| |
|
|
|
|
|
|
|||
|
Blood, Vol. 95 No. 11 (June 1), 2000:
pp. 3349-3356
HEMATOPOIESIS
From the Laboratory of Molecular Growth Regulation, National
Institute of Child Health and Human Development; the Laboratory of
Cellular Carcinogenesis and Tumor Promotion, National Cancer Institute;
and the Flow Cytometry Unit and Laboratory of Immunopathology, National
Institute of Allergy and Infectious Diseases, National Institutes of
Health, Bethesda, MD
To examine the role of retinoids in hematopoietic cell growth in
vivo, we studied female SENCAR mice made vitamin A deficient by dietary
restriction. Deficient mice exhibited a dramatic increase in myeloid
cells in bone marrow, spleen, and peripheral blood. The abnormal
expansion of myeloid cells was detected from an early stage of vitamin
A deficiency and contrasted with essentially normal profiles of T and B
lymphocytes. This abnormality was reversed on addition of retinoic acid
to the vitamin A-deficient diet, indicating that the myeloid cell
expansion is a direct result of retinoic acid deficiency. TUNEL
analysis indicated that spontaneous apoptosis, a normal process in the
life cycle of myeloid cells, was impaired in vitamin A-deficient mice,
which may play a role in the increased myeloid cell population.
Quantitative reverse transcriptase-polymerase chain reaction analysis
of purified granulocytes showed that expression of not only RAR, but
RXRs, 2 nuclear receptors that mediate biologic activities of
retinoids, was significantly reduced in cells of deficient mice. This
work shows that retinoids critically control the homeostasis of myeloid
cell population in vivo and suggests that deficiency in this signaling
pathway may contribute to various myeloproliferative disorders.
(Blood. 2000;95:3349-3356)
Retinoids are derivatives of vitamin A that control
cell growth, differentiation, and apoptosis in many types of cells.
They are also essential for embryonic development of many vertebrate species. In addition, retinoids confer resistance to various
pathogens1,2 and elicit preventive as well as
therapeutic activities against certain tumors.3-5
Two types of nuclear hormone receptors, RAR and RXR, are responsible
for mediating biologic activities of retinoids.6-8 Both RAR
and RXR bind to retinoids and their analogues through the ligand
binding domain. These receptors form RXR/RAR heterodimers, bind to the
retinoic acid (RA)-responsive element through their DNA binding domain,
and activate transcription of many retinoid responsive genes. Both RAR
and RXR have 3 subtypes, This study was designed to investigate the effects of vitamin A
deficiency on mouse hematopoietic cell growth. This work was prompted
by previous observations made with tissue culture cells of
hematopoietic origin, which showed that retinoids have a pivotal role
in their development.21-24 We found a dramatic increase in granulocytes in virtually all deficient mice, which occurred at a
relatively early stage of deficiency and persisted for the duration of
dietary restriction. Supporting a direct role of retinoids in
regulating myelopoiesis, on dietary supplementation with a physiologic
dose of RA, the number of granulocytes fell to a nearly normal level.
Our results indicate that this increase was due to impaired apoptosis
of granulocytes. Further, we show that expression of RXR Vitamin A-deficient (RA Measurement of liver retinol and retinylpalmitate levels
Cytokine gene expression by RNAse protection assay RNase protection analysis was performed using the multiprobe mouse cytokine template, mCK-2 (PharMingen, San Diego, CA), as detailed in our previous paper.27 Serum interleukin (IL)-1 (IL-1 )
levels were measured by enzyme-linked immunosorbent assay using a kit
according to the manufacturer's instructions (R& D Systems,
Minneapolis, MN).
Flow cytometry analysis and histology Cells (5 × 105) suspended in RPMI 1640 were first treated with anti-FcR antibody, washed, and then incubated
with fluorescein isothiocyanate (FITC)-conjugated monoclonal antimouse
CD4, anti-IgM, or anti-Mac-1 (CD11b) antibodies in combination with
phycoerythrin (PE)-conjugated anti-CD8, anti-B220 (CD45), or
anti-Gr-1(Ly-6G) antibodies, respectively (all antibodies from
PharMingen). Stained cells were analyzed on a FACScan interfaced with
the Cellquest software (Becton Dickinson, San Jose, CA). For reverse
transcriptase-polymerase chain reaction (RT-PCR) analysis,
granulocytes were purified from RA+ or RA
spleens by FACS sorting using FITC-labeled anti-Gr-1 antibody. Spleens
of 6 mice were pooled prior to sorting. Sorting was performed on Becton
Dickinson FACS Vantage Cell Sorter equipped with a Turbo-Sort option.
