|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 10 (May 15), 2000:
pp. 3208-3213
NEOPLASIA
Hypermethylation of E-cadherin in leukemia
John R. Melki,
Paul C. Vincent,
Ross D. Brown, and
Susan J. Clark
From Kanematsu Laboratories, Royal Prince Alfred Hospital,
Camperdown, NSW 2050, Australia; Faculty of Medicine, University of
Sydney, Sydney, NSW, 2006, Australia; Institute of Haematology, Royal
Prince Alfred Hospital, Camperdown, NSW 2050, Australia; CSIRO,
Molecular Science Sydney Laboratory, PO Box 184, North Ryde, SW 1670, Australia.
 |
Abstract |
E-cadherin gene is often termed a "metastasis suppressor" gene
because the E-cadherin protein can suppress tumor cell invasion and
metastasis. Inactivation of the E-cadherin gene occurs in undifferentiated solid tumors by both genetic and epigenetic
mechanisms; however, the role of E-cadherin in hematologic malignancies
is only now being recognized. E-cadherin expression is essential for
erythroblast and normoblast maturation, yet expression is reduced or
absent in leukemic blast cells. This study examined the messenger RNA
(mRNA) and protein expression of the E-cadherin gene in bone
marrow and blood samples from normal donors and patients with leukemia.
We found that all normal donor samples expressed E-cadherin mRNA,
whereas both samples of acute myelogenous leukemia and chronic
lymphocytic leukemia had a significant reduction or absence of
expression. However, normal blast counterparts expressed only a low
level of E-cadherin surface protein. Sodium bisulphite genomic
sequencing was used to fully characterize the methylation patterns of
the CpG island associated with the E-cadherin gene promoter in
those samples with matched DNA. All of the normal control samples were
essentially unmethylated; however, 14 of 18 (78%) of the leukemia
samples had abnormal hypermethylation of the E-cadherin CpG island. In
fact both alleles of the E-cadherin gene were often
hypermethylated. We conclude the E-cadherin gene is a common
target for hypermethylation in hematologic malignancies.
(Blood. 2000;95:3208-3213)
© 2000 by The American Society of Hematology.
 |
Introduction |
The E-cadherin gene (E-cad) on
chromosome 16q22.1 encodes a protein product important in the
maintenance of the epithelial phenotype mediated by a
Ca++-dependent, homotypic cell-cell adhesion (reviewed in
reference 1). The gene has been termed a "metastasis suppressor"
gene, because the E-cadherin protein can suppress tumor cell invasion
and metastasis.2 E-cad gene expression is reduced
or silenced in carcinomas of the breast3 and
liver4 and many cell lines including those from colon,
stomach, and prostate.5 These carcinomas are generally poorly differentiated, and reduced E-cad gene expression has
been shown to correlate with disease aggressiveness in prostate or breast cancer.2 E-cadherin recently was found to have an
unexpected role in hematopoiesis, the E-cadherin protein being
functionally involved in the maturation of erythroid
progenitors.6 Leukemic blasts, however, had no detectable
E-cad gene in acute lymphoblastic leukemia (ALL), chronic
myeloblastic leukemia (CML), and acute myeloblastic leukemia
(AML).7
The underlying mechanism of reduced or absent E-cad gene
expression in solid malignancies is not clear; however,
trans-acting pathways,8 allelic loss, 9
chromatin rearrangement,10 mutation,11 and
hypermethylation3-5,12 of the cytosine residues in the
CpG-rich promoter regions (CpG islands) have all been implicated. Normal cytosine methylation patterns are established early in development by the processes of demethylation and de novo methylation primarily at the cytosines of CpG dinucleotides (reviewed in reference 13). These methylation patterns are faithfully maintained through subsequent cell division by the DNA methyltransferase enzyme (DNA MTase).14 Changes in DNA cytosine methylation patterns are
common in solid and hematologic malignancies, with both hypomethylation and hypermethylation15,16 and a concurrent increase in the levels of DNA MTase.17 It is the aberrant
hypermethylation of CpG islands that is of particular interest to
cancer biology because there is a strong association with gene
inactivation.18 Although most CpG dinucleotides in a normal
cell are methylated, the CpG dinucleotides comprising CpG islands are
essentially unmethylated in all tissues,19 but appear to
become hypermethylated in specific tumor suppressor genes in most
malignancies including leukemia.15,18
Because changes in methylation patterns are common in leukemia, we
determined the role that DNA methylation might play in the reduction of
E-cad gene expression in leukemic blast cells. In this report,
we confirm a reduction or silencing of the expression levels of E-cad
mRNA in blood and bone marrow from patients with leukemia when compared
with normal donors. We also determined the detailed methylation
patterns of 29 CpG sites in the E-cad gene CpG island using the
technique of sodium bisulphite genomic sequencing,20-22 and
show that bi-allelic hypermethylation of the E-cad gene CpG
island is common in leukemia.
