| |
|
|
|
|
|
|
|||
|
Blood, Vol. 95 No. 11 (June 1), 2000:
pp. 3498-3505
NEOPLASIA
From the Department of Adult Oncology, Dana Farber Cancer Institute,
Department of Medicine, Brigham and Women's Hospital, and Department
of Medicine, Harvard Medical School, Boston, MA.
The tyrosine kinase activity of the Bcr/Abl oncogene is required for
transformation of hematopoietic cells. The tyrosine kinase inhibitor
STI571 (formerly called CGP57148B, Novartis Pharmaceuticals) inhibits
BCR/ABL, TEL/ABL, and v-ABL kinase activity and inhibits growth and
viability of cells transformed by any of these ABL oncogenes. Here we
report the generation of 2 BCR/ABL-positive cell lines that have
developed partial resistance to STI571. BCR/ABL-transformed Ba/F3
hematopoietic cells and Philadelphia-positive human K562 cells were cultured in gradually increasing concentrations of STI571
over a period of several months to generate resistant lines. Resistant
Ba/F3.p210 cells were found to have an increase in Bcr/Abl messenger
RNA, amplification of the Bcr/Abl transgene, and a greater than tenfold
increase in the level of BCR/ABL protein. In contrast to Ba/F3.p210
cells, drug-resistant K562 cells did not undergo detectable
amplification of the BCR/ABL gene, although they displayed a 2-fold to
3-fold increase in p210BCR/ABL protein. The addition of STI571 to both
resistant Ba/F3.p210 and K562 cells resulted in a rapid reduction of
tyrosine phosphorylation of cellular proteins, similar to that observed
for nonresistant cells. However, the inhibition of kinase activity was
transient and partial and was not accompanied by apoptosis. The results
suggest that resistance to STI571 may be multifactorial. Increased
expression of the target protein BCR/ABL was observed in both lines,
and resulted from oncogene amplification in one line. However, altered
drug metabolism, transport, or other related mechanisms may also
contribute to drug resistance.
(Blood. 2000;95:3498-3505)
Chronic myelogenous leukemia (CML) is a clonal
myeloproliferative disorder that is characterized by excessive
production, and premature release, of both mature and immature myeloid
cells. CML is caused by the 210-kd BCR/ABL oncoprotein, a chimeric
fusion of either exon 2 or exon 3 of c-Bcr and exon 2 of c-Abl, which results from the Philadelphia (Ph) chromosome
translocation t (9,22).1-3 One of the hallmarks of BCR/ABL
transformation is the greatly elevated ABL tyrosine kinase activity,
which is possibly related to oligomerization of BCR/ABL owing to the
presence of a coiled-coil motif in BCR.4-7
Since transformation by BCR/ABL is absolutely dependent on tyrosine
kinase activity,6 it has been evident for some time that a
drug that inhibited ABL tyrosine kinase activity could be of
therapeutic value. Synthesis of a class of tyrosine kinase-specific inhibitors called tyrphostins8 led to the discovery of an
inhibitor of ABL tyrosine kinase toxic to the human CML cell line
K562.9,10 More recently, STI571, a more potent and highly
selective ABL tyrosine kinase inhibitor of the 2-phenyl-amino
pyrimidine class, was developed.11,12 This compound,
synthesized using the structure of the ATP binding site of protein
kinases, selectively inhibits the anchorage-independent growth and
tumorigenicity of v-Abl-transformed cells,11 inhibits the
ability of BCR/ABL-positive cells to proliferate and develop tumors,
and suppresses the formation of BCR/ABL colony formation in cells
derived from peripheral blood or bone marrow from CML
patients.12,13 STI571 induces apoptosis in a variety of
BCR/ABL-positive cell lines and Ph+ cells.14-16 In
addition to the p210 form of BCR/ABL (B2A2), STI571 also inhibits the
p190 form of BCR/ABL (B1A2).16,17 STI571 is also effective
in inhibiting the kinase activity of platelet-derived growth factor
receptor (PDGFR)11 and TEL-PDGFR, an activated
PDGFR kinase.17 Preliminary results from a phase I
dose-escalating clinical trial suggest that STI571 has significant
activity in stable and advanced phases of CML.18
A recent study demonstrated the need for a continuous block of BCR/ABL
tyrosine kinase activity by STI571 to effectively cure BCR/ABL-positive tumor-bearing nude mice treated with the
inhibitor.19 Since chronic or repeated administration of
STI571 to CML patients may be necessary for successful treatment, we
were interested in identifying potential mechanisms of resistance to
this compound. Two cell lines were selected for study. K562 is a human
Ph+ cell line derived from a patient with CML. Ba/F3.p210 was derived
in our laboratory by transfecting a BCR/ABL complementary DNA (cDNA) into the nontransformed murine hematopoietic cell line Ba/F3. In this
study, we have compared the mechanisms of resistance to STI571 in these
2 cell lines and find both similarities and distinct differences.
Cells and cell culture
Antibodies
Proteasome/protease inhibitors Calpain Inhibitor I (MG101; ALLN; N-Ac-Leu-Leu-norleucinal) was purchased from Calbiochem (La Jolla, CA), resuspended as a 200-mmol/L stock in dimethyl sulfoxide (DMSO), and stored at 20°C. AEBSF, hydrochloric acid (4-[2-Aminoethyl]
benzenesulfonylfluoride, HCl), was purchased from Calbiochem,
resuspended as a 100-mmol/L stock in water, and stored at
20°C. Proteasome Inhibitor I (PSI; z-Ile-Glu
[OtBu]-Ala-Leu-CHO) was purchased from Calbiochem, resuspended as a
50-mmol/L stock in DMSO, and stored at 20°C.
Clasto-Lactacystin -Lactone was purchased from Calbiochem,
resuspended as a 10-mmol/L stock in DMSO, and stored at
20°C. MG132 (z-Leu-Leu-Leu-H [aldehyde]) was
purchased from Peptide Institute (Osaka, Japan),
resuspended as a 10-mmol/L stock in DMSO, and stored at
20°C.
