| |
|
|
|
|
|
|
|||
|
Blood, Vol. 95 No. 11 (June 1), 2000:
pp. 3451-3459
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Whitaker Cardiovascular Institute and the Evans Department
of Medicine, Boston University School of Medicine, Boston, MA.
Cytokines that stimulate inducible nitric oxide (NO) synthase can
suppress the growth and differentiation of normal human bone marrow
cells, including megakaryocytes. Since NO promotes apoptosis in other
cell systems, we chose to study the determinants of apoptosis in
megakaryocytic cells. We show that both exogenous and endogenous
sources of NO can induce apoptosis in megakaryocytoid cell lines. The megakaryocyte growth factor thrombopoietin suppresses NO-induced apoptosis, whereas treatment with peroxynitrite, a cytotoxic
product formed when NO reacts with superoxide, promotes apoptosis.
Superoxide inhibitors suppress NO-induced apoptosis, and pretreatment
with megakaryocyte growth and maturation factors attenuates NO-induced
apoptosis. These data show that NO modulates megakaryocyte apoptosis
and suggest that this process may occur in the cytokine-rich marrow
milieu to regulate megakaryocyte turnover.
(Blood. 2000;95:3451-3459)
Increases in nitric oxide (NO) production as a result
of inflammatory cytokine release can induce cytotoxicity through myriad mechanisms.1 One of the principal mechanisms of NO
cytotoxic action appears to be the inhibition of energy metabolism
through detrimental effects on mitochondrial respiration, glycolysis, and the citric acid cycle.2-5 Nitric oxide can bind to the
oxygen-binding site of cytochrome oxidase, thereby inhibiting oxygen
binding.5,6 Nitric oxide can also bind to the Fe-S clusters
in molecules of the respiratory chain, including complex I/II and
aconitase,7,8 further limiting cellular respiration.
Perhaps the most obvious mechanism by which NO can induce cell death is
through direct DNA damage leading to strand breaks. Nitric
oxide-regulated apoptosis has been shown to result from the activation
of many apoptotic effectors including p53,9,10
stress-activated protein kinase (SAPKinase),11
caspases,12-17 the Bcl-2 family of
proteins,18,19 and cytochrome c.20,21
Nitric oxide evokes these apoptotic actions by several mechanisms,
including deamination of cytosine and 5-methylcytosine in DNA, leading
to strand breaks, and S-nitrosation of caspases at their active-site
cysteine residues, leading to enzyme inhibition.14-17 Nitric oxide has also been shown to induce apoptosis through 1 of its
reaction products, peroxynitrite. When NO forms in the presence of
superoxide, the highly toxic molecule peroxynitrite (ONOO The recently cloned ligand for the c-mpl receptor
thrombopoietin (TPO) has been shown to be important for the growth,
development, and ploidy of megakaryocyte progenitor
cells.26 TPO is important for megakaryocyte maturation,
producing megakaryocytes that are more mature with increased ploidy
values and enhanced cytoplasmic maturation.26 One mechanism
that has been proposed to explain TPO's ability to stimulate the
growth of megakaryocytes is its ability to prevent
apoptosis.27 Borge et al27 have shown, in a
subpopulation of bone marrow
Lin In this study we sought to assess the role of NO on apoptosis in
megakaryocytic cell lines. Using both endogenous and exogenous sources
of NO, we assessed apoptosis with various methods that detect the
extent of endonucleosomal cleavage. To address the role of
peroxynitrite in NO-induced apoptosis in these cells, we either
inhibited superoxide or treated cells with synthetic peroxynitrite. To
determine the effects of growth and maturation factors on NO-induced
apoptosis, we pretreated the cells with TPO, IL-11,30 or
5-hydroxytryptamine (serotonin) 72 hours before exposure to various
sources of NO. By establishing that NO can induce apoptosis in
megakaryocytes and that NO-induced apoptosis can be modulated by
megakaryocyte maturation factors, we show that NO plays a pivotal role
in regulating megakaryocyte turnover.