The RA sorted cells were 95% pure and RA+
sorted cells were 90% pure.
Colony-forming assay Colony-forming assays were performed using the methylcellulose-based media (Stem Cell Technology, Vancouver, Canada). Bone marrow cells (15 × 103) were cultured for 10 days in 1 mL of the media (MethoCult GF M 3534) designed to support the formation of colonies derived from the myeloid lineage for 10 days. The media contained 50 ng/mL of recombinant mouse stem cell factor, 10 ng/mL of recombinant murine IL-3 (rmIL-3) and 10 ng/mL of recombinant human IL-6, among other components. Colony-forming assays were also performed using a serum-free medium, MethoCult M3236, from the same vender.TdT-mediated dUTP biotin nick end labeling (TUNEL) assay Spleen cells (2 × 107) were incubated in 5 mL of RPMI 1640 supplemented with 10% fetal bovine serum (FBS) for 24 hours. Cells stained with PE-conjugated monoclonal antibodies to CD3, B220, or Gr-1 antibodies were fixed with 1% paraformaldehyde in PBS for 15 minutes, washed in PBS, and incubated in 1 nmol/L biotin-conjugated dUTP and 5 U terminal transferase (both from Boehringer Mannheim, IN) in 50 µL reaction mixture.28,29 Cells were washed in sodium-citrate buffer (0.1% TritonX-100 and 5% dry milk in 4 × standard sodium citrate), incubated with 2.5 µL of avidin-FITC (Boehringer Mannheim) for 30 minutes at room temperature and then washed in Hanks balanced salt solution containing 0.1% TritonX-100 and 0.5% BSA. Stained cells were analyzed on FACScan interfaced with Cellquest.Quantitative RT-PCR Total RNA was prepared from Gr-1+ cells sorted from 5 spleens or from bone marrow of individual mice in RNAsol (Tel-Test, Friendswood, TX). First strand complementary DNA (cDNA) was synthesized with Superscript II (Life Technology, Rockville, MD) according to the manufacturer's instruction. PCR reaction was performed at 94°C for 1 minute, at 55°C for 1 minute, at 72°C for 1.5 minutes for 35 cycles in the presence of 250 µmol/L dNTPs, 2.5 mmol/L MgCl2, and 500 nmol/L of 5' and 3' primers.30,31 The following pairs of PCR primers were used. RAR 5'-: CCGCATCTACAAGCCTTGC 3'-: TCCAGGGAGACTCGTTGTTC, RAR RAR 1 5'-:AGCCTGGCCCAGTATGTAGG, RAR 2,
5'-:ATCCCTTACCCCCCATGC, 3'-: CTTCACAGGAGCTGACCCCAT
(RAR common),12 RXR
5'-;GGTGAACTCTTCGTCCCTCAACT 3'-:
GTGAAGGAGGCCATATTTC, RAR 5'-:TAGGACCCGCGCGCTCCGGAG,
3'-ATTGAGCAGTATGCCGGTGCT, RXR 5'-:
AGCCCAGACAGCTCCTCCCCAAAT 3'-: GGACCACCTGGAGGGGGTGGA. Bax-1
5'-:GAGACACCTGAGCTGACCTT, 3'-GCACCAGTTTGCTAGCAAAG,
BclX-L5': GTGGCCTTTTTCTCCTTGG,3'-TTGAAGCGCTCCTGGCCTTT, MPO
5':TGTCAGTGAGAGGAGTTGAC, 3':ACCTCAGCTCAGGAAGTATC. Primer sets for
other genes were synthesized as described previously.32,33
PCR products were resolved on 1% agarose gel electrophoresis and
stained with ethidium bromide. Bands visualized in the UV
transilluminator were quantified in the Eagle-Eye system (Stratagene, CA).