 |
Materials and methods |
Tissue samples
Blood samples obtained by venous aspiration or bone marrow samples
obtained by aspiration were collected from patients presenting with
either AML, ALL, or CLL. Lymphocytes were isolated from the blood
samples by a Ficoll-Paque gradient as per manufacturer's instructions
(Amersham Pharmacia Biotech AB, Uppsala, Sweden), and bone marrow cells
were collected by centrifugation following lysis in hypotonic lysis
buffer. The proportion of marrow blasts, where known, was more than
70%. The bone marrow used as a normal control was aspirated from the
sternal cavity from patients undergoing cardiac surgery who had given
prior informed consent, and the normal blood was obtained from regular
donors to the blood bank. The study was approved by the Ethics
Committee of Royal Prince Alfred Hospital. DNA and RNA were isolated
using TriZOL reagent (Gibco-BRL, Life Technologies, Gaithersburg, MD).
mRNA expression analysis (reverse transcriptase-polymerase chain
reaction [RT-PCR])
Complementary DNA (cDNA) was reverse transcribed from 1 to 2 µg of
total RNA in a 25-µL reaction using AMV reverse transcriptase (Promega, Madison, WI) as per the manufacturer's instructions. The
reaction was primed with 0.5 to 1 µg of random hexamers (Boehringer, Mannheim, Germany). Both E-cadherin and transferrin receptor RT-PCR reactions used the same cDNA synthesis. The PCR reactions were performed in volumes of 25 µL consisting of 200 µmol/L dNTPs, 100 ng primers, 1.75 mmol/L or 2.0 mmol/L MgCl2 (for E-cadherin and transferrin receptor, respectively), 1.0 µCi [33P]- dATP, and 2 units AmpliTaq DNA polymerase (Perkin-Elmer, Norwalk, CT) with 1 µL (transferrin receptor) or 2 µL (E-cadherin) of cDNA in
the manufacturer's buffer (Perkin-Elmer). Transferrin receptor was
amplified to control for RNA integrity. The primers used for the
amplification of transferrin receptor mRNA were Trans5'
(1764-1786): CTGTTGTATACGCTTATTGAGAA and Trans3' (2064-2086):
CTAACCCATGATGTTGAATTGAA; the primer coordinates in parentheses refer to
accession number X01060. The primers for the amplification of
E-cad gene mRNA were Ecad3 (2071-2094):
GGTGGGTGACTACAAAATCAATCT, and Ecad2 (2357-2380): TTCTCCGCCTCCTTCTTCATCATA, accession number Z13009. Reactions were
performed in a Hybaid DNA Thermal Cycler (Ashford, UK) under the following conditions: E-cadherin 96°C/4 minutes for
1 cycle; 95°C/60 seconds, 62°C/90 seconds, 72°C/90 seconds
for 5 cycles; 95°C/60 seconds, 64°C/60 seconds, 72°C/60
seconds for 25 cycles; 72°C/180 seconds for 1 cycle. Transferrin
receptor: 96°C/4 minutes for 1 cycle; 95°C/60 seconds,
60°C/90 seconds, 72°C/90 seconds for 5 cycles; 95°C/60
seconds, 60°C/60 seconds, 72°C/60 seconds for 25 cycles; and
72°C/180 seconds for 1 cycle. Products were electrophoresed on a
6% acrylamide gel, dried, and exposed to a PhosphorImager
(Molecular Dynamics, Sunnyvale, CA).
Surface expression analysis (FACS)
To determine the extent to which normal counterpart cells express
E-cadherin protein, 1 mL normal mononuclear bone marrow cells separated
by centrifugation through Ficoll-Paque or 5 mL normal blood was
analyzed. The cells were incubated with 20 µL rabbit polyclonal
anti-E-cadherin antibody (Santa Cruz Biotechnology, Santa Cruz, CA)
according to the manufacturer's directions, and visualized by adding 2 µL of sheep antirabbit fluorescein isothiocyanate (FITC)-labeled
monoclonal antibody (Silenus, Hawthorn, Australia). The cells were
labeled with 10 µL phycoerythrin-labeled murine monoclonal anti-CD34
antibody (Becton Dickinson, Mountain View, CA) according to the
manufacturer's directions, and a second tube was labeled using 20 µL
phycoerythrin-labeled murine monoclonal anti-glycophorin A antibody
(DAKO, Carpinteria, CA). Flow cytometric data were acquired on a
Coulter EPICS-XL-MCL flow cytometer (BeckmanCoulter, Hialeah, FL).
Methylation analysis
Bisulphite genomic sequencing was used to determine the methylation
pattern of the E-cadherin CpG island. The bisulphite reaction was
carried out for 16 hours at 55°C on 1 to 2 µg of Hind III digested patient DNA in 18 µL, under conditions described
in Clark et al.21 Following bisulphite conversion, the DNA
was ethanol precipitated, dried, and resuspended in 100 µL TE (10 mmol/L Tris-HCl, pH 8; 1 mmol/L EDTA) and stored at
20°C.