Immunoblotting Cells were lysed in lysis buffer containing 0.02 mol/L Tris, pH 8.0, 0.15 mol/L NaCl, 10% glycerol, 1% NP-40 (wt/vol), 0.1 mol/L NaF, 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L sodium orthovanadate, 40 µg/mL leupeptin, and 20 µg/mL aprotinin. Cell lysates were incubated on ice for 25 minutes, with vortexing every 5 minutes, and then centrifuged at 12 000g for 15 minutes. Protein yields were determined in the supernatants by Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, CA), and values were normalized accordingly. Protein lysates were dissolved in Laemmli's sample buffer by boiling for 5 minutes. Whole cell lysates were resolved on a sodium dodecyl sulfate (SDS) 7.5% polyacrylamide gel. Protein was then electrophoretically transferred to a Protran nitrocellulose transfer and immobilization membrane (Schleicher and Schuell, Dassel, Germany). The membrane was blocked either for 1 hour at 25°C or overnight at 4°C with 5% nonfat dry milk in 1 × TBS (10 mmol/L Tris-HCl, pH 8.0, 150 mmol/L NaCl), and then probed for 2 hours at 25°C or overnight at 4°C with antibody in 1 × TBST buffer (10 mmol/L Tris-HCl, pH 8.0, 150 mmol/L NaCl, 0.05% Tween20). Following 3 washes with 1 × TBST, membranes were incubated for 1 hour at 25°C with antimouse immunoglobulin (horseradish peroxidase linked whole antibody from sheep) or antirabbit immunoglobulin (horseradish peroxidase linked whole antibody from donkey) (Amersham Life Science, Arlington Heights, IL). The membrane was washed 5 times for 5 minutes/wash in 1 × TBST buffer, and bound antibodies were detected with enhanced luminol and oxidizing reagent as specified by the manufacturer (NEN Life Science Products, Boston, MA). Filters were stripped with stripping buffer (2% SDS, 0.0625 mol/L Tris, pH 6.8, and 0.7% 2-mercaptoethanol) for 30 minutes at 50°C prior to probing with additional antibodies.Northern blotting Total RNAs were extracted from 50 to 100 × 106 cells with the use of Trizol Reagent (Gibco BRL Life Technologies, Gaithersburg, MD), and then messenger RNA (mRNA) was extracted with the use of the Messagemaker Reagent Assembly Kit (Gibco BRL Life Technologies). Approximately 2 µg of mRNA per lane were electrophoresed overnight at 20 V on an ethidium-bromide-stained formaldehyde gel, denatured at room temperature for 30 minutes in 50 mmol/L NaOH, neutralized in 50 mmol/L Tris (pH 7.0) for 30 minutes, and transferred to a Genescreen Plus nylon membrane (NEN Life Science Products) overnight via capillary action. Messenger RNA was fixed to the membrane by UV crosslinking with a Stratalinker (Stratagene, La Jolla, CA), and prehybridized overnight in 50% deionized formamide, 4 × SSC, 0.02 mol/L Tris, 1 × Denhardt's Reagent (50 × Denhardt's Reagent contains 1% Ficoll, Type 400, 1% polyvinylpyrrolidone, and 1% bovine serum albumin [BSA], Fraction V), 0.5% SDS, and 10% dextran sulfate. 32P-labeled cDNA probe (1 to 2 × 106 cpm/mL), labeled by a Random Primed DNA Labeling Kit (Boehringer Mannheim GmbH, Germany) and purified by ProbeQuant G-50 Micro Columns (Amersham Pharmacia Biotech, Piscataway, NJ), was added to the prehybridization solution along with 10 µg/mL denatured salmon sperm DNA (Gibco BRL Life Technologies). Following overnight hybridization at 42°C, the membrane was washed for 20 minutes at 25°C with low-stringency wash buffer (2 × SSC, 0.1% SDS) and washed for 15 minutes at 25°C with high-stringency wash buffer (0.2 × SSC, 0.1% SDS). Filters were exposed to film for varying lengths of time.Southern blotting Genomic DNA (100 to 150 kilobases [kb]) was extracted from approximately 50 × 106 cells with the use of extraction buffer (10 mmol/L Tris-Cl, pH 8.0, 0.1 mol/L EDTA, pH 8.0, 20 µg/mL pancreatic RNAase, and 0.5% SDS) and treated with 100 µg/mL of proteinase K for 3 hours at 50°C. The solution was then extracted 3 times with phenol:chloroform:isoamyl alcohol (25:24:1), and genomic DNA was precipitated with 0.3 mol/L sodium acetate, pH 5.2, and 2 volumes of 100% ethanol. Pure genomic DNA was spooled out and washed twice with 70% ethanol. DNA was finally resuspended in 1 × TE buffer (10 mmol/L Tris-Cl, pH 8.0, 1 mmol/L EDTA, pH 8.0). DNA was digested with EcoRI, HindIII, StuI, and XhoI, and restriction fragments were separated by electrophoresis overnight at 20 V on a 0.8% ethidium bromide-stained agarose gel. Following electrophoresis, DNA was treated for 15 minutes at 25°C with 0.2 N HCl (for partial depurination), 30 minutes at 25°C with 0.4 N NaOH-0.6 mol/L NaCl (for hydrolysis of phosphodiester backbone), and 30 minutes at 25°C with 1.5 mol/L NaCl-0.5 mol/L Tris-Cl, pH 7.4 (for neutralization). Capillary transfer of DNA to a nylon filter, hybridization, and washing steps were carried out as described for Northern blotting.Probes Probes used in Northern and Southern analysis were generated by polymerase chain reaction (PCR) amplification of a BCR/ABL cDNA cloned in a pBluescript vector. PCR primers used for amplification of c-Bcr were 5'GGCGGCGCTCAGGTCCAACTTC3' (upper primer) and 5'CCAGCTCCTCATCGGGCACCAG3' (lower primer), which yield a product spanning the coding region of the c-Bcr gene from base pair (bp) 453 to bp 2332. PCR primers used for amplification of c-Abl were 5'TCGGAAGAGGGCAGGGGAGAAC3' (upper primer) and 5'GCCGGACCACTGCCTGCTGACG3' (lower primer), which yield a product spanning the C-terminus of the c-Abl gene coding region from bp 2289 to bp 3305. A human glyceraldehyde phosphodehydrogenase cDNA probe was generated by reverse transcriptase (RT)-PCR, subcloned into a TA vector (Invitrogen, Carlsbad, CA), and gel-purified. Primers used for amplification of a 332-bp portion of the 3' end of the gene were 5'TTCAAGGGGTCTACATGGCAACTG3' (upper primer) and 5'GGG- CATCCTGGGCTACACTG3' (lower primer).Quantitative PCR for Bcr/Abl Total RNA was isolated from DMSO-treated and STI571-resistant Ba/F3.p210 cells with the use of Trizol Reagent (Gibco BRL Life Technologies).Reverse transcription of 1 µg of total RNA isolated from DMSO-treated and STI571-resistant Ba/F3.p210 cells (see discussion of Northern blotting under "Results") was achieved by mixing the RNA with 2 µL of 10 × PCR buffer, 0.4 µL of deoxynucleotides (Perkin Elmer, Norwalk, CT), 0.65 µL of Random Hexamers (50 A260 Units) (Pharmacia, Piscataway, NJ), 0.25 µL RNAase Inhibitor (10 U/µL) (Gibco BRL Life Technologies), and 0.5 µL of Superscript II Reverse Transcriptase (200 U/µL) (Gibco BRL Life Technologies) in a 20-µL volume. This was followed by incubation of the mixture at 42°C for 60 minutes, and then for 5 minutes at 95°C.
FACS analysis Approximately 1 × 105 cells were incubated with Mdr-1 antibody (diluted 1:100) for 1 hour at 4°C. Cell/antibody mixtures were diluted with 1% BSA in 1 × PBS (PBSA) and centrifuged for 10 minutes at 2000 rpm. Cell pellets were then resuspended in fluorescein isothiocyanate (FITC)-conjugated antirabbit immunoglobulin (Ig)-G (H+L) (0.5 µg/mL) (Zymed, San Francisco, CA) and incubated for 45 minutes at 4°C. Samples were diluted with PBSA and centrifuged for 10 minutes at 2000 rpm. Cell pellets were resuspended in 3% formaldehyde in PBSA and analyzed by FACS analysis. As controls, cells were incubated at 4°C in the absence of Mdr-1 and FITC-conjugated antirabbit IgG antibodies, and cells were incubated at 4°C in the presence of only FITC-conjugated antirabbit IgG antibody. FACS analysis was performed as described above using MRP1 antibody (diluted 1:100) and antigoat IgG (whole molecule) FITC conjugate (Sigma, St Louis, MO).
