Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weisberg, E.
Right arrow Articles by Griffin, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weisberg, E.
Right arrow Articles by Griffin, J. D.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrowRelated Letter in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 95 No. 11 (June 1), 2000: pp. 3498-3505

NEOPLASIA

Mechanism of resistance to the ABL tyrosine kinase inhibitor STI571 in BCR/ABL-transformed hematopoietic cell lines

Ellen Weisberg and James D. Griffin

From the Department of Adult Oncology, Dana Farber Cancer Institute, Department of Medicine, Brigham and Women's Hospital, and Department of Medicine, Harvard Medical School, Boston, MA.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The tyrosine kinase activity of the Bcr/Abl oncogene is required for transformation of hematopoietic cells. The tyrosine kinase inhibitor STI571 (formerly called CGP57148B, Novartis Pharmaceuticals) inhibits BCR/ABL, TEL/ABL, and v-ABL kinase activity and inhibits growth and viability of cells transformed by any of these ABL oncogenes. Here we report the generation of 2 BCR/ABL-positive cell lines that have developed partial resistance to STI571. BCR/ABL-transformed Ba/F3 hematopoietic cells and Philadelphia-positive human K562 cells were cultured in gradually increasing concentrations of STI571 over a period of several months to generate resistant lines. Resistant Ba/F3.p210 cells were found to have an increase in Bcr/Abl messenger RNA, amplification of the Bcr/Abl transgene, and a greater than tenfold increase in the level of BCR/ABL protein. In contrast to Ba/F3.p210 cells, drug-resistant K562 cells did not undergo detectable amplification of the BCR/ABL gene, although they displayed a 2-fold to 3-fold increase in p210BCR/ABL protein. The addition of STI571 to both resistant Ba/F3.p210 and K562 cells resulted in a rapid reduction of tyrosine phosphorylation of cellular proteins, similar to that observed for nonresistant cells. However, the inhibition of kinase activity was transient and partial and was not accompanied by apoptosis. The results suggest that resistance to STI571 may be multifactorial. Increased expression of the target protein BCR/ABL was observed in both lines, and resulted from oncogene amplification in one line. However, altered drug metabolism, transport, or other related mechanisms may also contribute to drug resistance. (Blood. 2000;95:3498-3505)

© 2000 by The American Society of Hematology.


    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Chronic myelogenous leukemia (CML) is a clonal myeloproliferative disorder that is characterized by excessive production, and premature release, of both mature and immature myeloid cells. CML is caused by the 210-kd BCR/ABL oncoprotein, a chimeric fusion of either exon 2 or exon 3 of c-Bcr and exon 2 of c-Abl, which results from the Philadelphia (Ph) chromosome translocation t (9,22).1-3 One of the hallmarks of BCR/ABL transformation is the greatly elevated ABL tyrosine kinase activity, which is possibly related to oligomerization of BCR/ABL owing to the presence of a coiled-coil motif in BCR.4-7

Since transformation by BCR/ABL is absolutely dependent on tyrosine kinase activity,6 it has been evident for some time that a drug that inhibited ABL tyrosine kinase activity could be of therapeutic value. Synthesis of a class of tyrosine kinase-specific inhibitors called tyrphostins8 led to the discovery of an inhibitor of ABL tyrosine kinase toxic to the human CML cell line K562.9,10 More recently, STI571, a more potent and highly selective ABL tyrosine kinase inhibitor of the 2-phenyl-amino pyrimidine class, was developed.11,12 This compound, synthesized using the structure of the ATP binding site of protein kinases, selectively inhibits the anchorage-independent growth and tumorigenicity of v-Abl-transformed cells,11 inhibits the ability of BCR/ABL-positive cells to proliferate and develop tumors, and suppresses the formation of BCR/ABL colony formation in cells derived from peripheral blood or bone marrow from CML patients.12,13 STI571 induces apoptosis in a variety of BCR/ABL-positive cell lines and Ph+ cells.14-16 In addition to the p210 form of BCR/ABL (B2A2), STI571 also inhibits the p190 form of BCR/ABL (B1A2).16,17 STI571 is also effective in inhibiting the kinase activity of platelet-derived growth factor receptor (PDGFR)11 and TEL-PDGFR, an activated PDGFR kinase.17 Preliminary results from a phase I dose-escalating clinical trial suggest that STI571 has significant activity in stable and advanced phases of CML.18