The CD34+ cells were isolated from normal bone marrow and
peripheral blood using Dynabeads M-450 Rat antimouse IgG1 magnetic beads (Dynal, Carlton, Australia), according to the manufacturer's instructions (direct technique). A total of 3.75 µg murine monoclonal anti-CD34 antibody (Becton Dickinson) was conjugated to 200 µL Dynabeads, and 100 µL was added to each bone marrow and peripheral blood sample. The CD34+ cells were lysed while still
conjugated to the Dynabeads by the addition of 200 µL cell lysis
buffer (100 mmol/L Tris-HCl, pH 8, 3% sodium dodecyl sulfate (SDS), 50 mmol/L EDTA, 200 µg/mL Proteinase K) and an 18-µL aliquot was
treated with sodium bisulphite as outlined above.
A nested PCR was performed using the following primers: outer1
(791-820): ATTTAGTGGAATTAGAATAGTGTAGGTTTT; outer2 (1139-1165): CTACAACTCCAAAAACCCATAACTAAC; inner1M13 (841-858):
TGTAAAACGACGGCCAGTTTAGTAATTTTAGGTTAGAGGG; inner2 (1139-1165):
CTACAACTCCAAAAACCCATAACTAAC; accession number L34545. The incorporation
of the ( 21)M13 universal primer sequence into the inner
primer enabled direct sequencing of the PCR product.
The nested PCR amplifications were performed on 2 µL of
bisulphite-treated genomic DNA in a reaction mix containing 200 µmol/L of each of the 4 dNTPs and 2 U AmpliTaq DNA polymerase
(Perkin-Elmer). The reactions were performed in 50-µL reactions
containing 67 mmol/L Tris, 16.6 mmol/L ammonium sulfate, 1.7 mg/mL
bovine serum albumin, 10 mmol/L -mercaptoethanol in TE buffer (10 mmol/L Tris-HCl, pH 8.0; 0.1 mmol/L EDTA) and 300 ng of each primer.
Reactions were cycled in a Hybaid DNA Thermal Cycler using the
following cycling conditions: 96°C/3 minutes for 1 cycle;
95°C/1 minute, 55°C/2 minutes, 72°C/3 minutes for 5 cycles;
95°C/1 minute, 55°C/2 minutes, 72°C/2 minutes for 23 cycles; and 72°C/4 minutes for 1 cycle. The primers used were shown
to amplify methylated and unmethylated DNA without notable bias under
these PCR conditions.23
Direct sequencing
The PCR products were purified using a WIZARD PCR clean-up column
(Promega), and direct PCR sequencing reactions were performed using a
PRISM Dye Primer Cycle sequencing kit ( 21M13 Fwd) with AmpliTaq
FS (Perkin-Elmer) and electrophoresed using an automated 373A DNA
Sequencer (ABI). Sequencing reactions were performed as recommended by
the manufacturer. The amount of methylcytosine of each CpG dinucleotide
was quantitated by comparing the peak height of the cytosine signal
with the peak height of the cytosine plus thymine signal.
Statistical analysis
Statistical analysis was performed using InStat v2.02 (Macintosh),
applying a nonparametric unpaired 2-tailed test.
 |
Results |
E-cad gene expression
To determine the expression levels of E-cad gene mRNA in
normal and leukemic cells, we used RT-PCR, coamplifying transferrin receptor (CD71) cDNA as a control for RNA integrity and cDNA synthesis. The transferrin receptor gene was chosen because it is widely expressed
on hematopoietic progenitors,24 and therefore any differential E-cad gene expression would be the result of
selective E-cad gene silencing. As shown in Figure
1, all the normal bone marrow and blood
controls expressed E-cadherin mRNA, whereas both AML and CLL samples
showed an overall reduction or absence of expression.

View larger version (64K):
[in this window]
[in a new window]
| Fig 1.
Expression analysis of the E-cad gene.
(A) E-cadherin and transferrin receptor RT-PCR products were amplified
from bone marrow samples from normal donors and patients with AML. (B)
E-cadherin and transferrin receptor RT-PCR products were amplified from
blood samples from normal donors and patients with CLL. E-cadherin PCR
product is 310bp, and the transferrin receptor PCR product is 323 bp.
The sample numbers are labeled above each lane (R, leukemic patient; N,
normal sample). The relative amount of E-cadherin expression versus
transferrin receptor expression (E-cad/transferrin) is expressed in the
graph.
|
|
To clarify whether the normal counterparts of leukemic cells express
E-cadherin protein on the cell surface, we assayed protein expression
in CD34+ cells by flow cytometry. Figure
2 shows that of the CD34+ cells
in the normal bone marrow, 12% expressed E-cadherin protein on the
cell surface. We found that the majority (85%) of the
glycophorin A-positive cells (erythroid cells) coexpressed E-cadherin
protein, similar to the findings of Buhring and coworkers.7
It is likely that the erythroid component contributed to the high
level of E-cadherin mRNA expression in unseparated normal marrow cells, although a low proportion of the normal blast counterparts did express
E-cadherin protein. Only a small proportion of CD19+
lymphocytes from normal (4%) or CLL blood (1%) expressed
E-cadherin protein on the cell surface (Figure 2). The
substantial E-cad gene mRNA expression in the Ficol-separated
fraction of normal blood may have been due to contaminating monocytes.