Establishment of vitamin A deficiency in female SENCAR mice
(RA mice studied in this work were
likewise depleted of retinoids, we measured, by HPLC analysis, levels
of retinylpalmitate and retinol in liver, where much of the retinoids
are reposited.34 As seen in Figure
1, the mean levels of retinylpalmitate and
retinol both fell precipitously within 5 weeks after the initiation of dietary restriction. No retinol could be detected 2 weeks later, when
mice were 10 weeks of age. Similarly, retinylpalmitate levels reached
near zero levels starting at 8 weeks of feeding the deficient diet (11 weeks of age) and remained essentially undetectable thereafter. These
results confirm that complete retinoid deficiency in mice can be
attained by feeding a diet deficient in vitamin A, which provided a
foundation for this work. The RA mice did not show
external signs of infection and their sera were negative for a panel of
13 pathogens routinely tested in an animal facility. To look for other
signs of infection, expression of a series of cytokine genes known to
be stimulated in response to infections35-37 was examined
by RNase protection assay. Spleen samples from both RA
mice and control RA+ mice did not express detectable levels
of IL-12p40, IL-1 , IL-1 , IL-6, and interferon- transcripts
(not shown). In addition, serum levels of IL-1 in RA
mice were as low as control RA+ mice (17 and 18 pg/mL,
respectively).
Systemic expansion of myeloid cells in vitamin A-deficient mice Lymphoid tissues from RA mice were compared with
those of age- and sex- matched RA+ mice. Almost all mice in
the RA group exhibited marked splenomegaly by 14 weeks
of age, whereas spleens of RA+ mice were of normal size
(Figure 2A). The splenomegaly coincided with a marked increase in total cell number; spleens from
RA mice contained 50% to 70% more cells than those of
RA+ mice. Although less conspicuous, popliteal and
mesenteric lymph nodes of RA mice were also enlarged;
however, thymi appeared unaltered (not shown). Histologic examination
of RA spleens revealed extensive infiltration of
granulocytes obscuring the border between the white and red pulp
(Figure 2B). The cellular composition of bone marrow was also
drastically altered in RA mice; cells of the myeloid
lineage, both immature cells and mature granulocytes, were greatly
increased in RA bone marrow (Figure 2C). Peripheral
blood of RA mice also contained more granulocytes than
in control mice: 2900 to 3000 cells in 1 µL of RA
blood and 375 to 415 cells in 1 µL in RA+ blood (Figure
3B). Granulocytes in peripheral blood often
exhibited unusual hypersegmentation (Figure 2C).
Reversal of granulocyte increase after dietary RA repletion To test whether the observed granulocyte increase is reversible, 15-week-old mice maintained on the deficient diet were switched to the diet containing RA (3 µg/g diet). Figure 4 shows the percentage of Mac-1+/Gr-1+ cells in spleen and bone marrow after RA supplementation. As expected, mice fed continuously with the RA diet had more than twice the frequency of
Mac-1+/Gr-1+cells as those fed continuously
with the RA+ diet. However, when RA mice
were supplemented with RA for 2 weeks, the frequency of Mac-1+/Gr-1+ cells in bone marrow fell to an
essentially normal level (Figure 4), although 1 week of RA
supplementation did not have an effect (not shown). In spleen,
RA-supplemented mice showed a significant reduction in granulocytes at
1 week and further reduction in 2 weeks, although at the end of 2 weeks, their frequency was still slightly higher in RA-supplemented
mice than in control RA+ mice. Thus, vitamin A-deficient
mice can respond to RA and recover from abnormal expansion of myeloid
cells. The rapid reversibility by RA indicates that granulocyte
expansion is a direct result of vitamin A deficiency, rather than that
of an irreversible, secondary change.
Comparable colony formation by RA+ and
RA mice is attributed to alterations in the frequency of
myeloid cell progenitors. To this end, in vitro colony-forming assays were performed with bone marrow cells from RA+ and
RA mice using media designed to support the growth of
myeloid cell progenitors (see "Materials and methods"). Results
obtained from mice at 11, 13, and 15 weeks are shown in Figure
5. The number of colonies formed by
RA+ and RA bone marrow was similar in all
cases (20-40/104 cells). Differential counting of the
number of colony-forming units-granulocyte, -macrophage, and
-granulocyte/macrophage also yielded comparable results with
RA+ and RA cells. To exclude the possibility
that retinoids that might be present in the FBS in the media could have
obscured a difference in the 2 groups, similar assays were performed
with serum-free medium. Again, no significant difference was observed
between the 2 groups, ranging from 10/104 to
13/104 cells. These results indicate that the frequency of
progenitor cells capable of generating myeloid cell colonies was not
affected in RA mice.
