| |
|
|
|
|
|
|
|||
|
Blood, Vol. 95 No. 11 (June 1), 2000:
pp. 3423-3428
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Dipartimento di Biochimica e Biologia Molecolare-CIBF,
Università di Ferrara, Ferrara, Italy; the
Dipartimento di Medicina Clinica e Sperimentale, Università di
Verona, Verona, Italy; and the Centro Emofilia e Trombosi, Ospedale
Nuovo Pellegrini, Naples, Italy.
Previous studies have established that factor VII gene (F7)
polymorphisms (5'F7 and R353Q)
contribute about one-third of factor VII (FVII) level variation in
plasma. However, F7 genotyping in patients with cardiovascular
disease has produced conflicting results. Population and expression
studies were used to investigate the role of intron 7 (IVS7 ) polymorphisms, including repeat and sequence
variations, in controlling activated FVII (FVIIa) and antigen (FVIIag)
levels. Genotype-phenotype studies performed in 438 Italian subjects suggested a positive relation between the IVS7 repeat
number and FVII levels. The lowest values were associated with the
IVS7 + 7G allele. The screening of 52 patients with mild
FVII deficiency showed an 8-fold increase in frequency (8%) of this
allele, and among heterozygotes for identical mutations, lower FVII
levels were observed in the IVS7 + 7G carriers. This frequent genetic component participates in the phenotypic heterogeneity of FVII deficiency. The evaluation of the individual contribution of
polymorphisms was assisted by the expression of each IVS7
variant, as a minigene, in eukaryotic cells. The novel quantitative
analysis revealed that higher numbers of repeats were associated with
higher mRNA expression levels and that the IVS7 + 7G
allele, previously defined as a functionally silent polymorphism, was
responsible for the lowest relative mRNA expression. Taken together,
these findings indicate that the IVS7 polymorphisms contribute
to the plasmatic variance of FVII levels via differential efficiency of
mRNA splicing. These studies provide further elements to understand the
control of FVII levels, which could be of importance to ensure the
hemostatic balance under pathologic conditions.
(Blood. 2000;95:3423-3428)
Factor VII (FVII) is a vitamin K-dependent serine
protease glycoprotein with a pivotal role in blood
coagulation.1 In association with tissue factor, an
integral membrane protein exposed in the vascular lumen following a
lesion, activated FVII (FVIIa) initiates coagulation,2,3
which makes its levels of importance for the hemostatic balance in
normal and pathologic conditions. Decreased FVII levels are associated
with a variable bleeding tendency,4 and the FVII gene
(F7) knock-out experiments in mice demonstrated that death
following birth was due to hemorrhage from normal blood vessels.5 The association between increased FVII levels and cardiovascular disease is strongly debated,6-18 but high
levels may contribute, at least in the presence of additional risk
factors, to myocardial infarction and should be taken into account when assessing cardiovascular risk.19 High FVII levels might
disproportionately enhance the coagulation cascade at the time of
plaque rupture, which could explain the apparently differential
association with fatal and nonfatal events.6,7,10,19
FVII plasma levels are determined by environmental20,21 and
genetic factors22-24 and by their
interplay.25-27 A strong contribution of the F7
genotype to FVII levels has been demonstrated: different F7
genotypes demonstrated up to 5-fold differences in mean FVIIa levels.28 Tightly linked polymorphisms in the 5'
regulatory region are associated with FVII levels and differential
promoter activity in vitro.29,30 Regulation by
polymorphisms of the low FVII concentration (500 ng/mL) in plasma, the
lowest among the vitamin K-dependent coagulation proteins, might be
favored by the weak F7 gene promoter, which lacks the TATA and
CAAT boxes and shows a low affinity for ubiquitous transcription
factors.31-33 Moreover, the R353Q substitution in
the catalytic domain, tightly associated with the decanucleotide
insertion and with the Understanding the functional role of the different FVII genetic
components might be essential to explain previous conflicting results.
Using genotype-phenotype studies, the goal of the present study was to
define IVS7 polymorphisms in the control of plasma FVII levels.