View larger version (67K):
[in this window]
[in a new window]
| Fig 2.
Two-color FACS analysis for E-cadherin cell surface
protein.
Coexpression of E-cadherin is shown for glycophorin A cells from normal
bone marrow (A), CD34 cells from normal bone marrow (B), CD19 cells
from CLL blood (C), and CD19 cells from normal blood (D).
|
|
Methylation profile of the E-cadherin gene CpG island
We determined the methylation profile of the E-cad gene CpG
island from patient samples and normal controls that had matched DNA,
to look for a possible mechanism that was responsible for the reduction
in E-cadherin expression. The E-cad gene has an associated CpG
island that incorporates the promoter, exon 1, and part of intron
1.25 The CpG island also contains the 191 minimal
promoter region important to E-cad gene
expression,5 and other transcription-enhancing factors such
as Sp1, E-Pal, and GC region10 (Figure
3). It is known that artificial methylation of the Hpa II sites, within this CpG island, is sufficient to inhibit transcription.5 However, previous studies have used methylation specific PCR (MSP) and Southern blot analysis that do not
give information on individual CpG sites.26,27 We have determined the methylation status of 29 CpG sites located within the
CpG island by bisulphite genomic sequencing to see if any CpG sites
were preferentially methylated, particularly those comprising transcription factor binding sites. To estimate the methylation levels
at each CpG site, within the population of molecules amplified, we used
direct PCR sequencing. Examples of the direct sequencing profiles,
containing the cytosine versus thymine tracks used for quantitation,
are shown in Figure 4. It is important in
quantitative analysis to ensure that both methylated and unmethylated
molecules amplify in proportion. Therefore, PCR conditions were
optimized to ensure representative amplification of methylated and
unmethylated molecules in the PCR product, as shown in Figure
4A.23

View larger version (44K):
[in this window]
[in a new window]
| Fig 3.
Map of the E-cad gene.
(A) CpG island plot across the 5' promoter region through to exon
2 (compiled from Genbank accession numbers L34545, L36526, and L34937).
The dark line is the %G+C, and the lighter line is the
observed/expected CpG density (O/E CpG). (B) Schematic representation
of the gene, where the black boxes represent the coding regions of exon
1 and exon 2. (C) The E-cad gene DNA sequence analyzed by
bisulphite genomic sequencing from bases 863-1138 (L34545),
incorporating 29 CpG sites. CpG dinucleotides are numbered below each
site. The Hpa II sites are underlined with a solid line, and
the GC region is underlined with a dotted line. Other features are
boxed and labeled. An arrow represents the transcription start site
between CpG sites 15 and 16. The identified polymorphism (A or T),
after bisulphite sequencing, is at coordinate 862, and is immediately
5' to CpG site 1. Bisulphite sequencing of this region identified
an additional thymine at *, which is not present in the published
sequence (L34545).
|
|

View larger version (53K):
[in this window]
[in a new window]
| Fig 4.
Direct PCR bisulphite sequencing profiles.
Electrophoretograms of the CpG region of the E-cad gene from
CpG dinucleotides 11-17 show the T peaks (dotted line) and C peaks
(solid line) only. Note the sequence given within each panel is that of
the bisulphite-converted DNA, except for the CpG dinucleotides that are
shown as CG. The estimated amounts of methylcytosine, calculated by
measuring the peak height of the cytosine over the peak heights of the
cytosine plus thymine, are shown under each dinucleotide, where indicates 0% methylation, + 1% to 25% methylation, ++ 26% to 50%
methylation, +++ 51% to 75% methylation, and ++++ 76% to 100%
methylation. (A) 50% methylated control PCR reaction, as described in
Warnecke et al.23 (B) AML patient R99, with methylation
throughout the region. (C) Normal bone marrow control N43, with no
methylation evident throughout the region.
|
|
Six normal, 10 AML, and 4 CLL samples that had been assessed for
E-cad gene expression by RT-PCR also had matched DNA that was
available for methylation analysis. In addition, N40 (normal), R36
(AML), R124 (CLL), and 2 ALL patients who did not have corresponding RNA were analyzed for DNA methylation. Of the 7 normal bone marrow samples, only 1 (N34) of 7 (14%) had any detectable methylation; however, the methylation was at a low level (< 25%) and was
restricted to only 5 of the 29 CpG sites (Figure
5A). Moreover, the CD34+ cells
isolated from normal bone marrow were essentially unmethylated as shown
by direct PCR sequencing (Figure 5B). To determine if there was a low
level of methylation in individual molecules, the PCR fragment from the
CD34+ cells was cloned and sequenced. Four of the 10 molecules sequenced showed no evidence of methylation, whereas the
other molecules showed methylation at 1 to 3 individual CpG sites;
however, these sites varied between molecules (Figure 5B).