Reduced spontaneous apoptosis of RA mice are defective in apopotosis, causing an
abnormal increase in their number. To examine this possibility, TUNEL
assay was used to detect spontaneous apoptosis of spleen cells from
RA+ and RA mice. Briefly, cells were
cultured overnight, marked for Gr-1, B220, or CD3, and then subjected
to TUNEL assay.29 Results obtained from 15-week-old mice
are shown in Figure 6. Neither B
(B220+) nor T cells (CD3+) from the 2 groups
showed a significant difference in the extent of apoptosis. In
contrast, the frequency of apoptotic cells in Gr-1+ cells
from RA mice was significantly lower than that from
RA+ mice (26% versus 53%). As might have been expected,
the frequency of apoptotic cells in total spleen cells were roughly
comparable between the RA+ and RA groups
(36%). Similar TUNEL assays were performed with 17- and 18-week-old
mice, and the percent apoptotic cells in the Gr-1+ cell
population was again lower in RA mice than that in
RA+ mice; the frequency of apoptotic cells in the
RA group ranged from 32% to 41%, whereas that in the
RA+ group ranged from 50% to 57%. These results indicate
that vitamin A deficiency leads to a reduction in spontaneous apoptosis
of the granulocyte population, although it does not completely
eliminate apoptosis.
Down-regulation of RAR and RXR expression in
RA and subtypes of the receptors. We also tested RAR because
this receptor is expressed in bone marrow Gr-1+
cells.12 To avoid a potential complication derived from
cellular heterogeneity, PCR analysis was performed with FACS-purified
granulocytes obtained from spleens. Three serially diluted RNA samples
were tested to ensure a linear range of reaction. Neither RAR nor RAR was detected in any samples tested (not shown). By contrast, expression of RAR , RXR , and RXR was clearly detectable in the samples from both groups (Figure 7A).
Importantly, expression of the 3 receptors was significantly lower in
RA cells than in RA+ cells. Levels of
hypoxanthine-guanine phosphoribosyltransferase (HPRT) RNA,
run as a control, were comparable in the 2 samples. To verify
down-regulation of RAR and RXR in RA cells, we tested
bone marrow RNA from 2 individual mice in each group. As seen in Figure
7B, levels of RAR , RXR , and RXR were again lower in
RA cells than in RA+ cells. Expression of
RAR was undetectable in bone marrow RNA, similar to the results seen
with purified granulocytes. Thus, expression of RAR and RXR is
down-regulated in myeloid cells in vitamin A-deficient mice,
indicating that expression of these receptors is regulated by the
retinoid status of the cells.
We have shown that vitamin A deficiency leads to a striking
expansion of myeloid cells in mice. The increase in Mac-1+/
Gr-1+ cells occurred at an early stage of deficiency and
persisted throughout the remaining period. The increase was first noted in bone marrow and subsequently spread to peripheral tissues, indicating that the abnormality originates in bone marrow. The onset of
the abnormality was noticeable within 1 to 2 weeks of retinoid
depletion in liver and established 5 to 7 weeks after the initiation of
the RA
We thank David Stephany and Ruth Swofford in the NIAID Flow Cytometry Unit for FACS analysis and granulocyte sorting, and Susan Kirkhoff for preparation of mice.
Submitted May 5, 1999; accepted January 28, 2000.