STI571 inhibits tyrosine phosphorylation in Ba/F3.p210 and K562 cells The Abl tyrosine kinase inhibitor STI571 has previously been shown to inhibit the kinase activity of BCR/ABL.11,12 The concentration of STI571 that inhibits tyrosine phosphorylation by at least 50% in the BCR/ABL-transformed hematopoietic cell line, Ba/F3.p210, was determined by measuring tyrosine phosphorylation of cellular substrates of BCR/ABL by immunoblotting. Figure 1A shows that at 2 hours, levels of tyrosine phosphorylation began to decrease at 1 µmol/L STI571 and were barely detectable at 10 µmol/L STI571. Figure 1B shows that after 24 hours, 1 µmol/L STI571 decreased cellular tyrosine phosphorylation by more than 50%, as compared with DMSO-treated and untreated Ba/F3.p210 cells. STI571 did not appear to affect expression levels of BCR/ABL and c-Abl after 2 hours, although treatment for 24 hours with, respectively, 1 and 10 µmol/L STI571 resulted in a small reduction in the level of BCR/ABL. As with Ba/F3.p210 cells, tyrosine phosphorylation in K562 cells was potently inhibited by culturing cells in the presence of STI571 for 2 hours (Figure 1C).
Development of STI571-resistant Ba/F3.p210 cells Ba/F3.p210 cells were cultured in the presence of gradually increasing concentrations (0.01 µmol/L to 0.2 µmol/L) of STI571 over a period of 56 days. A subpopulation of these cells was placed in the presence of 1 µmol/L STI571, and the concentration of STI571 increased to 2.5 µmol/L in 4 steps over a period of 31 days. Protein, RNA, and DNA analyses were performed on cells resistant to 2 µmol/L STI571. Interestingly, although the cells achieved complete resistance to 2.5 µmol/L STI571, they were rapidly killed by 3 µmol/L STI571, even following several months of culturing in the presence of 2.5 µmol/L STI571 (data not shown). Whereas nonresistant Ba/F3.p210 cells rapidly die within 2 days of culture in the presence of 1 µmol/L STI571, drug-resistant Ba/F3.p210 cells grow well in 1 µmol/L STI571 (Figure 2A).
BCR/ABL protein expression and cellular tyrosine phosphorylation in STI571-resistant Ba/F3.p210 cells Protein lysates were prepared from STI571-resistant cells with the use of lysis buffer with a standard cocktail of protease inhibitors, including aprotinin, phenyl methyl sulfonyl fluoride, and leupeptin. BCR/ABL was then detected by immunoblotting with a monoclonal antibody directed against the SH2 domain of c-Abl (3F12). There was an increase in BCR/ABL protein in STI571-resistant Ba/F3.p210 cells, but multiple proteolytic cleavage products were observed (data not shown). STI571-resistant cells were then treated with a variety of proteasome and protease inhibitors while being continuously cultured in the presence of STI571. MG-132 (20 µmol/L, 4 hours), a reversible proteasome inhibitor that diminishes 26S complex-mediated degradation of ubiquitin-conjugated proteins, and the 20S proteasome inhibitors, Proteasome Inhibitor I (30 µmol/L to 100 µmol/L, 4 hours) and clasto-Lactacystin -lactone (30 µmol/L, 4 hours) did not reduce proteolytic cleavage.
Calpain Inhibitor I, an inhibitor of calpain I, calpain II, cathepsin B, cathepsin L, and neutral cysteine proteases (20 µmol/L and 50 µmol/L, 6 hours) had a
modest effect. However, AEBSF, a specific, cell-permeable, irreversible
inhibitor of serine proteases, such as trypsin, chymotrypsin, plasmin,
thrombin, and kallikrein, used at a concentration of 1 mmol/L for 20 minutes effectively reduced accumulation of
truncated BCR/ABL-related products and led to the reappearance of
apparently full-length p210 BCR/ABL. Therefore, all subsequent
experiments included AEBSF as indicated to reduce proteolytic cleavage
of the amplified BCR/ABL proteins occurring primarily during cell lysis.
Expression of BCR/ABL RNA in STI571-resistant and nonresistant
Ba/F3.p210 cells
Analysis of BCR/ABL gene in STI571-resistant and
nonresistant Ba/F3.p210 cells
Development of STI571-resistant K562 cells
BCR/ABL protein expression and cellular tyrosine
phosphorylation in STI571-resistant K562 cells
Expression of BCR/ABL RNA in STI571-resistant and nonresistant
K562 cells
Analysis of BCR/ABL gene in STI571-resistant and nonresistant K562 cells The BCR/ABL gene was investigated for amplification/alteration in STI571-resistant K562 cells. Southern analysis was performed on HindIII- and EcoRI-digested genomic DNA isolated from DMSO-treated nonresistant K562 cells and STI571-resistant K562 cells as described above. No differences were observed between nonresistant and STI571-resistant K562 cells in either DNA-banding pattern or signal intensity (data not shown).Mdr-1 and MRP1 protein expression in STI571-resistant K562 cells Flow cytometry was performed to determine if drug-resistant K562 cells had altered p-glycoprotein (Pgp) expression, as compared with nonresistant cells. No significant difference in levels of Mdr-1 or MRP1 was observed between the 2 cell populations (data not shown).
STI571 inhibits c-Abl tyrosine kinase activity by acting as a competitor for ATP.11 As a result of this inhibition, the proliferation of cells transformed by v-Abl, p190Bcr/Abl, p210Bcr/Abl, and TEL-ABL is suppressed.11-13,17 STI571 also inhibits colony formation and tumorigenicity of BCR/ABL- and Ph+ cells.11-13 STI571 induces apoptosis in BCR/ABL-positive cells14-16 without causing cell differentiation14; STI571-induced programmed cell death is accompanied by caspase activation.15
We are grateful to Dr Jerry Ritz and Antoinette Chillemi from the Dana Farber Cancer Institute for technical assistance with quantitative PCR.
Submitted August 5, 1999; accepted January 18, 2000.
Reprints: James D. Griffin, Dana Farber Cancer Institute, Department of Adult Oncology, 44 Binney St, Boston, MA 02115; e-mail: james_griffin{at}dfci.harvard.edu.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1. Shtivelman E, Lifshitz B, Gale RP, Canaani E. Fused transcript of abl and bcr genes in chronic myelogenous leukaemia. Nature. 1985;315:550[Medline] [Order article via Infotrieve]. 2. Heisterkamp N, Stam K, Groffen J, de Klein A, Grosveld G. Structural organization of the bcr gene and its role in the Ph' translocation. Nature. 1985;315:758[Medline] [Order article via Infotrieve].
3.
Ben-Neriah Y, Daley GQ, Mes-Masson AM, Witte ON, Baltimore D.
The chronic myelogenous leukemia-specific P210 protein is the product of the Bcr/Abl hybrid gene.
Science.
1986;233:212
4.
Daley GQ, McLaughlin J, Witte ON, Baltimore D.
The CML-specific P210 Bcr/Abl protein, unlike v-abl, does not transform NIH/3T3 fibroblasts.
Science.
1987;237:532
5.
Daley GQ, Baltimore D.
Transformation of an interleukin 3-dependent hematopoietic cell line by the chronic myelogenous leukemia-specific P210Bcr/Abl protein.
Proc Natl Acad Sci U S A.
1988;85:9312
6.
Lugo TG, Pendergast AM, Muller AJ, Witte ON.
Tyrosine kinase activity and transformation potency of bcr-abl oncogene products.
Science.
1990;247:1079
7.
McWhirter JR, Galasso DL, Wang JY.
A coiled-coil oligomerization domain of Bcr is essential for the transforming function of Bcr-Abl oncoproteins.