A recent study demonstrated the need for a continuous block of BCR/ABL tyrosine kinase activity by STI571 to effectively cure BCR/ABL-positive tumor-bearing nude mice treated with the inhibitor.19 Since chronic or repeated administration of STI571 to CML patients may be necessary for successful treatment, we were interested in identifying potential mechanisms of resistance to this compound. Two cell lines were selected for study. K562 is a human Ph+ cell line derived from a patient with CML. Ba/F3.p210 was derived in our laboratory by transfecting a BCR/ABL complementary DNA (cDNA) into the nontransformed murine hematopoietic cell line Ba/F3. In this study, we have compared the mechanisms of resistance to STI571 in these 2 cell lines and find both similarities and distinct differences.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Cells and cell culture

Ba/F3.p210 cells were generated by transfection of the interleukin (IL)-3-dependent murine hematopoietic cell line, Ba/F3, with a pGD vector containing p210Bcr/Abl (B2A2) cDNA,5 as previously described.20 The human chronic myelogenous leukemia cell line, K562, was purchased from ATCC (Rockville, MD). Cells were cultured in RPMI 1640 medium (Mediatech, Herndon, VA) with 10% fetal calf serum and supplemented with 1% glutamine. Cells were maintained at a concentration of 2 to 5 × 105 cells/mL at 37°C with 5% CO2.

Antibodies

Anti-pTyr, monoclonal antibody (mAb) #4G10, was a gift from Dr Brian Druker, University of Oregon Health Sciences Center (Portland, OR) and was used at 1:2500 for immunoblotting. Anti-SHP2, mAb #79 from Transduction Laboratories (Lexington, KY), was used at 1:2000 for immunoblot. Anti-ABL (clone 3F12), which is directed against the SH2 domain of c-Abl, was developed by Dr Ravi Salgia and Dr James Griffin, Dana Farber Cancer Institute (Boston, MA) and was used at 1:500 for immunoblot. Anti-BCR, pAb N-20, directed against the amino terminus of human c-Bcr, was purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA), and was used at 1:200 for immunoblot. Anti-BCLXL, mAb #4 from Transduction Laboratories, was used at 1:2000 for immunoblot. Anti-Mdr-1, pAb H-241, directed against the carboxy terminus of human Mdr-1, was purchased from Santa Cruz Biotechnology, Inc, and used for fluorescence-activated cell sorter (FACS) analysis. Anti-MRP1, pAb N-19, directed against the amino terminus of human MRP-1, was purchased from Santa Cruz Biotechnology, and used for FACS analysis.

Proteasome/protease inhibitors

Calpain Inhibitor I (MG101; ALLN; N-Ac-Leu-Leu-norleucinal) was purchased from Calbiochem (La Jolla, CA), resuspended as a 200-mmol/L stock in dimethyl sulfoxide (DMSO), and stored at -20°C. AEBSF, hydrochloric acid (4-[2-Aminoethyl] benzenesulfonylfluoride, HCl), was purchased from Calbiochem, resuspended as a 100-mmol/L stock in water, and stored at -20°C. Proteasome Inhibitor I (PSI; z-Ile-Glu [OtBu]-Ala-Leu-CHO) was purchased from Calbiochem, resuspended as a 50-mmol/L stock in DMSO, and stored at -20°C. Clasto-Lactacystin beta -Lactone was purchased from Calbiochem, resuspended as a 10-mmol/L stock in DMSO, and stored at -20°C. MG132 (z-Leu-Leu-Leu-H [aldehyde]) was purchased from Peptide Institute (Osaka, Japan), resuspended as a 10-mmol/L stock in DMSO, and stored at -20°C.