Reprints: Keiko Ozato, Laboratory of Molecular Growth Regulation, Bldg 6, Rm 2A01, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892-2753; e-mail: ozatok{at}nih.gov.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1. Hussey G, Klein M. A randomized, controlled trial of vitamin A in children with severe measles. New Engl J Med. 1990;323:160-164[Abstract]. 2. Ross AC, Stephensen CB. Vitamin A and retinoids in antiviral responses. FASEB J. 1996;10:979-985[Abstract]. 3. Chen I, De Luca L. Retinoids and Skin Cancer. Boca Raton, FL: CRC Press; 1995. 4. Tallman MS. Differentiating therapy in acute myeloid leukemia. Leukemia. 1996;10:12621268. 5. Chomienne C, Fenaux P, Degos L. Retinoid differentiation therapy in promyelocytic leukemia. FASEB J. 1996;10:1025-1030[Abstract]. 6. Mangelsdorf D, Evans RM. The RXR heterodimes and orphan receptors. Cell. 1995;83:841-850[Medline] [Order article via Infotrieve]. 7. Chambon P. A decade of molecular biology of retinoic acid receptors. FASEB J. 1996;10:940-954[Abstract]. 8. Minucci S, Ozato K. Retinoid receptors in transcriptional regulation. Curr Opin Genet Dev. 1996;6:567-574[Medline] [Order article via Infotrieve].
9.
Dolle P, Ruberte E, Leroy P, Morriss-Kay G, Chambon P.
Retinoic acid receptors and cellular retinoid binding proteins. I. A systematic study of their differential pattern of transcription during mouse organogenesis.
Development.
1990;110:1133-1151
10.
Li E, Sucov HM, Lee KF, Evans RM, Jaenisch R.
Normal development and growth of mice carrying a targeted disruption of the alpha 1 retinoic acid receptor gene.
Proc Natl Acad Sci U S A.
1993;90:1590-1594
11.
Lufkin T, Lohnes D, Mark M, et al.
High postnatal lethality and testis degeneration in retinoic acid receptor alpha mutant mice.
Proc Natl Acad Sci U S A.
1993;90:7225-7229
12.
Labrecque J, Allan D, Chambon P, Iscove NN, Lohnes D, Hoang T.
Impaired granulocytic differentiation in vitro in hematopoietic cells lacking retinoic acid receptors alpha1 and gamma.
Blood.
1998;92:607-615
13.
De Luca LM, Shores RL, Spangler EF, Wenk ML.
Inhibition of initiator-promoter-induced skin tumorigenesis in female SENCAR mice fed a vitamin A-deficient diet and reappearance of tumors in mice fed a diet adequate in retinoid or beta-carotene.
Cancer Res.
1989;49:5400-5406 14. van Bennekum AM, Wong Yen Kong LR, Gijbels MJ, et al. Mitogen response of B cells, but not T cells, is impaired in adult vitamin A-deficient rats [published erratum appears in J Nutr. 1992;122:588]. J Nutr. 1991;121:1960-1968.
15.
van Pelt AM, van den Brink CE, de Rooij DG, van der Saag PT.
Changes in retinoic acid receptor messenger ribonucleic acid levels in the vitamin A-deficient rat testis after administration of retinoids.
Endocrinology.
1992;131:344-340 16. Darwiche N, Celli G, Sly L, Lancillotti F, de Luca LM. Retinoid status controls the appearance of reserve cells and keratin expression in mouse cervical epithelium. Cancer Res. 1993;53:2297-2299. 17. Harada H, Miki R, Masushige S, Kato S. Gene expression of retinoic acid receptors, retinoid-X receptors, and cellular retinol-binding protein I in bone and its regulation by vitamin A. Endocrinology. 1995;136:5329-5335[Abstract]. 18. Maden M, Gale E, Kostetskii I, Zile M. Vitamin A-deficient quail embryos have half a hindbrain and other neural defects. Curr Biol. 1996;6:417-426[Medline] [Order article via Infotrieve].
19.
Ponnamperuma RM, Kirchhof SM, Trifiletti L, De Luca LM.
Ovariectomy increases squamous metaplasia of the uterine horns and survival of SENCAR mice fed a vitamin A-deficient diet.
Am J Clin Nutr.
1999;70:502-508
20.
Carman JA, Pond L, Nashold F, Wassom DL, Hayes CE.
Immunity to Trichinella spiralis infection in vitamin A-deficient mice.
J Exp Med.
1992;175:111-120
21.
Collins SJ, Robertson KA, Mueller L.