Cell culture
DNA isolation and terminal transferase labeling
DNA end-labeling of cells in situ (TUNEL method) The cells were fixed onto microscope slides in 4% paraformaldehyde and then incubated in the presence of proteinase K for 30 minutes at 37°C. Twenty-five units of terminal transferase and 2.0 nmol biotin-16-dUTP in terminal transferase buffer (140 mmol/L sodium cacodylate, 25 mmol/L Tris-HCl, pH 8.0, 0.25 mg/mL bovine serum albumin, and 2.5 mmol/L cobalt chloride) were added to the sections and incubated for 1 hour at 37°C. Sections were incubated with stop buffer (300 mmol/L NaCl, 30 mmol/L trisodium citrate) for 15 minutes, rinsed with doubly distilled water, and immersed in phosphate-buffered saline (PBS). Streptavidin peroxidase was added to the section according to the manufacturer's instructions and incubated for 30 minutes. After PBS washings, the sections were stained with aminoethylcarbazole for 5 minutes. In negative controls, the terminal transferase was omitted from the labeling solution (Frag-EL Kit; Oncogene, Cambridge, MA).34COMET assay for detection of cells containing damaged DNA Apoptosis in megakaryocytoid cells was quantified by the single-cell microgel electrophoresis assay (COMET assay).35 Megakaryocytoid cells were exposed to various concentrations of GSNO or cytokines known to stimulate iNOS expression. The cells were then embedded in situ in 1% agarose and exposed to alkaline lysis buffer (2.5 mol/L NaCl, 1% Na-lauryl sarcosinate, 100 mmol/L EDTA, 10 mmol/L Tris base, 1% hydrogen peroxide, and carbonyl-free Triton X-100) for 30 minutes, followed by 15 minutes equilibration in electrophoresis buffer containing 300 mmol/L NaOH, 10 mmol/L EDTA, pH 10, 0.1% hydroxyquinoline, and 0.02% dimethyl sulfoxide. The nuclei were subsequently electrophoresed for 25 minutes at 2 V/cm, followed by staining with YOYO-1 (3 µmol/L) and visualized with a fluorescence microscope equipped with a fluorescein isothiocyanate filter. Between 100 to 200 COMETs per treatment were scored in a blinded fashion and assigned as type A, B, or C by visual inspection based on the appearance of the nucleus and the presence of a "tail" (A, circular nucleus, no apoptosis; B, circular nucleus with tail, consistent with apoptosis; C, large nucleus with diffuse tail, consistent with apoptosis).35p53 Immunoprecipitation and Western blotting Cells were incubated with the NO donor or with cytokines for induction of iNOS to produce NO. After treatment, the cells were lysed for 20 minutes in lysis buffer (50 mmol/L Tris, pH 8.0, 5 mmol/L EDTA, 150 mmol/L NaCl, 0.5% Nonidet-40, and 1 mmol/L phenylmethylsulfonyl fluoride). Lysed cells were then centrifuged, and the supernatant was incubated with 50% (vol/vol) protein A-Sepharose for 30 minutes at 4°C followed by centrifugation for 15 minutes; p53 was immunoprecipitated overnight at 4°C by adding p53 antibody. Immune complexes were collected by centrifugation and washed 3 times with wash buffer. Finally, samples were resuspended in sample buffer (125 mmol/L Tris, pH 6.9, 2% SDS, 10% glycerin, 1 mmol/L dithiothreitol, and 0.002% bromophenol blue) and boiled for 5 minutes. Proteins were separated on a 10% SDS-polyacrylamide gel and blotted onto nitrocellulose membranes. The sheets were washed twice with PBS containing 0.1% Tween-20 before blocking the nonspecific binding sites with PBS and 5% powdered milk for 1 hour at room temperature. The p53 antibody (PharMingen, San Diego, CA) was added and incubated overnight at 4°C. The nitrocellulose sheets were washed 3 times and then incubated with antirat horseradish peroxidase--conjugated antibody diluted in PBS/0.5% powered milk for 1 hour followed by the ECL kit detection (Amersham, Arlington Heights, IL).Stress-activated protein kinase assay Stress-activated protein kinase SAPK/JNK assay was determined using a commercial assay (New England Bio-Labs, Beverly, MA). This