View larger version (115K):
[in this window]
[in a new window]
| Fig 5.
Methylation maps of E-cad gene CpG island.
(A) Summary of the direct PCR sequencing analysis for normal and
leukemic samples. The sample number and leukemia subtype (FAB
classification) are in the left column, and the CpG sites are numbered
across the top row. represents up to 25%
methylation, represents 26% to 50% methylation,
represents 51% to 75% methylation,
represents 76% to 100% methylation, and
represents no methylation, as determined by direct
PCR sequencing. Absence of a score indicates that the methylation at
that site was unable to be determined due to enzyme stoppage in the
sequence. (B) Methylation results for CD34+ cells. The top
row represents the direct sequencing results, followed by the
methylation patterns for 10 cloned molecules. + indicates a methylated
CpG site and indicates an unmethylated CpG
site.
|
|
In contrast to the normal samples, 14 of 18 (78%) samples from
patients with leukemia displayed extensive methylation across the
E-cad gene CpG island (Figure 5A). A hypermethylated phenotype was found in cells from all leukemic subtypes, including 9 of 11 (82%)
AML patients, 2 of 2 (100%) ALL patients, and 3 of 5 (60%) CLL
patients, with extensive hypermethylation spanning the E-cad
gene CpG island. The methylation patterns were heterogeneous, ranging
from limited methylation in some patients (eg, R36, R37, R62, and R102)
to methylation in each determinable CpG site (R76 and R99). The
methylation patterns were not restricted to Hpa II or
transcription factor sites, but rather encompassed the entire region analyzed.
Bi-allelic E-cadherin methylation
In some patient samples, the degree of methylation at individual CpG
sites was high (50%-100%) in particular in the 3' region that
corresponds to exon 1 and the core of the CpG island. This high degree
of methylation reflected either that the methylation was bi-allelic, or
that 1 allele was deleted. To address whether methylation of the
E-cad gene was bi-allelic we identified an informative
polymorphism (T or A) within the sequenced region. Approximately 50%
of the normal and leukemia patients were heterozygous for the
polymorphism. We cloned and sequenced the PCR products from 2 patients
who were heterozygous for the polymorphism, AML patient (R38) and ALL
patient (R30). Figure 6 shows that
methylation across the E-cad gene CpG island was bi-allelic for
both R38 and R30 because the clones containing either the T or A
polymorphism were methylated. In addition, the degree of methylation,
as well as the methylation profile, appeared to be similar for each
allele. Although only a small number of clones were analyzed, the level of methylation reflected the direct sequencing methylation estimates. We also cloned and sequenced the PCR product from an AML patient (R99)
who was homozygous for the polymorphism (Figure 6). All the molecules
sequenced from R99, except for 1, were heavily methylated. Because the
methylation profiles from most of the molecules were similar, it is
unclear whether R99 had lost 1 allele, or whether hypermethylation was
also bi-allelic.

View larger version (29K):
[in this window]
[in a new window]
| Fig 6.
Bi-allelic methylation of E-cadherin.
The methylation status at each CpG site (1-29), as determined by
cloning and sequencing the PCR products amplified from
bisulphite-treated DNA from R30, R38, and R99. The direct sequence
methylation estimates are shown above (Figure 5). The polymorphism (A
or T) identified in each molecule is given in the last
column.
|
|
 |
Discussion |
The E-cad gene is important in the metastatic potential of
tumors as its expression confers "metastasis suppressing"
properties to the malignant cells.1 Diminished
E-cad gene expression is associated with poorly
differentiated aggressive carcinomas and is a prognostic marker of poor
clinical outcome in some tumors. The role of E-cadherin in
hematopoiesis and leukemia is not clear. Although E-cadherin protein is
mainly found on the cell surface of epithelial cells, it has also been
established that colony-forming units-erythrocytes (CFU-E),
normoblasts, and erythroblasts express E-cadherin.6,7
Indeed erythroid progenitor cells are dependent on E-cad gene
expression for maturation.6 Our data show that a small
proportion of normal CD34 progenitor cells express E-cadherin on the
cell surface, similar to the results of others.6,7 However,
cells from patients with acute leukemia and CLL show reduced or absent
E-cadherin mRNA expression. Normal CD34+ stem cells
circulate continuously in the blood,28,29 as do most
leukemic cells, and it is conceivable that this ability to leave the
marrow microenvironment could be related to decreased E-cad
gene expression.
Reduced E-cad gene expression could be mediated by a number of
mechanisms including mutation, loss of heterozygosity,
trans-acting pathways, chromatin rearrangement, or DNA
hypermethylation of the CpG island. Alterations in DNA methylation
patterns are commonly found in essentially all cancers, often with
concomitant changes in gene expression.18 Changes in
methylation patterns are common in leukemia16 and leukemic
blast cells have an elevated expression of DNA MTase.17 In
this study, we analyzed E-cad gene methylation across 29 CpG
sites in the CpG-rich promoter region using sodium bisulphite analysis.