A control population and a cohort of patients with mild FVII
deficiency, potentially useful to evidence the contribution of
polymorphic alleles, were investigated. To dissect at the molecular level the genetic components indicated by population studies, the in
vitro expression in eukaryotic cells of the different polymorphic forms
was performed. The use of minigenes, previously exploited by
us38 for the study of splicing mutations in FVII
deficiency, was extended and modified by quantitative analysis at the
mRNA level.
Patients and controls
Coagulation studies
Statistical analysis
Genomic studies Normal subjects and patients were characterized for the 5'F7, IVS7, and R353Q polymorphisms in the F7 gene as previously described.22,42,43 Among the strongly linked F7 promoter polymorphisms, the deletion (A1)/easily detectable decanucleotide insertion (A2) (A1/A2) marker was chosen for this study. The IVS7 allelic forms defined in the original reports36,43 as c, b, a, and d are now reported as H5, H6, H7, and H8, respectively, depending on the presence of 5, 6, 7, and 8 repeats. The 9726 + 7A G transition, which abolishes an
RsaI restriction site,43 is reported as 7G. Direct
sequencing was used to confirm the identity of this mutation. The
search for mutations in the F7 gene of patients not previously
characterized was carried out by polymerase chain reaction (PCR)
amplification and direct sequencing of coding regions and intron-exon
junctions, as previously reported.41
Cloning Genomic fragments containing different polymorphic alleles were obtained by PCR amplification using the Expand high-fidelity PCR system (Boehringer Mannheim, Mannheim, Germany). The genomic region spanning nucleotides 9568-10 908 (3' of exon 7, intron 7, and 5' of exon 8) and containing 5 or 8 repeats was cloned in the pUC18 vector and then subcloned in the pcDNA3 vector as previously described for alleles H6, H7, IVS7 + 5A, and IVS7 + 7G.38 The complete insert of each construct was sequenced by primers located in exon 7 (CCCTGATC AACACCATCTGG [nucleotides 9642-9663]) and intron 7 (GATGTCTGTCTG TCTGTGGA [nucleotides 10 009-9990]; TCCACAGACAGACAGACATC [nucleotides 9990-10 009]; and GAGGTGGCAGGTGGTGGAAA [nucleotides 10 495-10 514]). Plasmids containing the different allelic forms are reported as pIVS7H5, pIVS7H6, pIVS7H7, pIVS7H8, pIVS7 + 5A (9726 + 5A38), and pIVS7 + 7G (9726 + 7G38).Cell culture and transfection We transfected 7 × 105 baby hamster kidney (BHK) cells, grown as described,38 into a 10-cm petri dish using the calcium-phosphate method or a nonliposomal blend of lipids (FuGENE6 Transfection Reagent; Boehringer Mannheim). For each transfection, 6 µL FuGENE6 was incubated with 94 µL serum-free medium for 5 minutes at room temperature, added dropwise to the DNA, and then reincubated for 15 minutes at room temperature. The reagent/DNA mixture was added dropwise to the cell medium and then incubated at 37°C with 5% carbon dioxide (CO2).RNA studies Twenty-two hours after transfection, total RNA was extracted using RNAfast (Molecular Systems, San Diego, CA) and evaluated by reverse transcriptase-PCR (RT-PCR) using 40 units avian myeloblastosis virus RT and 10 N reverse oligonucleotide (CAGCGCGATGTCGTGGTT, exon 8 [nucleotides 10 652-10 635]). We amplified one-tenth of the RT reaction mixture with forward oligonucleotides (ACCCTGATCAACACCATCTGG, exon 7 [nucleotides 9642-9663]) and reverse oligonucleotides.
Population studies The allelic forms of IVS7 and the 5'F7 insertion/deletion polymorphisms were studied in 438 subjects characterized for plasma FVIIa levels. Out of 438 patients, 102 were also characterized for FVIIag levels, and association between variables was observed (correlation coefficient FVIIa/FVIIag, 0.69). The observed allelic and genotype frequencies were similar to those previously reported in the Italian population28 and were within the Hardy-Weinberg equilibrium.