Mol Cell Biol.
1993;13:7587
8.
Yaish P, Gazit A, Gilon C, Levitzki A.
Blocking of EGF-dependent cell proliferation by EGF receptor kinase inhibitors.
Science.
1988;242:933
9.
Anafi M, Gazit A, Zehavi A, Ben-Neriah Y, Levitzki A.
Tyrphostin-induced inhibition of p210bcr-abl tyrosine kinase activity induces K562 to differentiate.
Blood.
1993;82:3524 10. Kaur G, Gazit A, Levitzki A, Stowe E, Cooney DA, Sausville EA. Tyrphostin induced growth inhibition: correlation with effect on p210bcr-abl autokinase activity in K562 chronic myelogenous leukemia. Anticancer Drugs. 1994;5:213[Medline] [Order article via Infotrieve].
11.
Buchdunger E, Zimmermann J, Mett H, et al.
Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative.
Cancer Res.
1996;56:100 12. Druker BJ, Tamura S, Buchdunger E, et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med. 1996;2:561[Medline] [Order article via Infotrieve].
13.
Deininger MW, Goldman JM, Lydon N, Melo JV.
The tyrosine kinase inhibitor CGP57148B selectively inhibits the growth of BCR-ABL-positive cells.
Blood.
1997;90:3691 14. Gambacorti-Passerini C, le Coutre P, Mologni L, et al. Inhibition of the ABL kinase activity blocks the proliferation of BCR/ABL+ leukemic cells and induces apoptosis. Blood Cells Mol Dis. 1997;23:380[Medline] [Order article via Infotrieve]. 15. Dan S, Naito M, Tsuruo T. Selective induction of apoptosis in Philadelphia chromosome-positive chronic myelogenous leukemia cells by an inhibitor of BCR-ABL tyrosine kinase, CGP 57148. Cell Death Differ. 1998;5:710[Medline] [Order article via Infotrieve]. 16. Beran M, Cao X, Estrov Z, et al. Selective inhibition of cell proliferation and BCR-ABL phosphorylation in acute lymphoblastic leukemia cells expressing Mr 190,000 BCR-ABL protein by a tyrosine kinase inhibitor (CGP-57148). Clin Cancer Res. 1998;4:1661[Abstract].
17.
Carroll M, Ohno-Jones S, Tamura S, et al.
CGP57148, a tyrosine kinase inhibitor, inhibits the growth of cells expressing BCR-ABL, TEL-ABL, and TEL-PDGFR fusion proteins.
Blood.
1997;90:4947 18. Druker BJ, Talpaz M, Resta D, et al. Clinical efficacy and safety of an ABL specific tyrosine kinase inhibitor as targeted therapy for chronic myelogenous leukemia [abstract]. Blood. 1999;99(suppl 1):368a.
19.
le Coutre P, Mologni L, Cleris L, et al.
In vivo eradication of human BCR/ABL-positive leukemia cells with an ABL kinase inhibitor.
J Natl Cancer Inst.
1999;91:163 20. Sattler M, Salgia R, Okuda K, et al. The proto-oncogene product p120CBL and the adaptor proteins CRKL and c-CRK link c-Abl, p190BCR/ABL, and p210BCR/ABL to the phosphatidylinositol-3' kinase pathway. Oncogene. 1996;12:839[Medline] [Order article via Infotrieve]. 21. Mensink E, van de Locht A, Schattenberg A, et al. Quantitation of minimal residual disease in Philadelphia chromosome positive chronic myeloid leukaemia patients using real-time quantitative RT-PCR. Br J Haematol. 1998;102:768[Medline] [Order article via Infotrieve]. 22. Kuo MT, Sen S, Hittelman WN, Hsu TC. Chromosomal fragile sites and DNA amplification in drug-resistant cells. Biochem Pharmacol. 1998;56:7[Medline] [Order article via Infotrieve].
23.
Tong Y, Liu-Chen X, Ercikan-Abali EA, et al.
Isolation and characterization of thymitaq (AG337) and 5-fluoro-2-deoxyuridylate-resistant mutants of human thymidylate synthase from ethyl methanesulfonate-exposed human sarcoma HT1080 cells.
J Biol Chem.
1998;273:11,611
24.
Lewis WH, Srinivasan PR.
Chromosome-mediated gene transfer of hydroxurea resistance and amplification of ribonucleotide activity.
Mol Cell Biol.
1983;3:1053
25.
Schaefer DI, Livanos EM, White AE, Tlsty TD.
Multiple mechanisms of N-(phosphonoacetyl)-L-aspartate drug resistance in SV40-infected precrisis human fibroblasts.
Cancer Res.
1993;53:4946
26.
Kuo MT, Vyas RC, Jiang LX, Hittelman WN.
Chromosome breakage at a major fragile site associated with P-glycoprotein gene amplification in multidrug-resistant CHO cells.
Mol Cell Biol.
1994;14:5202 27. Coquelle A, Pipiras E, Toledo F, Buttin G, Debatisse M. Expression of fragile sites triggers intrachromosomal mammalian gene amplification and sets boundaries to early amplicons. Cell. 1997;89:215[Medline] [Order article via Infotrieve]. 28. Bostock CJ, Clark EM. Satellite DNA in large marker chromosomes of methotrexate-resistant mouse cells. Cell. 1980;19:709[Medline] [Order article via Infotrieve].
29.
Slovak ML, Ho JP, Cole SP, et al.
The LRP gene encoding a major vault protein associated with drug resistance maps proximal to MRP on chromosome 16: evidence that chromosome breakage plays a key role in MRP or LRP gene amplification.
Cancer Res.
1995;55:4214 30. Eijdems EW, De Haas M, Coco-Martin JM, et al. Mechanisms of MRP over-expression in four human lung-cancer cell lines and analysis of the MRP amplicon. Int J Cancer. 1995;60:676[Medline] [Order article via Infotrieve]. 31. Coquelle A, Toledo F, Stern S, Bieth A, Debatisse M. A new role for hypoxia in tumor progression: induction of fragile site triggering genomic rearrangements and formation of complex DMs ad HSRs. Mol Cell. 1998;2:259[Medline] [Order article via Infotrieve]. 32. Collins SJ. Breakpoints on chromosomes 9 and 22 in Philadelphia chromosome-positive chronic myelogenous leukemia (CML): amplification of rearranged c-Abl oncogenes in CML blast crisis. J Clin Invest. 1986;78:1392.
33.
Collins SJ, Groudine MT.
Chronic myelogenous leukemia: amplification of a rearranged c-Abl oncogene in both chronic phase and blast crisis.
Blood.
1987;69:893 34. Wu SQ, Voelkerding KV, Sabatini L, Chen XR, Huang J, Meisner LF. Extensive amplification of Bcr/Abl fusion genes clustered on three marker chromosomes in human leukemic cell line K-562. Leukemia. 1995;9:858[Medline] [Order article via Infotrieve].
35.
Mechetner EB, Roninson IB.
Efficient inhibition of p-glycoprotein-mediated multidrug resistance with a monoclonal antibody.
Proc Natl Acad Sci U S A.
1992;89:5824 36. Serra M, Scotlandi K, Manara MC, et al. Establishment and characterization of multidrug-resistant human osteosarcoma cell lines. Anticancer Res. 1993;13:323[Medline] [Order article via Infotrieve].