We found hypermethylation in DNA from 78% of patients with leukemia,
including both acute and chronic types (AML, ALL, and CLL). The
methylation profile across the CpG island was heterogeneous, with no
single CpG site consistently methylated. The transcription enhancing
elements Sp1, E-Pal, and the GC box did not appear to differ in the
amount of de novo methylation with respect to the rest of the CpG
island. This is similar to the methylation patterns we have
characterized for other genes in both cancer and normal
cells30-32 and supports the idea that it is not the
methylation of critical CpG sites in vivo that is important for gene
silencing. Furthermore, the density of methylation in the CpG island
also did not appear to be linked to gene expression because a small
number of patient samples had absent (eg, R113) or limited (eg, R126)
E-cadherin expression without corresponding methylation of the CpG
island promoter. These results support the possibility that gene
silencing is a precursor to aberrant CpG island methylation in cancer.
The mechanism of CpG island methylation in cancer is unclear. Graff et
al26 have reported that E-cad gene CpG island
methylation is initiated from flanking methylated Alu sequences, where
the methylation spreads into the body of the gene. Because the
methylation pattern found in our study was heterogeneous, it is not
clear if the methylation has spread from the ends of the CpG island or
was initiated within the CpG island. Our data support initiation of
methylation from within the CpG island because some samples had no
methylation in the beginning of the island that flanks the Alu
sequences but moderate methylation within the body of the CpG island,
whereas other samples were extensively methylated throughout the
region. In addition, a low level of methylation was found to exist at
individual CpG sites in some molecules in the normal CD34+
counterparts. This raises an interesting possibility that in leukemia
the hypermethylation of the E-cad gene CpG island may be
triggered by a combination of elevated expression of DNA
MTase17 and a low level of methylated CpG sites in the CpG
island. These CpG sites could act as seeds to aid methylation expansion
across the CpG island. The hypermethylated foci are found scattered in different positions throughout the island in different samples possibly
reflecting the distribution of the initial CpG sites that were
methylated in the normal cell.
The results of this study have given an insight into the E-cad
gene expression in hematopoiesis and hypermethylation in
leukemogenesis. The E-cadherin protein was expressed at only low levels
in normal CD34+ and CD19+ cells, despite the
E-cad gene CpG island being essentially unmethylated. In
contrast, hypermethylation in the E-cad gene CpG island was common in leukemic cells and was frequently found to be methylated on
both E-cad gene alleles. Therefore, there must be a mechanism common in the genesis of leukemia that renders the E-cad gene CpG island promoter region susceptible to hypermethylation.
 |
Acknowledgments |
We thank Cheryl Paul for the automated sequencing, and Dr Doug Millar
and Dr Alpha Yap for advice and helpful discussions.
 |
Footnotes |
Submitted July 6, 1999; accepted January 20, 2000.
J.R.M. is funded by the Anthony Rothe Memorial Trust postgraduate
scholarship and an Anthony Rothe Memorial Trust grant.
Reprints: Susan J. Clark, CSIRO Molecular Science, Sydney
Laboratory, PO Box 184, North Ryde, NSW 1670, Australia; e-mail:
susan.clark{at}molsci.csiro.au.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
 |
References |
1.
Jankowski JA, Bedford FK, Kim YS.
Changes in gene structure and regulation of E-cadherin during epithelial development, differentiation, and disease.
Prog Nucleic Acid Res Mol Biol.
1997;57:187[Medline]
[Order article via Infotrieve].
2.
Paul R, Ewing CM, Jarrard DF, Isaacs WB.
The cadherin cell-cell adhesion pathway in prostate cancer progression.
Br J Urol.
1997;79:37.
3.
Graff JR, Herman JG, Lapidus RG, et al.
E-cadherin expression is silenced by DNA hypermethylation in human breast and prostate carcinomas.
Cancer Res.
1995;55:5195[Abstract/Free Full Text].
4.
Kanai Y, Ushijima S, Hui AM, et al.
The E-cadherin gene is silenced by CpG methylation in human hepatocellular carcinomas.
Int J Cancer.
1997;71:355[Medline]
[Order article via Infotrieve].
5.
Yoshiura K, Kanai Y, Ochiai A, Shimoyama Y, Sugimura T, Hirohashi S.
Silencing of the E-cadherin invasion-suppressor gene by CpG methylation in human carcinomas.
Proc Natl Acad Sci U S A.
1995;92:7416[Abstract/Free Full Text].
6.
Armeanu S, Buhring HJ, Reuss-Borst M, Muller CA, Klein G.
E-cadherin is functionally involved in the maturation of the erythroid lineage.
J Cell Biol.
1995;131:243[Abstract/Free Full Text].