Patient studies
Expression studies To study the expression of the IVS7 alleles at the messenger RNA (mRNA) level, we made minigene constructs containing the various polymorphic forms (Figure 2), and the presence of the correct sequences was confirmed by sequencing. RT-PCR evaluation of mRNA produced by constructs pIVS7H5, pIVS7H6, pIVS7H7, pIVS7H8, and pIVS7 + 7G and transfected into mammalian cells showed that all of the constructs had the presence of cDNAs with the normal expected size, 195 bp (Figure 2 and Figure 3). pIVS7 + 5A, bearing a mutation that impairs splicing at the IVS7 donor splice site,38 showed only an abnormal transcript of 232 bp (Figure 2 and Figure 3), which was chosen as an internal control for quantitative analysis. Competition between constructs was demonstrated in cotransfection experiments obtained with constant amounts of pIVS7 + 5A and decreasing amounts of pIVS7H5 (Figure 3). A quantitative analysis of transcripts was performed by the densitometric scanning of bands, and the relative expression of each construct was estimated. The expression level of pIVS7H6, bearing the most frequent repeat number in the general population, was considered as a reference point (ratio = 1) (Figure 4). Data obtained from repeated transfection experiments (Figure 4) indicated a parallel decrease of the IVS7 repeat number and mRNA relative expression. In these quantitative studies, construct pIVS7 + 7G resulted in the lowest expression level.
The FVII genotype/phenotype relationship confirmed a major role of the 5'F7 and R353Q polymorphisms in lowering FVII levels28 and suggested a parallel decrease of the IVS7 repeat number and the FVII levels. Differences associated with repeat numbers were more pronounced in the A1A2 subjects than in the A1 homozygote subjects, which could suggest that the influence of the IVS7 polymorphisms on FVII levels might be partially masked by the higher promoter activity associated with the A1 allele.29,30 As observed in a previous population study,28 FVIIa differences associated with F7 genotypes (5'F7 and IVS7 polymorphisms) were larger than those obtained for the antigen levels. FVIIa is indeed the first and longest living active protease in the coagulation pathway. Its level variations may modify the hemostatic balance both in bleeding and prothrombotic conditions, and the amplified differences in FVIIa values, predicted by genetic components, could have interesting clinical and biologic implications. A correlation between repeat number and plasma protein levels has also been reported for a polymorphism in intron 4 of the endothelial constitutive nitric oxide synthase gene.44
Supported in part by a grant from the CNR Biotech Target Project (no. 9900295PF49); a grant from Telethon Italy (no. E.0675); and Cariverona-Progetto Sanità, Verona, Italy. Università-Azienda Ospedaliera, Ferrara, Italy, provided a fellowship to P.F. (Ricerca Biomedica Project).
Submitted August 5, 1999; accepted January 27, 1999.
Reprints: Francesco Bernardi, Dipartimento di Biochimica e Biologia Molecolare, Università di Ferrara, Via L. Borsari 46, 44100 Ferrara, Italy; e-mail: ber{at}dns.unife.it.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1. Hedner U, Davie EW. Introduction to hemostasis and the vitamin K-dependent coagulation factors. In: Scriver CR,Beaudet AL,Sly WS,Valle D, eds. The Metabolic Basis of Inherited Disease. New York: McGraw-Hill; 1989:2107-2134. 2. Rapaport SI, Rao RVM. The tissue factor pathway: how it has become a "prima ballerina." Thromb Haemost. 1995;74:7-17[Medline] [Order article via Infotrieve]. 3. Edgington TS, Dickinson CD, Ruf W. The structural basis of function of the TF. VIIa complex in the cellular initiation of coagulation. Thromb Haemost. 1997;78:401-405[Medline] [Order article via Infotrieve]. 4. Cooper DN, Millar DS, Wacey A, Banner DW, Tuddenham EGD. Inherited factor VII deficiency: molecular genetics and pathophysiology. Thromb Haemost. 1997;78:151-160[Medline] [Order article via Infotrieve]. 5. Rosen ED, Chan JC, Idusogie E, et al. Mice lacking factor VII develop normally but suffer fatal perinatal bleeding. Nature. 1997;390:290-294[Medline] [Order article via Infotrieve]. 6. Meade TW, Mellows S, Brozovic M, et al. Haemostatic function and ischaemic heart disease: principal results of the Northwick Park Heart Study. Lancet. 1986;2:533-537[Medline] [Order article via Infotrieve].
7.
Heinrich J, Balleisen L, Schulte H, Assmann G, van de Loo J.