nonradioactive method uses an N-terminal c-Jun fusion protein bound to glutathione-Sepharose beads to precipitate SAPK/JNK specifically from cell lysates. The c-Jun protein contains a high-affinity binding site for SAPK/JNK located in proximity to 2 phosphorylation sites, Ser63 and Ser73. The precipitated protein was then used to perform a kinase reaction in the presence of cold adenosine triphosphate, and c-Jun phosphorylation was selectively measured using a phospho-specific c-Jun antibody.CPP32 enzymatic activity CPP32 (caspase-3) activity was determined using a commercial assay (Clontech, Palo Alto, CA) that provides a means of measuring CPP32 protease activity in mammalian cell lines. The method detects the shift in fluorescence emission of 7-amino-4-trifluoromethyl coumarin (AFC) when the AFC-substrate conjugate DEVD-AFC is cleaved by CPP32. The free AFC emits yellow-green fluorescence at 505 nm as compared with the blue fluorescence at 400 nm emitted by the uncleaved substrate. Comparison of the fluorescence produced by the apoptotic sample with an uninduced control allows the determination of the units of protease activity.RT-PCR for iNOS Total RNA was extracted from treated and untreated megakaryocytoid cells using RNAsol (Biotecx Labs, Houston, TX). Contaminating DNA was digested using RNase-free DNase I (Boehringer Mannheim). Reverse transcription was carried out using 150 ng total RNA in 20 µL reaction mixture containing 50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L KCl, 3 mmol/L MgCl2, 10 mmol/L dithiothreitol, 0.5 mmol/L of each dNTP, 200 U Superscript reverse transcriptase (GIBCO), and 10 µg/mL oligo dT16. After incubation at 42°C for 1 hour, the reaction was stopped by incubation at 70°C for 5 minutes. A nested primer PCR reaction was carried out using 10 µL from the reverse transcription reaction in 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 200 µmol/L of each dNTP, and 2.5 U Taq DNA polymerase (Boehringer Mannheim). Primer sequences used for the first amplification of iNOS were 5'catcatggaccaccactaggctga and 5'ccaggtgggacagcttctgatcaa, and for the second round of amplification they were 5'cctcccatgtctgggagcatcac and 5'ccagggcagtctccattgccaaac. Primers were added at a final concentration of 1.0 µmol/L, and amplification was performed in a DNA thermal cycler. A second PCR reaction was carried out using 10 µL of the original PCR mixture and the nested primer pair under the same conditions. Amplified products were analyzed by 1.5% agarose gel electrophoresis and visualized under UV illumination after staining with ethidium bromide.Western blotting for Bcl-2 and Bax Western blot analysis was performed according to the standard protocol. Cells were lysed in lysis buffer containing (0.1% Nonidet P-45, 50 mmol/L HEPES, pH 7.6, 50 mmol/L KCl, 10 mmol/L EGTA, 2 mmol/L MgCl2, 1 mmol/L dithiothreitol, and 1 mmol/L phenylmethylsulfonyl fluoride), centrifuged to collect the cell lysate, and resolved by SDS-polyacrylamide gel electrophoresis. After transfer to nitrocellulose, the filter was incubated with varying dilutions of the anti-Bax or anti-Bcl-2 antibody (PharMingen) followed by incubation with a 1:1000 dilution of secondary goat antirabbit horseradish peroxidase-conjugated antibody (Amersham). Bound antibody was visualized using the ECL kit (Amersham) according to the manufacturer's instructions.Synthesis of GSNO S-nitrosoglutathione was synthesized at 25°C by combining equimolar (200 mmol/L) concentrations of reduced glutathione and sodium nitrite in 0.5 mol/L HCl, as previously described.36Synthesis of peroxynitrite Peroxynitrite was prepared by combining 0.6 mol/L sodium nitrite with 1.75 mol/L hydrogen peroxide in the presence of 1 mol/L HCl and 1.5 mol/L NaOH. The UV spectrum of the solution was analyzed after 15 minutes at 302 nm for concentration determination (![]() ONOO = 1670
mol/L 1 cm 1) and
stored at 70°C until use.