Immunoblotting

Cells were lysed in lysis buffer containing 0.02 mol/L Tris, pH 8.0, 0.15 mol/L NaCl, 10% glycerol, 1% NP-40 (wt/vol), 0.1 mol/L NaF, 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L sodium orthovanadate, 40 µg/mL leupeptin, and 20 µg/mL aprotinin. Cell lysates were incubated on ice for 25 minutes, with vortexing every 5 minutes, and then centrifuged at 12 000g for 15 minutes. Protein yields were determined in the supernatants by Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, CA), and values were normalized accordingly. Protein lysates were dissolved in Laemmli's sample buffer by boiling for 5 minutes. Whole cell lysates were resolved on a sodium dodecyl sulfate (SDS) 7.5% polyacrylamide gel. Protein was then electrophoretically transferred to a Protran nitrocellulose transfer and immobilization membrane (Schleicher and Schuell, Dassel, Germany). The membrane was blocked either for 1 hour at 25°C or overnight at 4°C with 5% nonfat dry milk in 1 × TBS (10 mmol/L Tris-HCl, pH 8.0, 150 mmol/L NaCl), and then probed for 2 hours at 25°C or overnight at 4°C with antibody in 1 × TBST buffer (10 mmol/L Tris-HCl, pH 8.0, 150 mmol/L NaCl, 0.05% Tween20). Following 3 washes with 1 × TBST, membranes were incubated for 1 hour at 25°C with antimouse immunoglobulin (horseradish peroxidase linked whole antibody from sheep) or antirabbit immunoglobulin (horseradish peroxidase linked whole antibody from donkey) (Amersham Life Science, Arlington Heights, IL). The membrane was washed 5 times for 5 minutes/wash in 1 × TBST buffer, and bound antibodies were detected with enhanced luminol and oxidizing reagent as specified by the manufacturer (NEN Life Science Products, Boston, MA). Filters were stripped with stripping buffer (2% SDS, 0.0625 mol/L Tris, pH 6.8, and 0.7% 2-mercaptoethanol) for 30 minutes at 50°C prior to probing with additional antibodies.

Northern blotting

Total RNAs were extracted from 50 to 100 × 106 cells with the use of Trizol Reagent (Gibco BRL Life Technologies, Gaithersburg, MD), and then messenger RNA (mRNA) was extracted with the use of the Messagemaker Reagent Assembly Kit (Gibco BRL Life Technologies). Approximately 2 µg of mRNA per lane were electrophoresed overnight at 20 V on an ethidium-bromide-stained formaldehyde gel, denatured at room temperature for 30 minutes in 50 mmol/L NaOH, neutralized in 50 mmol/L Tris (pH 7.0) for 30 minutes, and transferred to a Genescreen Plus nylon membrane (NEN Life Science Products) overnight via capillary action. Messenger RNA was fixed to the membrane by UV crosslinking with a Stratalinker (Stratagene, La Jolla, CA), and prehybridized overnight in 50% deionized formamide, 4 × SSC, 0.02 mol/L Tris, 1 × Denhardt's Reagent (50 × Denhardt's Reagent contains 1% Ficoll, Type 400, 1% polyvinylpyrrolidone, and 1% bovine serum albumin [BSA], Fraction V), 0.5% SDS, and 10% dextran sulfate. 32P-labeled cDNA probe (1 to 2 × 106 cpm/mL), labeled by a Random Primed DNA Labeling Kit (Boehringer Mannheim GmbH, Germany) and purified by ProbeQuant G-50 Micro Columns (Amersham Pharmacia Biotech, Piscataway, NJ), was added to the prehybridization solution along with 10 µg/mL denatured salmon sperm DNA (Gibco BRL Life Technologies). Following overnight hybridization at 42°C, the membrane was washed for 20 minutes at 25°C with low-stringency wash buffer (2 × SSC, 0.1% SDS) and washed for 15 minutes at 25°C with high-stringency wash buffer (0.2 × SSC, 0.1% SDS). Filters were exposed to film for varying lengths of time.

Southern blotting

Genomic DNA (100 to 150 kilobases [kb]) was extracted from approximately 50 × 106 cells with the use of extraction buffer (10 mmol/L Tris-Cl, pH 8.0, 0.1 mol/L EDTA, pH 8.0, 20 µg/mL pancreatic RNAase, and 0.5% SDS) and treated with 100 µg/mL of proteinase K for 3 hours at 50°C. The solution was then extracted 3 times with phenol:chloroform:isoamyl alcohol (25:24:1), and genomic DNA was precipitated with 0.3 mol/L sodium acetate, pH 5.2, and 2 volumes of 100% ethanol. Pure genomic DNA was spooled out and washed twice with 70% ethanol. DNA was finally resuspended in 1 × TE buffer (10 mmol/L Tris-Cl, pH 8.0, 1 mmol/L EDTA, pH 8.0). DNA was digested with EcoRI, HindIII, StuI, and XhoI, and restriction fragments were separated by electrophoresis overnight at 20 V on a 0.8% ethidium bromide-stained agarose gel. Following electrophoresis, DNA was treated for 15 minutes at 25°C with 0.2 N HCl (for partial depurination), 30 minutes at 25°C with 0.4 N NaOH-0.6 mol/L NaCl (for hydrolysis of phosphodiester backbone), and 30 minutes at 25°C with 1.5 mol/L NaCl-0.5 mol/L Tris-Cl, pH 7.4 (for neutralization). Capillary transfer of DNA to a nylon filter, hybridization, and washing steps were carried out as described for Northern blotting.