Fibrinogen and factor VII in the prediction of coronary risk: results from the PROCAM study in healthy men.
Arterioscler Thromb.
1994;14:54-59
8.
Moor E, Silveira A, van't Hooft F, et al.
Coagulation factor VII mass and activity in young men with myocardial infarction at a young age: role of plasma lipoproteins and factor VII genotype.
Arterioscler Thromb Vasc Biol.
1995;15:655-664
9.
Philippou H, Adami A, Amersey RA, Stubbs PJ, Lane DA.
A novel specific immunoassay for plasma two-chain factor VIIa: investigation of FVIIa levels in normal individuals and in patients with acute coronary syndromes.
Blood.
1997;89:767-775
10.
Ruddock V, Meade TW.
Factor VII activity and ischaemic heart disease: fatal and non-fatal events.
QJM.
1994;87:403-406
11.
Wang XL, Wang J, McCredie RM, Wilcken DE.
Polymorphisms of factor V, factor VII, and fibrinogen genes: relevance to severity of coronary artery disease.
Arterioscler Thromb Vasc Biol.
1997;17:246-251 12. Doggen CJ, Manger Cats V, Bertina RM, Reitsma PH, Vandenbroucke JP, Rosendaal FR. A genetic propensity to high factor VII is not associated with the risk of myocardial infarction in men. Thromb Haemost. 1998;80:281-285[Medline] [Order article via Infotrieve].
13.
Heywood DM, Carter AM, Catto AJ, Bamford JM, Grant PJ.
Polymorphisms of the factor VII gene and circulating FVII: C levels in relation to acute cerebrovascular disease and poststroke mortality.
Stroke.
1997;28:816-821
14.
Scarabin PY, Aillaud MF, Amouyel P, et al.
Associations of fibrinogen, factor VII and PAI-1 with baseline findings among 10,500 male participants in a prospective study of myocardial infarction 15. Lane A, Green F, Scarabin PY, et al. Factor VII Arg/Gln353 polymorphism determines factor VII coagulant activity in patients with myocardial infarction (MI) and control subjects in Belfast and in France but is not a strong indicator of MI risk in the ECTIM study. Atherosclerosis. 1996;119:119-127[Medline] [Order article via Infotrieve].
16.
Tracy RP, Arnold AM, Ettinger W, Fried L, Meilahn E, Savage P.
The relationship of fibrinogen and factors VII and VIII to incident cardiovascular disease and death in the elderly: results from the cardiovascular health study.
Arterioscler Thromb Vasc Biol.
1999;19:1776-1783
17.
Folsom AR, Wu KK, Rosamond WD, Sharrett AR, Chambless LE.
Prospective study of hemostatic factors and incidence of coronary heart disease: the Atherosclerosis Risk in Communities (ARIC) Study.
Circulation.
1997;96:1102-1108
18.
Folsom AR, Rosamond WD, Shahar E, et al.
Prospective study of markers of hemostatic function with risk of ischemic stroke. The Atherosclerosis Risk in Communities (ARIC) Study Investigators.
Circulation.
1999;100:736-742
19.
Junker R, Heinrich J, Schulte H, van de Loo J, Assmann G.
Coagulation factor VII and the risk of coronary heart disease in healthy men.
Arterioscler Thromb Vasc Biol.
1997;17:1539-1544 20. Mennen LI, Schouten EG, Grobbee DE, Kluft C. Coagulation factor VII, dietary fat and blood lipids: a review. Thromb Haemost. 1996;76:492-499[Medline] [Order article via Infotrieve].
21.
Miller GJ, Martin JC, Mitropoulos KA, et al.
Activation of FVII during alimentary lipidemia occurs in healthy adults and patients with congenital factor XII or factor XI deficiency, but not in patients with factor IX deficiency.
Blood.
1996;87:4187-4196
22.
Green F, Kelleher C, Wilkes H, Temple A, Meade TW, Humphries S.
A common genetic polymorphism associated with lower coagulation factor VII levels in healthy individuals.
Arterioscler Thromb.