7.
Buhring HJ, Muller T, Herbst R, et al.
The adhesion molecule E-cadherin and a surface antigen recognized by the antibody 9C4 are selectively expressed on erythroid cells of defined maturational stages.
Leukemia.
1996;10:106[Medline]
[Order article via Infotrieve].
8.
Ji X, Woodard AS, Rimm DL, Fearon ER.
Transcriptional defects underlie loss of E-cadherin expression in breast cancer.
Cell Growth Differ.
1997;8:773[Abstract].
9.
Hiraguri S, Godfrey T, Nakamura H, et al.
Mechanisms of inactivation of E-cadherin in breast cancer cell lines.
Cancer Res.
1998;58:1972[Abstract/Free Full Text].
10.
Hennig G, Behrens J, Truss M, Frisch S, Reichmann E, Birchmeier W.
Progression of carcinoma cells is associated with alterations in chromatin structure and factor binding at the E-cadherin promoter in vivo.
Oncogene.
1995;11:475[Medline]
[Order article via Infotrieve].
11.
Guilford P, Hopkins J, Harraway J, et al.
E-cadherin germline mutations in familial gastric cancer.
Nature.
1998;392:402[Medline]
[Order article via Infotrieve].
12.
Saito Y, Takazawa H, Uzawa K, Tanzawa H, Sato K.
Reduced expression of E-cadherin in oral squamous cell carcinoma: relationship with DNA methylation of 5' CpG island.
Int J Oncol.
1998;12:293[Medline]
[Order article via Infotrieve].
13.
Turker MS, Bestor TH.
Formation of methylation patterns in the mammalian genome [see comments].
Mutat Res.
1997;386:119[Medline]
[Order article via Infotrieve].
14.
Holliday R.
DNA methylation and epigenetic inheritance.
Philos Trans R Soc Lond B Biol Sci.
1990;326:329[Abstract/Free Full Text].
15.
Melki J, Vincent P, Clark S.
Concurrent DNA hypermethylation of multiple genes in acute myeloid leukemia.
Cancer Res.
1999;59:3730[Abstract/Free Full Text].
16.
Issa JP, Baylin SB, Herman JG.
DNA methylation changes in hematologic malignancies: biologic and clinical implications.
Leukemia.
1997;11:S7.
17.
Melki J, Warnecke P, Vincent P, Clark S.
Increased DNA methyltransferase expression in leukemia.
Leukemia.
1998;12:311[Medline]
[Order article via Infotrieve].
18.
Baylin SB, Herman JG, Graff JR, Vertino PM, Issa JP.
Alterations in DNA methylation: a fundamental aspect of neoplasia.
Adv Cancer Res.
1998;72:141[Medline]
[Order article via Infotrieve].
19.
Bird AP.
CpG-rich islands and the function of DNA methylation.
Nature.
1986;321:209[Medline]
[Order article via Infotrieve].
20.
Frommer M, McDonald LE, Millar DS, et al.
A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands.
Proc Natl Acad Sci U S A.
1992;89:1827[Abstract/Free Full Text].
21.
Clark SJ, Harrison J, Paul CL, Frommer M.
High sensitivity mapping of methylated cytosines.
Nucleic Acids Res.
1994;22:2990[Abstract/Free Full Text].
22.
Clark SJ, Frommer M.
Bisulphite genomic sequencing of methylated cytosines. In:
Taylor GR, ed.
Laboratory Methods for the Detection of Mutations and Polymorphisms in DNA. New York: CRC Press; 1997:151.
23.
Warnecke PM, Stirzaker C, Melki JR, Millar DS, Paul CL, Clark S.
Detection and measurement of PCR bias in quantitative methylation analysis of bisulphite-treated DNA.
Nucleic Acids Res.
1997;25:4422[Abstract/Free Full Text].
24.
Levy JE, Jin O, Fujiwara Y, Kuo F, Andrews NC.
Transferrin receptor is necessary for development of erythrocytes and the nervous system.
Nat Genet.
1999;21:396[Medline]
[Order article via Infotrieve].
25.
Berx G, Staes K, van Hengel J, et al.
Cloning and characterization of the human invasion suppressor gene E-cadherin (CDH1).
Genomics.
1995;26:281[Medline]
[Order article via Infotrieve].
26.
Graff JR, Herman JG, Myohanen S, Baylin SB, Vertino PM.
Mapping patterns of CpG island methylation in normal and neoplastic cells implicates both upstream and downstream regions in de novo methylation.
J Biol Chem.
1997;272:22,322[Abstract/Free Full Text].
27.
Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB.
Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands.
Proc Natl Acad Sci U S A.
1996;93:9821[Abstract/Free Full Text].
28.
To LB, Haylock DN, Simmons PJ, Juttner CA.
The biology and clinical uses of blood stem cells.
Blood.
1997;89:2233[Free Full Text].
29.
Fliedner TM.
The role of blood stem cells in hematopoietic cell renewal.