Nitrite/nitrate analysis Nitrate was converted to nitrite by incubation with nitrate reductase (Sigma) in the presence of NADPH (Sigma). Total nitrite was measured by the Griess reaction.37 Briefly, the sample was incubated with an equal volume of Griess reagent (naphthylethylenediamine dihydrochloride [0.1% wt/vol] plus sulfanilamide [1% wt/vol in 5% H3 PO4 vol/vol]) at room temperature, and the absorbance was read at 540 nm. Nitrite concentration was determined using sodium nitrite as a standard.Statistics All values are presented as mean ± SD. Pairwise comparisons were performed using the Student t test. Groups of data were subjected to analysis of variance with post hoc Newman-Keul comparisons. P < .05 was considered statistically significant.
S-nitrosoglutathione and DNA fragmentation HEL cells treated with the NO donor GSNO exhibited "DNA laddering" that was detectable using terminal transferase radiolabeling (Figure 1A). Laddering was visible as early as 1 hour after treatment and was still present after 8 hours of exposure. Induction of endogenous iNOS by treatment with 10 ng/mL IL-1 , 10 ng/mL TNF- , 10 ng/mL IFN- , and 1 µg/mL
endotoxin also produced endonucleosomal cleavage of DNA, an effect that
was prevented by simultaneous treatment of the induced cells with the
NOS inhibitor NG-monomethyl-L-arginine (L-NMMA) (Figure
1B).
DNA fragmentation by TUNEL labeling Using the TUNEL technique in which the free 3'-ends of DNA are labeled with dUTP-biotin by terminal transferase, we found that both GSNO donor treatment and iNOS induction produced TUNEL-positive cells in both cell lines tested (Meg-01 and HEL cells) (Figures 2 and 3, respectively). Meg-01 cells exposed to 100 µmol/L GSNO were TUNEL-positive and had an apoptotic index (percentage apoptotic cells) of 17% as early as 30 minutes after treatment. Cytokine induction of iNOS in Meg-01 cells also produced TUNEL-positive cells with an apoptotic index of 8%, an effect not observed in uninduced cells (0% apoptotic index) (Figure 2C). HEL cells exposed to 100 µmol/L GNSO were TUNEL-positive and had an apoptotic index of 27% (Figure 3C). Cytokine induction of iNOS in HEL cells led to TUNEL positivity with an apoptotic index of 17%, an effect that was decreased by simultaneous treatment with L-NMMA (4% apoptotic index). To establish that cytokine induction led to transcriptional activation of iNOS under these experimental conditions, RT-PCR was used to monitor iNOS steady-state mRNA. After cells were induced to express iNOS mRNA by cytokine stimulation, a 230-bp product could be visualized using iNOS-specific primers (see Figure 5C). This product was not present in cells that were not induced to express iNOS by cytokine induction.
Apoptosis in megakaryocytoid cells grown in co-culture with fibroblasts Meg-01 cells grown in co-culture with fibroblasts induced to express iNOS were TUNEL-positive and had an apoptotic index of 33% compared with control Meg-01 cells co-cultured with uninduced fibroblasts (0% apoptotic index). The NOS inhibitor L-NMMA significantly attenuated the apoptotic response in Meg-01 cells co-cultured with fibroblasts induced to express iNOS (3% apoptotic index). To affirm that NO was generated by the fibroblasts and that its oxidative byproducts were present in the media, nitrite/nitrate (NOx) measurements were made on the conditioned media using the Griess reaction. We found a statistically significant increase in NOx (P < .001) measured as nitrite in the media of Meg-01 cells grown in co-culture with NO-producing fibroblasts (6.1 ± 3.5 µmol/L/mg per mL protein) in comparison to fibroblasts that were not induced to suppress iNOS (0.6 ± 0.02 µmol/L/mg per mL protein).COMET assay The highly sensitive COMET assay was also used to monitor apoptotic responses of human megakaryocytoid cell lines. In this assay, endonucleosomal fragmentation of DNA is identified as a tail extending from the cell's nucleus after electrophoretic separation of the fragments and staining with YOYO-1 dye. The tails are grouped as types A, B, and C (Figure 4A) according to the extent of change in the morphology of the nucleus and the fragmented "tail." Using this method, we observed that incubation of Meg-01 cells with GSNO, at concentrations as low as 10 µmol/L, for 1.5 hours produced apoptosis in 33% ± 10% of cells, whereas only 3% ± 1% of untreated cells were apoptotic. Similarly, cytokine induction of iNOS produced apoptosis in 66% ± 12% of cells, an effect that was prevented by coincubation with the NOS inhibitor, L-NMMA (Figure 4B). In co-culture experiments in which NO was produced by cytokine induction of iNOS in fibroblasts, 26% ± 4% of cells were apoptotic according to this assay (data not shown).