1991;11:540-546 23. Lane A, Cruickshank JK, Stewart J, Henderson A, Humpries S, Green F. Genetic and environmental determinants of factor VII coagulant activity in different ethnic groups at differing risk of coronary heart disease. Artheriosclerosis. 1992;94:43-50. 24. Bernardi F, Marchetti G, Pinotti M, et al. Factor VII gene polymorphisms contribute about one third of the factor VII level variation in plasma. Arterioscler Thromb Vasc Biol. 1996;16:72-76.
25.
Humphries SE, Lane A, Green FR, Cooper J, Miller GJ.
Factor VII coagulant activity and antigen levels in healthy men are determined by interaction between factor VII genotype and plasma triglyceride concentration.
Arterioscler Thromb.
1994;14:193-198 26. Green F, Humphries S. Genetic determinants of arterial thrombosis. Baillière's Clin Haematol. 1994;7:675-692[Medline] [Order article via Infotrieve]. 27. Heywood DM, Ossei-Gerning N, Grant PJ. Association of factor VII: C levels with environmental and genetic factors in patients with ischaemic heart disease and coronary atheroma characterised by angiography. Thromb Haemost. 1996;76:161-165[Medline] [Order article via Infotrieve].
28.
Bernardi F, Arcieri P, Bertina RM, et al.
Contribution of Factor VII genotype to activated FVII levels: differences in genotype frequencies between northern and southern European population.
Arterioscler Thromb Vasc Biol.
1997;17:2548-2553
29.
Pollak ES, Hung HL, Godin W, Overton GC, High KA.
Functional characterization of the human factor VII 5' flanking region.
J Biol Chem.
1996;271:1738-1747
30.
van't Hooft FM, Silveira A, Tornvall P, et al.
Two common functional polymorphisms in the promoter region of the coagulation factor VII gene determining plasma factor VII activity and mass concentration.
Blood.
1999;93:3432-3441
31.
O'Hara PJ, Grant FJ, Haldeman BA, et al.
Nucleotide sequence of the gene coding for the human factor VII, a vitamin K-dependent protein participating in blood coagulation.
Proc Natl Acad Sci U S A.
1987;84:5158-5162
32.
Greenberg D, Miao CH, Ho WT, Chung DW, Davie EW.
Liver-specific expression of the human factor VII gene.
Proc Natl Acad Sci U S A.
1995;92:12,347-12,351
33.
Carew JA, Pollak ES, High KA, Bauer KA.
Severe factor VII deficiency due to a mutation disrupting an Sp1 binding site in the factor VII promoter.
Blood.
1998;92:1639-1645
34.
Hunault M, Arbini AA, Lopaciuk S, Carew JA, Bauer KA.
The Arg353Gln polymorphism reduces the level of coagulation factor VII: in vivo and in vitro studies.
Arterioscler Thromb Vasc Biol.
1997;17:2825-2829 35. O'Hara PJ, Grant FJ. The human factor VII gene is polymorphic due to variation in repeat copy number in a minisatellite. Gene. 1988;66:147-158[Medline] [Order article via Infotrieve].
36.
Marchetti G, Gemmati D, Patracchini P, Pinotti M, Bernardi F.
PCR detection of a repeat polymorphism within the F7 gene.
Nucleic Acids Res.
1991;19:4570 37. Marchetti G, Patracchini P, Gemmati D, et al. Detection of two missense mutations and characterization of a repeat polymorphism in the factor VII gene (F7). Hum Genet. 1992;89:497-502[Medline] [Order article via Infotrieve].
38.
Pinotti M, Toso R, Redalli R, Berrettini M, Marchetti G, Bernardi F.
Molecular mechanisms of FVII deficiency: expression of mutations clustered in the IVS7 donor splice site of factor VII gene.
Blood.
1998;92:1646-1651
39.
Iacoviello L, Di Castelnuovo A, de Knijff P, et al.
Polymorphism in the coagulation factor VII gene and risk of myocardial infarction.
N Eng J Med.
1998;338:79-85
40.
Krontiris TG.
Minisatellites and human disease.
Science.