Retinoic acid-induced granulocytic differentiation of HL-60 myeloid leukemia cells is mediated directly through the retinoic acid receptor (RAR-alpha).
Mol Cell Biol.
1990;10:2154-2163 22. Nagy L, Thomazy VA, Shipley GL, et al. Activation of retinoid X-receptors induces apoptosis in HL-60 cell lines. Mol Cell Biol. 1995;15:3540-3551[Abstract]. 23. Mehta K, McQueen T, Neamati N, Collins S, Andreeff M. Activation of retinoid receptors RAR alpha and RXR alpha induces differentiation and apoptosis, respectively, in HL-60 cells. Cell Growth Differ. 1996;7:179-186[Abstract]. 24. Grillier I, Umiel T, Elstner E, Collins SJ, Koeffler HP. Alterations of differentiation, clonal proliferation, cell cycle progression and bcl-2 expression in RAR alpha-altered sublines of HL-60. Leukemia. 1997;11:393-400[Medline] [Order article via Infotrieve]. 25. Frolik CA, Tavela TE, Peck GL, Sporn MB. High-pressure liquid chromatographic determination of 13-cis-retinoic acid and all-trans-retinoic acid in human plasma. Anal Biochem. 1978;86:743-750[Medline] [Order article via Infotrieve]. 26. Barua A, Furr H, Janick-Buckner D, Ja O. Simultaneous analysis of individual carotinoids, retinol, retinyl esters and tochopherols in serum by isocratic non-aqueous reverse phase HPLC. Food Chem. 1993;46:419-424.
27.
Scharton-Kersten T, Contursi C, Masumi A, Sher A, Ozato K.
Interferon consensus sequence binding protein-deficient mice display impaired resistance to intracellular infection due to a primary defect in interleukin 12 p40 induction.
J Exp Med.
1997;186:1523-1534
28.
Gorczyca W, Gong J, Darzynkiewicz Z.
Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assays.
Cancer Res.
1993;53:1945-1951
29.
Gabriele L, Phung J, Fukumoto J, et al.
Regulation of apoptosis in myeloid cells by interferon consensus sequence-binding protein.
J Exp Med.
1999;190:411-422 30. Wang AM, Mark DF. Quantitative PCR. New York, NY: Academic Press; 1990. 31. Halford WP, Falco VC, Gebhardt BM, Carr DJ. The inherent quantitative capacity of the reverse transcription-polymerase chain reaction. Anal Biochem. 1999;266:181-191[Medline] [Order article via Infotrieve]. 32. Kihara-Negishi F, Yamada T, Kubota Y, et al. Down-regulation of c-myc and bcl-2 gene expression in PU.1-induced apoptosis in murine erythroleukemia cells. Int J Cancer. 1998;76:523-530[Medline] [Order article via Infotrieve]. 33. Kuida K, Zheng TS, Na S, et al. Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature. 1996;384:368-372[Medline] [Order article via Infotrieve]. 34. Olson JA. Serum levels of vitamin A and carotenoids as reflectors of nutritional status. J Natl Cancer Inst. 1984;73:1439-1444. 35. Durum SK, Schmidt JA, Oppenheim JJ. Interleukin 1: an immunological perspective. Annu Rev Immunol. 1985;3:263-287[Medline] [Order article via Infotrieve]. 36. Boehm U, Klamp T, Groot M, Howard JC. Cellular responses to interferon-gamma. Annu Rev Immunol. 1997;15:749-795[Medline] [Order article via Infotrieve]. 37. Trinchieri G. Interleukin-12: a cytokine at the interface of inflammation and immunity. Adv Immunol. 1998;70:83-243[Medline] [Order article via Infotrieve]. 38. Lee E, Fujita M, Miki Y, Kariya K. Decrease in myeloperoxidase during differentiation of bone marrow cells by colony-stimulating factor. Biol Pharm Bull. 1994;17:546-547[Medline] [Order article via Infotrieve].
39.
Bedi A, Zehnbauer BA, Barber JP, Sharkis SJ, Jones RJ.
Inhibition of apoptosis by BCR-ABL in chronic myeloid leukemia.
Blood.
1994;83:2038-2044
40.
Moulding DA, Quayle JA, Hart CA, Edwards SW.