p53 immunoprecipitation and Western analysis HEL cells stimulated to produce NO by iNOS induction or iNOS induction in conjunction with L-NMMA incubation showed no increase in p53 protein expression after treatment. HEL cells treated with 100 µmol/L GSNO for variable time periods, ranging from 30 minutes to 8 hours, also showed no increase in expression of p53 protein (data not shown). While these experiments were being conducted, Abo et al38 showed that cell lines established from patients with erythroblastic leukemia carry a mutation in the p53 gene that results in the up-regulation of p53 expression and a high basal level of p53, thereby potentially masking any possible effects of NO on the regulation of p53 expression.SAPKinase assay No up-regulation of SAPKinase activity could be detected after cytokine induction of iNOS. This activity was also not affected by co-incubation with the NOS inhibitor L-NMMA (data not shown.) In addition, no increase in SAPKinase activity was apparent after treatment with 100 µmol/L GSNO (data not shown).CPP32 assay HEL cells exposed to various concentrations of GSNO in the presence or absence of the specific CPP32 enzymatic inhibitor DEVD all demonstrated a decrease in CPP32 enzymatic activity in comparison to untreated cells (Figure 5). This effect is likely caused by S-nitrosation of the active site cysteine present in CPP32, which suppresses its activity.15
Bax and Bcl-2 Western blot analysis Western blot analysis showed that the expression of Bcl-2 was high in untreated cells and was not present after 1, 2, or 4 hours of treatment with 100 µmol/L GSNO (Figure 6A). Bax expression was not detected in untreated cells but was visible after 1 hour of treatment with 100 µmol/L GSNO (Figure 6B). Based on these results, it appears that NO-induced apoptosis of megakaryocytoid cells is associated with a change in the balance of the expression of survival and of apoptotic members of the Bcl-2 family. The expression of the pro-apoptotic molecule Bax increases concomitantly with a decrease in the expression of the anti-apoptotic molecule Bcl-2, thereby promoting the apoptotic response.
Effect of superoxide and peroxynitrite on nitric oxide-induced apoptosis Using the COMET assay, we found that Meg-01 cell apoptosis occurs within 10 minutes of exposure to 8 µmol/L authentic peroxynitrite (Figure 7B). To determine whether the apoptosis we observed after exposure to NO could be related to the formation of peroxynitrite, we used Tiron, a chelator of superoxide. When cells were pretreated for 1 hour with Tiron before exposure to 10 µmol/L GSNO, there was a significant decrease in COMET-positive cells (Figure 8). When the cells were pretreated with Tiron before exposure to iNOS induction by cytokine treatment, there also was a statistically significant decrease in the percentage of B and C COMET in comparison with cells not pretreated with Tiron before iNOS induction (see Figure 10). In experiments in which HEL cells were grown in co-culture with NO-producing fibroblasts, pretreatment with 10 mmol/L Tiron decreased the percentage of B and C COMET compared with cells that were not pretreated before exposure to the fibroblast-derived NO (Figure 9). Inhibition of apoptosis in HEL cells pretreated with Tiron was observed when other superoxide inhibitors were used, including superoxide dismutase, catalase, oxypurinol, and indomethacin (Figure 9).