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
D. H. Mak, W. D. Schober, W. Chen, M. Konopleva, J. Cortes, H. M. Kantarjian, M. Andreeff, and B. Z. Carter Triptolide induces cell death independent of cellular responses to imatinib in blast crisis chronic myelogenous leukemia cells including quiescent CD34+ primitive progenitor cells Mol. Cancer Ther., September 1, 2009; 8(9): 2509 - 2516. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Grosso, A. Puissant, M. Dufies, P. Colosetti, A. Jacquel, K. Lebrigand, P. Barbry, M. Deckert, J. P. Cassuto, B. Mari, et al. Gene expression profiling of imatinib and PD166326-resistant CML cell lines identifies Fyn as a gene associated with resistance to BCR-ABL inhibitors Mol. Cancer Ther., July 1, 2009; 8(7): 1924 - 1933. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Jabbour, H. M. Kantarjian, D. Jones, J. Shan, S. O'Brien, N. Reddy, W. G. Wierda, S. Faderl, G. Garcia-Manero, S. Verstovsek, et al. Imatinib mesylate dose escalation is associated with durable responses in patients with chronic myeloid leukemia after cytogenetic failure on standard-dose imatinib therapy Blood, March 5, 2009; 113(10): 2154 - 2160. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Michor Mathematical Models of Cancer Stem Cells J. Clin. Oncol., June 10, 2008; 26(17): 2854 - 2861. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mayerhofer, K. V. Gleixner, J. Mayerhofer, G. Hoermann, E. Jaeger, K. J. Aichberger, R. G. Ott, K. Greish, H. Nakamura, S. Derdak, et al. Targeting of heat shock protein 32 (Hsp32)/heme oxygenase-1 (HO-1) in leukemic cells in chronic myeloid leukemia: a novel approach to overcome resistance against imatinib Blood, February 15, 2008; 111(4): 2200 - 2210. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Boddy, J. Sludden, M. J. Griffin, C. Garner, J. Kendrick, P. Mistry, C. Dutreix, D. R. Newell, and S. G. O'Brien Pharmacokinetic Investigation of Imatinib Using Accelerator Mass Spectrometry in Patients with Chronic Myeloid Leukemia Clin. Cancer Res., July 15, 2007; 13(14): 4164 - 4169. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Peng, J. Brain, Y. Hu, A. Goodrich, L. Kong, D. Grayzel, R. Pak, M. Read, and S. Li Inhibition of heat shock protein 90 prolongs survival of mice with BCR-ABL-T315I-induced leukemia and suppresses leukemic stem cells Blood, July 15, 2007; 110(2): 678 - 685. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ray, S. W. Cowan-Jacob, P. W. Manley, J. Mestan, and J. D. Griffin Identification of BCR-ABL point mutations conferring resistance to the Abl kinase inhibitor AMN107 (nilotinib) by a random mutagenesis study Blood, June 1, 2007; 109(11): 5011 - 5015. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Baran, A. Salas, C. E. Senkal, U. Gunduz, J. Bielawski, L. M. Obeid, and B. Ogretmen Alterations of Ceramide/Sphingosine 1-Phosphate Rheostat Involved in the Regulation of Resistance to Imatinib-induced Apoptosis in K562 Human Chronic Myeloid Leukemia Cells J. Biol. Chem., April 13, 2007; 282(15): 10922 - 10934. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Weisberg, L. Catley, R. D. Wright, D. Moreno, L. Banerji, A. Ray, P. W. Manley, J. Mestan, D. Fabbro, J. Jiang, et al. Beneficial effects of combining nilotinib and imatinib in preclinical models of BCR-ABL+ leukemias Blood, March 1, 2007; 109(5): 2112 - 2120. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Baccarani, G. Saglio, J. Goldman, A. Hochhaus, B. Simonsson, F. Appelbaum, J. Apperley, F. Cervantes, J. Cortes, M. Deininger, et al. Evolving concepts in the management of chronic myeloid leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet Blood, September 15, 2006; 108(6): 1809 - 1820. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Copland, A. Hamilton, L. J. Elrick, J. W. Baird, E. K. Allan, N. Jordanides, M. Barow, J. C. Mountford, and T. L. Holyoake Dasatinib (BMS-354825) targets an earlier progenitor population than imatinib in primary CML but does not eliminate the quiescent fraction Blood, June 1, 2006; 107(11): 4532 - 4539. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Piwocka, S. Vejda, T. G. Cotter, G. C. O'Sullivan, and S. L. McKenna Bcr-Abl reduces endoplasmic reticulum releasable calcium levels by a Bcl-2-independent mechanism and inhibits calcium-dependent apoptotic signaling Blood, May 15, 2006; 107(10): 4003 - 4010. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Koyama, S. Koschmieder, S. Tyagi, I. Portero-Robles, J. Chromic, S. Myloch, H. Nurnberger, T. Rossmanith, W.-K. Hofmann, D. Hoelzer, et al. Inhibition of phosphotyrosine phosphatase 1B causes resistance in BCR-ABL-positive leukemia cells to the ABL kinase inhibitor STI571. Clin. Cancer Res., April 1, 2006; 12(7 Pt 1): 2025 - 2031. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chandra, J. Tracy, D. Loegering, K. Flatten, S. Verstovsek, M. Beran, M. Gorre, Z. Estrov, N. Donato, M. Talpaz, et al. Adaphostin-induced oxidative stress overcomes BCR/ABL mutation-dependent and -independent imatinib resistance Blood, March 15, 2006; 107(6): 2501 - 2506. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Caraglia, D. Santini, M. Marra, B. Vincenzi, G. Tonini, and A. Budillon Emerging anti-cancer molecular mechanisms of aminobisphosphonates. Endocr. Relat. Cancer, March 1, 2006; 13(1): 7 - 26. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Radich, H. Dai, M. Mao, V. Oehler, J. Schelter, B. Druker, C. Sawyers, N. Shah, W. Stock, C. L. Willman, et al. Gene expression changes associated with progression and response in chronic myeloid leukemia PNAS, February 21, 2006; 103(8): 2794 - 2799. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Z. Carter, D. H. Mak, W. D. Schober, M. Cabreira-Hansen, M. Beran, T. McQueen, W. Chen, and M. Andreeff Regulation of survivin expression through Bcr-Abl/MAPK cascade: targeting survivin overcomes imatinib resistance and increases imatinib sensitivity in imatinib-responsive CML cells Blood, February 15, 2006; 107(4): 1555 - 1563. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pricl, M. Fermeglia, M. Ferrone, and E. Tamborini T315I-mutated Bcr-Abl in chronic myeloid leukemia and imatinib: insights from a computational study Mol. Cancer Ther., August 1, 2005; 4(8): 1167 - 1174. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Golemovic, S. Verstovsek, F. Giles, J. Cortes, T. Manshouri, P. W. Manley, J. Mestan, M. Dugan, L. Alland, J. D. Griffin, et al. AMN107, a Novel Aminopyrimidine Inhibitor of Bcr-Abl, Has In vitro Activity against Imatinib-Resistant Chronic Myeloid Leukemia Clin. Cancer Res., July 1, 2005; 11(13): 4941 - 4947. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lee, Y.-J. Kim, C.-K. Min, H.-J. Kim, K.-S. Eom, D.-W. Kim, J.-W. Lee, W.-S. Min, and C.