Stem Cells.
1998;16:361[Abstract/Free Full Text].
30.
Millar DS, Ow KK, Paul CL, Russell PJ, Molloy PL, Clark SJ.
Detailed methylation analysis of the glutathione S-transferase Pi (GSTP1) gene in prostate cancer.
Oncogene.
1999;18:1313[Medline]
[Order article via Infotrieve].
31.
Stirzaker C, Millar DS, Paul CL, et al.
Extensive DNA methylation spanning the Rb promoter in retinoblastoma tumors.
Cancer Res.
1997;57:2229[Abstract/Free Full Text].
32.
Warnecke PM, Clark SJ.
DNA methylation profile of the mouse skeletal alpha-actin promoter during development and differentiation.
Mol Cell Biol.
1999;19:164[Abstract/Free Full Text].

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. A. Dubovsky, D. G. McNeel, J. J. Powers, J. Gordon, E. M. Sotomayor, and J. A. Pinilla-Ibarz
Treatment of Chronic Lymphocytic Leukemia with a Hypomethylating Agent Induces Expression of NXF2, an Immunogenic Cancer Testis Antigen
Clin. Cancer Res.,
May 15, 2009;
15(10):
3406 - 3415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Agrawal, W.-K. Hofmann, N. Tidow, M. Ehrich, D. v. d. Boom, S. Koschmieder, W. E. Berdel, H. Serve, and C. Muller-Tidow
The C/EBP{delta} tumor suppressor is silenced by hypermethylation in acute myeloid leukemia
Blood,
May 1, 2007;
109(9):
3895 - 3905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Raval, D. M. Lucas, J. J. Matkovic, K. L. Bennett, S. Liyanarachchi, D. C. Young, L. Rassenti, T. J. Kipps, M. R. Grever, J. C. Byrd, et al.
TWIST2 Demonstrates Differential Methylation in Immunoglobulin Variable Heavy Chain Mutated and Unmutated Chronic Lymphocytic Leukemia
J. Clin. Oncol.,
June 10, 2005;
23(17):
3877 - 3885.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Roman-Gomez, A. Jimenez-Velasco, J. A. Castillejo, X. Agirre, M. Barrios, G. Navarro, F. J. Molina, M. J. Calasanz, F. Prosper, A. Heiniger, et al.
Promoter hypermethylation of cancer-related genes: a strong independent prognostic factor in acute lymphoblastic leukemia
Blood,
October 15, 2004;
104(8):
2492 - 2498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Takahashi, N. Shivapurkar, J. Reddy, H. Shigematsu, K. Miyajima, M. Suzuki, S. Toyooka, S. Zochbauer-Muller, J. Drach, G. Parikh, et al.
DNA Methylation Profiles of Lymphoid and Hematopoietic Malignancies
Clin. Cancer Res.,
May 1, 2004;
10(9):
2928 - 2935.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. J. Rush, A. Raval, P. Funchain, A. J. Johnson, L. Smith, D. M. Lucas, M. Bembea, T.-H. Liu, N. A. Heerema, L. Rassenti, et al.
Epigenetic Profiling in Chronic Lymphocytic Leukemia Reveals Novel Methylation Targets
Cancer Res.,
April 1, 2004;
64(7):
2424 - 2433.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Yates, R. Burman, J. Simpson, O. N. Ponomoreva, M. J. Thayer, and M. S. Turker
Silencing of Mouse Aprt Is a Gradual Process in Differentiated Cells
Mol. Cell. Biol.,
July 1, 2003;
23(13):
4461 - 4470.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Galm, H. Yoshikawa, M. Esteller, R. Osieka, and J. G. Herman
SOCS-1, a negative regulator of cytokine signaling, is frequently silenced by methylation in multiple myeloma
Blood,
April 1, 2003;
101(7):
2784 - 2788.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Shen, Y. Kondo, J.-P. Issa, G. Garcia-Manero, J. Roman-Gomez, J. A. Castillejo, A. Torres, and A. Jimenez
Lack of p21CIP1 DNA methylation in acute lymphocytic leukemia
Blood,
October 16, 2002;
100(9):
3432 - 3433.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Garcia-Manero, J. Daniel, T. L. Smith, S. M. Kornblau, M.-S. Lee, H. M. Kantarjian, and J.-P. J. Issa
DNA Methylation of Multiple Promoter-associated CpG Islands in Adult Acute Lymphocytic Leukemia
Clin. Cancer Res.,
July 1, 2002;
8(7):
2217 - 2224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. F Costello and C. Plass
Methylation matters
J. Med. Genet.,
May 1, 2001;
38(5):
285 - 303.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
I. Poser, D. Dominguez, A. G. de Herreros, A. Varnai, R. Buettner, and A. K Bosserhoff
Loss of E-cadherin Expression in Melanoma Cells Involves Up-regulation of the Transcriptional Repressor Snail
J. Biol. Chem.,
June 29, 2001;
276(27):
24661 - 24666.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|