Suppression of nitric oxide-induced apoptosis by the megakaryocyte maturation factor, TPO Using the COMET assay, we showed that pretreatment of HEL cells with TPO for 72 hours significantly reduced the percentage of apoptotic cells produced by 10 µmol/L GSNO or after iNOS induction (11% ± 7%, P < .001 and 3% ± 1%, P = .002, respectively, compared with control cells not treated with TPO) (Figures 10A and 10B). Pretreatment of HEL cells with 100 µmol/L IL-1 or 100 µmol/L 5HT
(serotonin) alone or in combination with TPO also led to a significant
decrease in the percentage of apoptotic cells produced by GSNO
exposure. To study paracrine regulation of NO-induced apoptosis, HEL
cells were grown in the presence of NO-producing fibroblasts. In these
sets of experiments, we again observed a decrease in apoptosis after
pretreatment of the cells with TPO alone or in combination with other
maturation factors (4% ± 2%) (Figure 10C).
We have established that NO can induce apoptosis in 2 megakaryocytoid cell lines, Meg-01 and HEL cells. We found that both exogenous and endogenous sources of NO can regulate apoptosis in these cell lines. A potential paracrine source of endogenous NO was demonstrated by co-culture with cytokine-induced fibroblasts, a representative cell of the bone marrow stroma. We have also shown that a potential mechanism by which NO induces apoptosis in megakaryocytes involves the modulation of the Bcl-2 family of proteins. In addition, we have shown that the apoptotic effect of NO in these cell lines is not dependent on caspase-3 activation, a phenomenon recently observed in several other types.39-42 Megakaryocyte maturation factors, including TPO, can suppress NO-induced apoptosis. To establish whether the apoptotic response is the result of peroxynitrite formation, we pretreated the cells with the superoxide inhibitor Tiron and showed a decreased apoptotic response.
The authors thank Stephanie Tribuna for expert technical assistance.
Submitted November 9, 1999; accepted February 2, 2000.
Supported in part by National Institutes of Health grants HL48743, HL55993, HL58976, and HL61795, and by a Merit Review Award from the U.S. Veterans Administration.
Reprints: Joseph Loscalzo, Evans Department of Medicine, Boston University School of Medicine, 700 Albany St, W507, Boston, MA 02118; e-mail: jloscalz{at}bu.edu.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1. Nathan C. Nitric oxide as a secretory product of mammalian cells. FASEB J. 1992;6:3051-3064[Abstract]. 2. Hibbs JB Jr, Taintor RR, Vavrin Z, Rachlin EM. Nitric oxide: a cytotoxic activated macrophage effector molecule. Biochem Biophys Res Commun. 1988;157:87-94[Medline] [Order article via Infotrieve].
3.
Stadler J, Billiar TR, Curran RD, Stuehr DJ, Ochoa JB, Simmons RL.
Effect of exogenous and endogenous nitric oxide on mitochondrial respiration of rat hepatocytes.
Am J Physiol.
1991;260:C910-C916
4.
Dimmeler S, Lottspeich F, Brune B.
Nitric oxide causes ADP-ribosylation and inhibition of glyceraldehyde-3-phosphate dehydrogenase.
J Biol Chem.
1992;267:16,771-16,774 5. Brown GC. Nitric oxide inhibition of cytochrome oxidase and mitochondrial respiration: implications for inflammatory, neurodegenerative and ischaemic pathologies. Mol Cell Biochem. 1997;174:189-192[Medline] [Order article via Infotrieve]. 6. Lizasoain I, Moro MA, Knowles RG, Darley-Usmar V, Moncada S. Nitric oxide and peroxynitrite exert distinct effects on mitochondrial respiration which are differentially blocked by glutathione or glucose. Biochem J. 1996;314:877-880. 7. Drapier JC. Interplay between NO and (Fe-S) clusters: relevance to biological systems. Methods. 1997;11:319-329[Medline] [Order article via Infotrieve].
8.
Gardner PR, Costantino G, Szabo C, Salzman AL.
Nitric oxide sensitivity of the aconitases.
J Biol Chem.
1997;272:25,071-25,076 9. Messmer UK, Ankarcrona M, Nicotera P, Brune B. p53 expression in nitric oxide-induced apoptosis. FEBS Lett. 1994;355:23-26[Medline] [Order article via Infotrieve]. 10. Messmer UK, Reimer DM, Reed JC, Brune B. Nitric oxide induced poly(ADP-ribose) polymerase cleavage in RAW 264.7 macrophage apoptosis is blocked by Bcl-2. FEBS Lett. 1996;384:162-166[Medline] [Order article via Infotrieve].