Mcl-1 expression in human neutrophils: regulation by cytokines and correlation with cell survival.
Blood.
1998;92:2495-2502 41. Villa P, Kaufmann SH, Earnshaw WC. Caspases and caspase inhibitors. Trends Biochem Sci. 1997;22:388-393[Medline] [Order article via Infotrieve]. 42. Reed JC. Bcl-2 family proteins. Oncogene. 1998;17:3225-3236[Medline] [Order article via Infotrieve].
43.
Packham G, White EL, Eischen CM, et al.
Selective regulation of Bcl-XL by a Jak kinase-dependent pathway is bypassed in murine hematopoietic malignancies.
Genes Dev.
1998;12:2475-2487
44.
Park JR, Robertson K, Hickstein DD, Tsai S, Hockenbery DM, Collins SJ.
Dysregulated bcl-2 expression inhibits apoptosis but not differentiation of retinoic acid-induced HL-60 granulocytes.
Blood.
1994;84:440-445 45. Zhao Z, Ross AC. Retinoic acid repletion restores the number of leukocytes and their subsets and stimulates natural cytotoxicity in vitamin A-deficient rats. J Nutr. 1995;125:2064-2073. 46. Hestdal K, Ruscetti FW, Ihle JN, et al. Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J Immunol. 1991;147:22-28[Abstract]. 47. Nagata T, Kanno Y, Ozato K, Taketo M. The mouse Rxrb gene encoding RXR beta: genomic organization and two mRNA isoforms generated by alternative splicing of transcripts initiated from CpG island promoters. Gene. 1994;142:183-189[Medline] [Order article via Infotrieve]. 48. Holtschke T, Lohler J, Kanno Y, et al. Immunodeficiency and chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of the ICSBP gene. Cell. 1996;87:307-317[Medline] [Order article via Infotrieve]. 49. Amarante-Mendes GP, McGahon AJ, Nishioka WK, Afar DE, Witte ON, Green DR. Bcl-2-independent Bcr-Abl-mediated resistance to apoptosis: protection is correlated with up regulation of Bcl-xL. Oncogene. 1998;16:1383-1390[Medline] [Order article via Infotrieve].
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
S. Ueki, G. Mahemuti, H. Oyamada, H. Kato, J. Kihara, M. Tanabe, W. Ito, T. Chiba, M. Takeda, H. Kayaba, et al. Retinoic Acids Are Potent Inhibitors of Spontaneous Human Eosinophil Apoptosis J. Immunol., December 1, 2008; 181(11): 7689 - 7698. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Lackey, S. L. Ashley, A. L. Davis, and K. A. Hoag Retinoic Acid Decreases Adherence of Murine Myeloid Dendritic Cells and Increases Production of Matrix Metalloproteinase-9 J. Nutr., August 1, 2008; 138(8): 1512 - 1519. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yoshida, H. Ichikawa, Y. Tagata, T. Katsumoto, K. Ohnishi, Y. Akao, T. Naoe, P. P. Pandolfi, and I. Kitabayashi PML-Retinoic Acid Receptor {alpha} Inhibits PML IV Enhancement of PU.1-Induced C/EBP{varepsilon} Expression in Myeloid Differentiation Mol. Cell. Biol., August 15, 2007; 27(16): 5819 - 5834. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Taschner, C. Koesters, B. Platzer, A. Jorgl, W. Ellmeier, T. Benesch, and H. Strobl Down-regulation of RXR{alpha} expression is essential for neutrophil development from granulocyte/monocyte progenitors Blood, February 1, 2007; 109(3): 971 - 979. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yanagisawa, M. A. Exley, X. Jiang, N. Ohkochi, M. Taniguchi, and K.-i. Seino Hyporesponsiveness to Natural Killer T-Cell Ligand {alpha}-Galactosylceramide in Cancer-Bearing State Mediated by CD11b+ Gr-1+ Cells Producing Nitric Oxide Cancer Res., December 1, 2006; 66(23): 11441 - 11446. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mirza, M. Fishman, I. Fricke, M. Dunn, A. M. Neuger, T. J. Frost, R. M. Lush, S. Antonia, and D. I. Gabrilovich All-trans-Retinoic Acid Improves Differentiation of Myeloid Cells and Immune Response in Cancer Patients. Cancer Res., September 15, 2006; 66(18): 9299 - 9307. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Kindle, P. J. F. Troke, H. M. Collins, S. Matsuda, D. Bossi, C. Bellodi, E. Kalkhoven, P. Salomoni, P. G. Pelicci, S. Minucci, et al. MOZ-TIF2 Inhibits Transcription by Nuclear Receptors and p53 by Impairment of CBP Function Mol. Cell. Biol., February 1, 2005; 25(3): 988 - 1002. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Masubuchi, R. D. May, and R. Atsumi A Predictive Model of Human Myelotoxicity Using Five Camptothecin Derivatives and the In vitro Colony-Forming Unit Granulocyte/Macrophage Assay Clin. Cancer Res., October 1, 2004; 10(19): 6722 - 6731. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Hengesbach and K. A. Hoag Physiological Concentrations of Retinoic Acid Favor Myeloid Dendritic Cell Development over Granulocyte Development in Cultures of Bone Marrow Cells from Mice J. Nutr., October 1, 2004; 134(10): 2653 - 2659. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Terabe, S. Matsui, J.-M. Park, M. Mamura, N. Noben-Trauth, D. D. Donaldson, W. Chen, S. M. Wahl, S. Ledbetter, B. Pratt, et al. Transforming Growth Factor-{beta} Production and Myeloid Cells Are an Effector Mechanism through Which CD1d-restricted T Cells Block Cytotoxic T Lymphocyte-mediated Tumor Immunosurveillance: Abrogation Prevents Tumor Recurrence J. Exp. Med., December 1, 2003; 198(11): 1741 - 1752. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Brunner, H. Laumen, P. J. Nielsen, N. Kraut, and T. Wirth Expression of the Aldehyde Dehydrogenase 2-like Gene Is Controlled by BOB.1/OBF.1 in B Lymphocytes J. Biol. Chem., November 14, 2003; 278(46): 45231 - 45239. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Lindner, X. Ma, J. Hu, S. Karra, and D. V. Kalvakolanu Thioredoxin Reductase Plays a Critical Role in IFN Retinoid-mediated Tumor-Growth Control in Vivo Clin. Cancer Res., October 1, 2002; 8(10): 3210 - 3218. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ghatpande, A. Ghatpande, J. Sher, M. H. Zile, and T. Evans Retinoid signaling regulates primitive (yolk sac) hematopoiesis Blood, April 1, 2002; 99(7): 2379 - 2386. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Bunting ABC Transporters as Phenotypic Markers and Functional Regulators of Stem Cells Stem Cells, January 1, 2002; 20(1): 11 - 20. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Misner, S. Jacobs, Y. Shimizu, A. M. de Urquiza, L. Solomin, T. Perlmann, L. M. De Luca, C. F. Stevens, and R. M. Evans Vitamin A deprivation results in reversible loss of hippocampal long-term synaptic plasticity PNAS, September 5, 2001; (2001) 191369798. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sivakumaran, L. M. De Luca, and K. Ozato Role of vitamin A deficiency in the pathogenesis of myeloproliferative disorders Blood, September 1, 2001; 98(5): 1636 - 1637. [Full Text] [PDF] |
||||
![]() |
P. Kastner, H. J. Lawrence, C. Waltzinger, N. B. Ghyselinck, P. Chambon, and S. Chan Positive and negative regulation of granulopoiesis by endogenous RAR{alpha} Blood, March 1, 2001; 97(5): 1314 - 1320. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Ma, S. Karra, W. Guo, D. J. Lindner, J. Hu, J. E. Angell, E. R. Hofmann, S. P. M. Reddy, and D. V. Kalvakolanu Regulation of Interferon and Retinoic Acid-induced Cell Death Activation through Thioredoxin Reductase J. Biol. Chem., June 29, 2001; 276(27): 24843 - 24854. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Misner, S. Jacobs, Y. Shimizu, A. M. de Urquiza, L. Solomin, T. Perlmann, L. M. De Luca, C. F. Stevens, and R. M. Evans Vitamin A deprivation results in reversible loss of hippocampal long-term synaptic plasticity PNAS, September 25, 2001; 98(20): 11714 - 11719. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||