1995;269:1682-1683 41. Bernardi F, Castaman G, Pinotti M, et al. Mutation pattern in clinically asymptomatic coagulation factor VII deficiency. Hum Mut. 1996;8:108-115[Medline] [Order article via Infotrieve]. 42. Marchetti G, Patracchini P, Papacchini M, Ferrati M, Bernardi F. A polymorphism in the 5' region of coagulation factor VII gene (F7) caused by an inserted decanucleotide. Hum Genet. 1993;90:575-576[Medline] [Order article via Infotrieve]. 43. Bernardi F, Patracchini P, Gemmati D, et al. Molecular analysis of factor VII deficiency in Italy: a frequent mutation (FVII Lazio) in a repeated intronic region. Hum Genet. 1993;92:446-450[Medline] [Order article via Infotrieve].
44.
Wang XL, Mahaney MC, Sim AS, et al.
Genetic contribution of the endothelial constitutive nitric oxide synthase gene to plasma nitric oxide levels.
Arterioscler Thromb Vasc Biol.
1997;17:3147-3153
45.
Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM.
The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in hepG2 cells.
J Biol Chem.
1993;268:10,739-10,745
46.
Dominski Z, Kole R.
Cooperation of pre-mRNA sequence elements in splice site selection.
Mol Cell Biol.
1992;12:2108-2114
47.
Sterner DA, Berget SM.
In vivo recognition of a vertebrate mini-exon as an exon-intron-exon unit.
Mol Cell Biol.
1993;13:2677-2687
48.
Dominski Z, Kole R.
Identification of exon sequences involved in splice site selection.
J Biol Chem.
1994;269:23,590-23,596 49. Howard PR, Bovill EG, Pike J, Church WR, Tracy RP. Factor VII antigen levels in a healthy blood donor population. Thromb Haemost. 1994;72:21-27[Medline] [Order article via Infotrieve].
50.
Sirand-Pugnet P, Durosay P, Brody E, Marie J.
An intronic (A/U) GGG repeat enhances the splicing of an alternative intron of the chicken 51. McCullough AJ, Berget SM. G triplets located throughout a class of small vertebrate introns enforce intron borders and regulate splice site selection. Mol Cell Biol. 1997;7:4562-4571.
52.
Shapiro MB, Senapathy P.
RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression.
Nucleic Acids Res.
1987;15:7155-7174 53. Saad S, Rowley G, Tagliavacca L, Green PM, Giannelli G, and UK Haemophilia Centres. First report on UK database of Haemophilia B mutations and pedigrees. Thromb Haemost. 1994;71:563-570[Medline] [Order article via Infotrieve].
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
M. Pinotti, L. Rizzotto, D. Balestra, M. A. Lewandowska, N. Cavallari, G. Marchetti, F. Bernardi, and F. Pagani U1-snRNA-mediated rescue of mRNA processing in severe factor VII deficiency Blood, March 1, 2008; 111(5): 2681 - 2684. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Shikata, I. Ieiri, S. Ishiguro, H. Aono, K. Inoue, T. Koide, S. Ohgi, and K. Otsubo Association of pharmacokinetic (CYP2C9) and pharmacodynamic (factors II, VII, IX, and X; proteins S and C; and {gamma}-glutamyl carboxylase) gene variants with warfarin sensitivity Blood, April 1, 2004; 103(7): 2630 - 2635. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Voetsch and J. Loscalzo Genetic Determinants of Arterial Thrombosis Arterioscler. Thromb. Vasc. Biol., February 1, 2004; 24(2): 216 - 229. [Abstract] [Full Text] |
||||
![]() |
E. Castoldi, J. W. P. Govers-Riemslag, M. Pinotti, D. Bindini, G. Tans, M. Berrettini, M. G. Mazzucconi, F. Bernardi, and J. Rosing Coinheritance of Factor V (FV) Leiden enhances thrombin formation and is associated with a mild bleeding phenotype in patients homozygous for the FVII 9726+5G>A (FVII Lazio) mutation Blood, December 1, 2003; 102(12): 4014 - 4020. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-L. Tseng, Y.-P. Shih, Y.-C. Huang, C.-K. Wang, P.-H. Chen, J.-G. Chang, K.-T. Yeh, Y.-M. A. Chen, and K. H. Buetow Genotypic and Phenotypic Characterization of a Putative Tumor Susceptibility Gene, GNMT, in Liver Cancer Cancer Res., February 1, 2003; 63(3): 647 - 654. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||