11.
Forrester K, Ambs S, Lupold SE, et al.
Nitric oxide-induced p53 accumulation and regulation of inducible nitric oxide synthase expression by wild-type p53.
Proc Natl Acad Sci U S A.
1996;93:2442-2447 12. Pfeilschifter J, Huwiler A. Nitric oxide stimulates stress-activated protein kinases in glomerular endothelial and mesangial cells. FEBS Lett. 1996;396:67-70[Medline] [Order article via Infotrieve].
13.
Thornberry NA, Lazebnik Y.
Caspases: enemies within.
Science.
1998;281:1312-1316 14. Haendeler J, Weiland U, Zeiher AM, Dimmeler S. Effects of redox-related congeners of NO on apoptosis and caspase-3 activity. Nitric Oxide. 1997;1:282-293[Medline] [Order article via Infotrieve]. 15. Li J, Billiar TR, Talanian RV, Kim YM. Nitric oxide reversibly inhibits seven members of the caspase family via S-nitrosylation. Biochem Biophys Res Commun. 1997;240:419-424[Medline] [Order article via Infotrieve]. 16. Balakirev MY, Kharmtsov VV, Zimmer G. Modulation of the mitochondrial permeability transition by nitric oxide. Eur J Biochem. 1997;246:710-718[Medline] [Order article via Infotrieve]. 17. Hortelano S, Dallaporta B, Zamzami N, et al. Nitric oxide induces apoptosis via triggering mitochondrial permeability transition. FEBS Lett. 1997;410:373-377[Medline] [Order article via Infotrieve].
18.
Messmer UK, Reed JC, Brune B.
Bcl-2 protects macrophages from nitric oxide-induced apoptosis.
J Biol Chem.
1996;271:20,192-20,197 19. Brockhaus F, Brune B. U937 apoptotic cell death by nitric oxide: Bcl-2 downregulation and caspase activation. Exp Cell Res. 1998;238:33-41[Medline] [Order article via Infotrieve].
20.
Green DR, Reed JC.
Mitochondria and apoptosis.
Science.
1998;281:1309-1312 21. von Knethen A, Brune B. Cyclooxygenase-2: an essential regulator of NO-induced apoptosis. FASEB J. 1997;11:887-895[Abstract].
22.
Dypbukt JM, Ankarcrona M, Burkitt M, et al.
Different prooxidant levels stimulate growth, trigger apoptosis, or produce necrosis of insulin-secreting RINm5F cells: the role of intracellular polyamines.
J Biol Chem.
1994;269:30,553-30,560 23. Villa P, Kaufmann SH, Earnshaw WC. Caspases and caspase inhibitors. Trends Biochem Sci. 1997;22:388-393[Medline] [Order article via Infotrieve].
24.
Beckman JS, Koppenol WH.
Nitric oxide, superoxide, and peroxynitrite: the good, the bad, and the ugly.
Am J Physiol.
1996;271:C1424-C1437
25.
Ischiropoulos H.
Living and dying with reactive species: focus on "peroxynitrite induces apoptosis of HL-60 cells by activation of a casapase-3 family protease."
Am J Physiol.
1998;274:C853-C854
26.
Kaushansky K.
Thrombopoietin.
N Engl J Med.
1998;339:746-754
27.
Borge OJ, Ramsfjell V, Veiby OP, Murphy MJ Jr, Lok S, Jacobsen SE.
Thrombopoietin, but not erythropoietin, promotes viability and inhibits apoptosis of multipotent murine hematopoietic progenitor cells in vitro.
Blood.
1996;88:2859-2870 28. Ritchie A, Vadhan-Raj S, Broxmeyer HE. Thrombopoietin suppresses apoptosis and behaves as a survival factor for the human growth factor-dependent cell line, M07e. Stem Cells. 1996;14:330-336[Abstract].
29.
Borge OJ, Ramsfjell V, Cui L, Jabobsen SE.
Ability of early acting cytokines to directly promote survival and suppress apoptosis of human primitive CD34+CD38- bone marrow cells with multilineage potential at the single cell level: key role of thrombopoietin.
Blood.
1997;90:2282-2292 |