-C. Kim The effect of first-line imatinib interim therapy on the outcome of allogeneic stem cell transplantation in adults with newly diagnosed Philadelphia chromosome-positive acute lymphoblastic leukemia Blood, May 1, 2005; 105(9): 3449 - 3457. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Aichberger, M. Mayerhofer, M.-T. Krauth, H. Skvara, S. Florian, K. Sonneck, C. Akgul, S. Derdak, W. F. Pickl, V. Wacheck, et al. Identification of mcl-1 as a BCR/ABL-dependent target in chronic myeloid leukemia (CML): evidence for cooperative antileukemic effects of imatinib and mcl-1 antisense oligonucleotides Blood, April 15, 2005; 105(8): 3303 - 3311. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Volk, H. Potschka, and W. Loscher Immunohistochemical Localization of P-glycoprotein in Rat Brain and Detection of Its Increased Expression by Seizures Are Sensitive to Fixation and Staining Variables J. Histochem. Cytochem., April 1, 2005; 53(4): 517 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Deininger, E. Buchdunger, and B. J. Druker The development of imatinib as a therapeutic agent for chronic myeloid leukemia Blood, April 1, 2005; 105(7): 2640 - 2653. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. von Bubnoff, D. R. Veach, H. van der Kuip, W. E. Aulitzky, J. Sanger, P. Seipel, W. G. Bornmann, C. Peschel, B. Clarkson, and J. Duyster A cell-based screen for resistance of Bcr-Abl-positive leukemia identifies the mutation pattern for PD166326, an alternative Abl kinase inhibitor Blood, February 15, 2005; 105(4): 1652 - 1659. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gumireddy, S. J. Baker, S. C. Cosenza, P. John, A. D. Kang, K. A. Robell, M. V. R. Reddy, and E. P. Reddy A non-ATP-competitive inhibitor of BCR-ABL overrides imatinib resistance PNAS, February 8, 2005; 102(6): 1992 - 1997. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Kantarjian, J. E. Cortes, S. O'Brien, R. Luthra, F. Giles, S. Verstovsek, S. Faderl, D. Thomas, G. Garcia-Manero, M. B. Rios, et al. Long-term survival benefit and improved complete cytogenetic and molecular response rates with imatinib mesylate in Philadelphia chromosome-positive chronic-phase chronic myeloid leukemia after failure of interferon-{alpha} Blood, October 1, 2004; 104(7): 1979 - 1988. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Baker, J. G. Gurney, K. K. Ness, R. Bhatia, S. J. Forman, L. Francisco, P. B. McGlave, L. L. Robison, D. S. Snyder, D. J. Weisdorf, et al. Late effects in survivors of chronic myeloid leukemia treated with hematopoietic cell transplantation: results from the Bone Marrow Transplant Survivor Study Blood, September 15, 2004; 104(6): 1898 - 1906. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Harata, Y. Soda, K. Tani, J. Ooi, T. Takizawa, M. Chen, Y. Bai, K. Izawa, S. Kobayashi, A. Tomonari, et al. CD19-targeting liposomes containing imatinib efficiently kill Philadelphia chromosome-positive acute lymphoblastic leukemia cells Blood, September 1, 2004; 104(5): 1442 - 1449. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kantarjian, M. Talpaz, S. O'Brien, G. Garcia-Manero, S. Verstovsek, F. Giles, M. B. Rios, J. Shan, L. Letvak, D. Thomas, et al. High-dose imatinib mesylate therapy in newly diagnosed Philadelphia chromosome-positive chronic phase chronic myeloid leukemia Blood, April 15, 2004; 103(8): 2873 - 2878. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bagrintseva, R. Schwab, T. M. Kohl, S. Schnittger, S. Eichenlaub, J. W. Ellwart, W. Hiddemann, and K. Spiekermann Mutations in the tyrosine kinase domain of FLT3 define a new molecular mechanism of acquired drug resistance to PTK inhibitors in FLT3-ITD-transformed hematopoietic cells Blood, March 15, 2004; 103(6): 2266 - 2275. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Donato, J. Y. Wu, J. Stapley, H. Lin, R. Arlinghaus, B. Aggarwal, S. Shishodin, M. Albitar, K. Hayes, H. Kantarjian, et al. Imatinib Mesylate Resistance Through BCR-ABL Independence in Chronic Myelogenous Leukemia Cancer Res., January 15, 2004; 64(2): 672 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. T. Ferrao, M. J. Frost, S.-P. Siah, and L. K. Ashman Overexpression of P-glycoprotein in K562 cells does not confer resistance to the growth inhibitory effects of imatinib (STI571) in vitro Blood, December 15, 2003; 102(13): 4499 - 4503. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Grunberger, P. Demin, O. Rounova, N. Sharfe, L. Cimpean, H. Dadi, A. Freywald, Z. Estrov, and C. M. Roifman Inhibition of acute lymphoblastic and myeloid leukemias by a novel kinase inhibitor Blood, December 1, 2003; 102(12): 4153 - 4158. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Kirschner and K. Baltensperger Erythropoietin Promotes Resistance Against the Abl Tyrosine Kinase Inhibitor Imatinib (STI571) in K562 Human Leukemia Cells Mol. Cancer Res., November 1, 2003; 1(13): 970 - 980. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Goldman and J. V. Melo Chronic Myeloid Leukemia -- Advances in Biology and New Approaches to Treatment N. Engl. J. Med., October 9, 2003; 349(15): 1451 - 1464. [Full Text] [PDF] |
||||
![]() |
J. Kuroda, S. Kimura, H. Segawa, Y. Kobayashi, T. Yoshikawa, Y. Urasaki, T. Ueda, F. Enjo, H. Tokuda, O. G. Ottmann, et al. The third-generation bisphosphonate zoledronate synergistically augments the anti-Ph+ leukemia activity of imatinib mesylate Blood, September 15, 2003; 102(6): 2229 - 2235. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. N. Deininger and B. J. Druker Specific Targeted Therapy of Chronic Myelogenous Leukemia with Imatinib Pharmacol. Rev., September 1, 2003; 55(3): 401 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cortes, F. Giles, S. O'Brien, D. Thomas, G. Garcia-Manero, M. B. Rios, S. Faderl, S. Verstovsek, A. Ferrajoli, E. J. Freireich, et al. Result of high-dose imatinib mesylate in patients with Philadelphia chromosome--positive chronic myeloid leukemia after failure of interferon-{alpha} Blood, July 1, 2003; 102(1): 83 - 86. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Branford, Z. Rudzki, S. Walsh, I. Parkinson, A. Grigg, J. Szer, K. Taylor, R. Herrmann, J. F. Seymour, C. Arthur, et al. Detection of BCR-ABL mutations in patients with CML treated with imatinib is virtually always accompanied by clinical resistance, and mutations in the ATP phosphate-binding loop (P-loop) are associated with a poor prognosis Blood, July 1, 2003; 102(1): 276 - 283. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kurzrock, H. M. Kantarjian, B. J. Druker, and M. Talpaz Philadelphia Chromosome-Positive Leukemias: From Basic Mechanisms to Molecular Therapeutics Ann Intern Med, May 20, 2003; 138(10): 819 - 830. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yu, M. Rahmani, J. Almenara, M. Subler, G. Krystal, D. Conrad, L. Varticovski, P. Dent, and S. Grant Histone Deacetylase Inhibitors Promote STI571-mediated Apoptosis in STI571-sensitive and -resistant Bcr/Abl+ Human Myeloid Leukemia Cells Cancer Res., May 1, 2003; 63(9): 2118 - 2126. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nimmanapalli, L. Fuino, C. Stobaugh, V. Richon, and K. Bhalla Cotreatment with the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) enhances imatinib-induced apoptosis of Bcr-Abl-positive human acute leukemia cells Blood, April 15, 2003; 101(8): 3236 - 3239. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Mohamed, P. Pemberton, J. Zonder, and C. A. Schiffer The Effect of Imatinib Mesylate on Patients with Philadelphia Chromosome-positive Chronic Myeloid Leukemia with Secondary Chromosomal Aberrations Clin. Cancer Res., April 1, 2003; 9(4): 1333 - 1337. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-X. Mahon, F. Belloc, V. Lagarde, C. Chollet, F. Moreau-Gaudry, J. Reiffers, J. M. Goldman, and J. V. Melo MDR1 gene overexpression confers resistance to imatinib mesylate in leukemia cell line models Blood, March 15, 2003; 101(6): 2368 - 2373. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nakajima, T. Tauchi, M. Sumi, W. R. Bishop, and K. Ohyashiki Efficacy of SCH66336, a Farnesyl Transferase Inhibitor, in Conjunction with Imatinib against BCR-ABL-positive Cells Mol. Cancer Ther., March 1, 2003; 2(3): 219 - 224. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tatton, G. M. Morley, R. Chopra, and A. Khwaja The Src-selective Kinase Inhibitor PP1 Also Inhibits Kit and Bcr-Abl Tyrosine Kinases J. Biol. Chem., February 7, 2003; 278(7): 4847 - 4853. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gambacorti-Passerini, M. Zucchetti, D. Russo, R. Frapolli, M. Verga, S. Bungaro, L. Tornaghi, F. Rossi, P. Pioltelli, E. Pogliani, et al. {alpha}1 Acid Glycoprotein Binds to Imatinib (STI571) and Substantially Alters Its Pharmacokinetics in Chronic Myeloid Leukemia Patients Clin. Cancer Res., February 1, 2003; 9(2): 625 - 632. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Donato, J. Y. Wu, J. Stapley, G. Gallick, H. Lin, R. Arlinghaus, and M. Talpaz BCR-ABL independence and LYN kinase overexpression in chronic myelogenous leukemia cells selected for resistance to STI571 Blood, January 15, 2003; 101(2): 690 - 698. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Kantarjian, M. Talpaz, S. O'Brien, F. Giles, G. Garcia-Manero, S. Faderl, D. Thomas, J. Shan, M. B. Rios, and J. Cortes Dose escalation of imatinib mesylate can overcome resistance to standard-dose therapy in patients with chronic myelogenous leukemia Blood, January 15, 2003; 101(2): 473 - 475. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. V. Melo, T. P. Hughes, and J. F. Apperley Chronic Myeloid Leukemia Hematology, January 1, 2003; 2003(1): 132 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ricci, B. Scappini, V. Divoky, S. Gatto, F. Onida, S. Verstovsek, H. M. Kantarjian, and M. Beran Mutation in the ATP-binding Pocket of the ABL Kinase Domain in an STI571-resistant BCR/ABL-positive Cell Line Cancer Res., November 1, 2002; 62(21): 5995 - 5998. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nimmanapalli, E. O'Bryan, M. Huang, P. Bali, P. K. Burnette, T. Loughran, J. Tepperberg, R. Jove, and K. Bhalla Molecular Characterization and Sensitivity of STI-571 (Imatinib Mesylate, Gleevec)-resistant, Bcr-Abl-positive, Human Acute Leukemia Cells to SRC Kinase Inhibitor PD180970 and 17-Allylamino-17-demethoxygeldanamycin Cancer Res., October 15, 2002; 62(20): 5761 - 5769. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yu, G. Krystal, P. Dent, and S. Grant Flavopiridol Potentiates STI571-induced Mitochondrial Damage and Apoptosis in BCR-ABL-positive Human Leukemia Cells Clin. Cancer Res., September 1, 2002; 8(9): 2976 - 2984. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. G. Ottmann, B. J. Druker, C. L. Sawyers, J. M. Goldman, J. Reiffers, R. T. Silver, S. Tura, T. Fischer, M. W. Deininger, C. A. Schiffer, et al. A phase 2 study of imatinib in patients with relapsed or refractory Philadelphia chromosome-positive acute lymphoid leukemias Blood, August 28, 2002; 100(6): 1965 - 1971. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wisniewski, C. L. Lambek, C. Liu, A. Strife, D. R. Veach, B. Nagar, M. A. Young, T. Schindler, W. G. Bornmann, J. R. Bertino, et al. Characterization of Potent Inhibitors of the Bcr-Abl and the c-Kit Receptor Tyrosine Kinases Cancer Res., August 1, 2002; 62(15): 4244 - 4255. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Roche-Lestienne, V. Soenen-Cornu, N. Grardel-Duflos, J.-L. Lai, N. Philippe, T. Facon, P. Fenaux, and C. Preudhomme Several types of mutations of the Abl gene can be found in chronic myeloid leukemia patients resistant to STI571, and they can pre-exist to the onset of treatment Blood, July 18, 2002; 100(3): 1014 - 1018. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Hoover, F.-X. Mahon, J. V. Melo, and G. Q. Daley Overcoming STI571 resistance with the farnesyl transferase inhibitor SCH66336 Blood, July 18, 2002; 100(3): 1068 - 1071. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Dash, I. R. Williams, J. L. Kutok, M. H. Tomasson, E. Anastasiadou, K. Lindahl, S. Li, R. A. Van Etten, J. Borrow, D. Housman, et al. A murine model of CML blast crisis induced by cooperation between BCR/ABL and NUP98/HOXA9 PNAS, May 28, 2002; 99(11): 7622 - 7627. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Sawyers, A. Hochhaus, E. Feldman, J. M. Goldman, C. B. Miller, O. G. Ottmann, C. A. Schiffer, M. Talpaz, F. Guilhot, M. W. N. Deininger, et al. Imatinib induces hematologic and cytogenetic responses in patients with chronic myelogenous leukemia in myeloid blast crisis: results of a phase II study Blood, May 15, 2002; 99(10): 3530 - 3539. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Branford, Z. Rudzki, S. Walsh, A. Grigg, C. Arthur, K. Taylor, R. Herrmann, K. P. Lynch, and T. P. Hughes High frequency of point mutations clustered within the adenosine triphosphate-binding region of BCR/ABL in patients with chronic myeloid leukemia or Ph-positive acute lymphoblastic leukemia who develop imatinib (STI571) resistance Blood, May 1, 2002; 99(9): 3472 - 3475. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Talpaz, R. T. Silver, B. J. Druker, J. M. Goldman, C. Gambacorti-Passerini, F. Guilhot, C. A. Schiffer, T. Fischer, M. W. N. Deininger, A. L. Lennard, et al. Imatinib induces durable hematologic and cytogenetic responses in patients with accelerated phase chronic myeloid leukemia: results of a phase 2 study Blood, March 15, 2002; 99(6): 1928 - 1937. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Baron, A. G. Turhan, J. Giron-Michel, B. Azzarone, M. Bentires-Alj, V. Bours, J. H. Bourhis, S. Chouaib, and A. Caignard Leukemic target susceptibility to natural killer cytotoxicity: relationship with BCR-ABL expression Blood, March 15, 2002; 99(6): 2107 - 2113. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-K. Hofmann, L. C. Jones, N. A. Lemp, S. de Vos, H. Gschaidmeier, D. Hoelzer, O. G. Ottmann, and H. P. Koeffler Ph+ acute lymphoblastic leukemia resistant to the tyrosine kinase inhibitor STI571 has a unique BCR-ABL gene mutation Blood, March 1, 2002; 99(5): 1860 - 1862. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Savage and K. H. Antman Imatinib Mesylate -- A New Oral Targeted Therapy N. Engl. J. Med., February 28, 2002; 346(9): 683 - 693. [Full Text] [PDF] |
||||
![]() |
B. M. F. Mow, J. Chandra, P. A. Svingen, C. G. Hallgren, E. Weisberg, T. J. Kottke, V. L. Narayanan, M. R. Litzow, J. D. Griffin, E. A. Sausville, et al. Effects of the Bcr/abl kinase inhibitors STI571 and adaphostin (NSC 680410) on chronic myelogenous leukemia cells in vitro Blood, January 15, 2002; 99(2): 664 - 671. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. G. Jorgensen, M. A. Elliott, E. K. Allan, C. E. Carr, T. L. Holyoake, and K. D. Smith alpha 1-Acid glycoprotein expressed in the plasma of chronic myeloid leukemia patients does not mediate significant in vitro resistance to STI571 Blood, January 15, 2002; 99(2): 713 - 715. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Mauro, M. O'Dwyer, M. C. Heinrich, and B. J. Druker STI571: A Paradigm of New Agents for Cancer Therapeutics J. Clin. Oncol., January 1, 2002; 20(1): 325 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yu, G. Krystal, L. Varticovksi, R. McKinstry, M. Rahmani, P. Dent, and S. Grant Pharmacologic Mitogen-activated Protein/Extracellular Signal-regulated Kinase Kinase/Mitogen-activated Protein Kinase Inhibitors Interact Synergistically with STI571 to Induce Apoptosis in Bcr/Abl-expressing Human Leukemia Cells Cancer Res., January 1, 2002; 62(1): 188 - 199. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hawk, T. Sun, S. Xie, Y. Wang, Y. Wu, J. Liu, and R. B. Arlinghaus Inhibition of the Bcr-Abl Oncoprotein by Bcr Requires Phosphoserine 354 Cancer Res., January 1, 2002; 62(2): 386 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhang, P. N. Raghunath, L. Xue, M. Majewski, D. F. Carpentieri, N. Odum, S. Morris, T. Skorski, and M. A. Wasik Multilevel Dysregulation of STAT3 Activation in Anaplastic Lymphoma Kinase-Positive T/Null-Cell Lymphoma J. Immunol., January 1, 2002; 168(1): 466 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Graham, H. G. Jorgensen, E. Allan, C. Pearson, M. J. Alcorn, L. Richmond, and T. L. Holyoake Primitive, quiescent, Philadelphia-positive stem cells from patients with chronic myeloid leukemia are insensitive to STI571 in vitro Blood, January 1, 2002; 99(1): 319 - 325. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C. Wolff and R. L. Ilaria Jr Establishment of a murine model for therapy-treated chronic myelogenous leukemia using the tyrosine kinase inhibitor STI571 Blood, November 1, 2001; 98(9): 2808 - 2816. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Barthe, P. Cony-Makhoul, J. V. Melo, J. R. F.-X. Mahon, A. Hochhaus, S. Kreil, A. Corbin, P. La Rosee, T. Lahaye, U. Berger, et al. Roots of Clinical Resistance to STI-571 Cancer Therapy Science, September 21, 2001; 293(5538): 2163a - 2163. [Full Text] [PDF] |
||||
![]() |
B. A. Chabner The Oncologic Four-Minute Mile Oncologist, June 1, 2001; 6(3): 230 - 232. [Full Text] [PDF] |
||||
![]() |
M. J. Mauro and B. J. Druker STI571: Targeting BCR-ABL as Therapy for CML Oncologist, June 1, 2001; 6(3): 233 - 238. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Druker, C. L. Sawyers, H. Kantarjian, D. J. Resta, S. F. Reese, J. M. Ford, R. Capdeville, and M. Talpaz Activity of a Specific Inhibitor of the BCR-ABL Tyrosine Kinase in the Blast Crisis of Chronic Myeloid Leukemia and Acute Lymphoblastic Leukemia with the Philadelphia Chromosome N. Engl. J. Med., April 5, 2001; 344(14): 1038 - 1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Goldman and J. V. Melo Targeting the BCR-ABL Tyrosine Kinase in Chronic Myeloid Leukemia N. Engl. J. Med., April 5, 2001; 344(14): 1084 - 1086. [Full Text] [PDF] |
||||
![]() |
X. Sun, J. E. Layton, A. Elefanty, and G. J. Lieschke Comparison of effects of the tyrosine kinase inhibitors AG957, AG490, and STI571 on BCR-ABL-expressing cells, demonstrating synergy between AG490 and STI571 Blood, April 1, 2001; 97(7): 2008 - 2015. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nimmanapalli, E. OBryan, and K. Bhalla Geldanamycin and Its Analogue 17-Allylamino-17-demethoxygeldanamycin Lowers Bcr-Abl Levels and Induces Apoptosis and Differentiation of Bcr-Abl-positive Human Leukemic Blasts Cancer Res., March 1, 2001; 61(5): 1799 - 1804. [Abstract] [Full Text] |
||||
![]() |
D. G. Peters, R. R. Hoover, M. J. Gerlach, E. Y. Koh, H. Zhang, K. Choe, P. Kirschmeier, W. R. Bishop, and G. Q. Daley Activity of the farnesyl protein transferase inhibitor SCH66336 against BCR/ABL-induced murine leukemia and primary cells from patients with chronic myeloid leukemia Blood, March 1, 2001; 97(5): 1404 - 1412. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nimmanapalli, M. Porosnicu, D. Nguyen, E. Worthington, E. OBryan, C. Perkins, and K. Bhalla Cotreatment with STI-571 Enhances Tumor Necrosis Factor {{alpha}}-related Apoptosis-inducing Ligand (TRAIL or Apo-2L)- induced Apoptosis of Bcr-Abl-positive Human Acute Leukemia Cells Clin. Cancer Res., February 1, 2001; 7(2): 350 - 357. [Abstract] [Full Text] |
||||
![]() |
B. J. Druker, C. L. Sawyers, R. Capdeville, J. M. Ford, M. Baccarani, and J. M. Goldman Chronic Myelogenous Leukemia Hematology, January 1, 2001; 2001(1): 87 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. A. Knight;, C. Gambacorti-Passerini, P. le Coutre, E. Tassi, and H. Ruchatz Another possible mechanism of resistance to STI571 Blood, December 1, 2000; 96(12): 4003 - 4005. [Full Text] [PDF] |
||||
![]() |
C. Gambacorti-Passerini, R. Barni, P. le Coutre, M. Zucchetti, G. Cabrita, L. Cleris, F. Rossi, E. Gianazza, J. Brueggen, R. Cozens, et al. Role of {alpha}1 Acid Glycoprotein in the In Vivo Resistance of Human BCR-ABL+ Leukemic Cells to the Abl Inhibitor STI571 J Natl Cancer Inst, October 18, 2000; 92(20): 1641 - 1650. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Grossbard Hematologic Malignancies: Selected Abstracts and Commentary Oncologist, August 1, 2000; 5(4): 280 - 284. [Abstract] [Full Text] |
||||
![]() |
M. E. Gorre, M. Mohammed, K. Ellwood, N. Hsu, R. Paquette, P. N. Rao, and C. L. Sawyers Clinical Resistance to STI-571 Cancer Therapy Caused by BCR-ABL Gene Mutation or Amplification Science, August 3, 2001; 293(5531): 876 - 880. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||