Probes

Probes used in Northern and Southern analysis were generated by polymerase chain reaction (PCR) amplification of a BCR/ABL cDNA cloned in a pBluescript vector. PCR primers used for amplification of c-Bcr were 5'GGCGGCGCTCAGGTCCAACTTC3' (upper primer) and 5'CCAGCTCCTCATCGGGCACCAG3' (lower primer), which yield a product spanning the coding region of the c-Bcr gene from base pair (bp) 453 to bp 2332. PCR primers used for amplification of c-Abl were 5'TCGGAAGAGGGCAGGGGAGAAC3' (upper primer) and 5'GCCGGACCACTGCCTGCTGACG3' (lower primer), which yield a product spanning the C-terminus of the c-Abl gene coding region from bp 2289 to bp 3305. A human glyceraldehyde phosphodehydrogenase cDNA probe was generated by reverse transcriptase (RT)-PCR, subcloned into a TA vector (Invitrogen, Carlsbad, CA), and gel-purified. Primers used for amplification of a 332-bp portion of the 3' end of the gene were 5'TTCAAGGGGTCTACATGGCAACTG3' (upper primer) and 5'GGG- CATCCTGGGCTACACTG3' (lower primer).

Quantitative PCR for Bcr/Abl

Total RNA was isolated from DMSO-treated and STI571-resistant Ba/F3.p210 cells with the use of Trizol Reagent (Gibco BRL Life Technologies).Reverse transcription of 1 µg of total RNA isolated from DMSO-treated and STI571-resistant Ba/F3.p210 cells (see discussion of Northern blotting under "Results") was achieved by mixing the RNA with 2 µL of 10 × PCR buffer, 0.4 µL of deoxynucleotides (Perkin Elmer, Norwalk, CT), 0.65 µL of Random Hexamers (50 A260 Units) (Pharmacia, Piscataway, NJ), 0.25 µL RNAase Inhibitor (10 U/µL) (Gibco BRL Life Technologies), and 0.5 µL of Superscript II Reverse Transcriptase (200 U/µL) (Gibco BRL Life Technologies) in a 20-µL volume. This was followed by incubation of the mixture at 42°C for 60 minutes, and then for 5 minutes at 95°C.

Two microliters of product from the RT reaction were added to 48 µL of reaction mix (Taqman Core Reagent Kit, Perkin Elmer), consisting of 20.2 µL H2O, 0.3 µL Taq polymerase, 1 µL deoxyadenosine triphosphate, 1 µL deoxycytidine triphosphate, 1 µL deoxyguanosine triphosphate, 1 µL deoxyuridine triphosphate, 12 µL MgCl2, 1 µL B2A2 forward primer, 1 µL B2A2 reverse primer, 1 µL Bcr/Abl probe, 1 µL G3PDH forward primer, 1 µL G3PDH reverse primer, 1 µL G3PDH probe, 5 µL Taqman buffer, and 0.5 µL uracil N-glycosylase, and placed in a 96-well plate. The plate was transferred to an ABI 7700 thermocycler (Perkin Elmer), and samples were passed through denaturation cycles (50°C, 2 minutes; 95°C, 10 minutes). These were followed by 40 amplification cycles (95°C, 15 seconds; 60°C, 1 minute), during which fluorescent signals of Bcr/Abl and G3PDH probes were measured as described previously.21

Serial dilutions 106 to 10-1 of Bcr/Abl plasmid DNA were used as reference standards of fluorescent signals for copy number as described previously.21 Negative controls lacking reverse transcription product were used, as well as reverse-transcribed total RNA extracted from the IL-3-dependent, BCR/ABL-minus, murine hematopoietic cell line Ba/F3. G3PDH primers and probe placed in the same reaction mixture as Bcr/Abl primers and probe were used to assess RNA integrity.

G3PDH primers (forward primer: 5'GAAGGTGAAGGTCGGAGTC3'; reverse primer: 5'GAAGATGGTGATGGGATTC3') and probe (5'CAA- GCTTCCCGTTCTCAGCC3') were provided by the G3PDH Control Reagent Kit (Perkin Elmer). The Taqman G3PDH probe carried a 5' JOE reporter label and a 3' TAMRA quencher group. PCR primers for the amplification of B2A2 cDNA (forward primer: 5'GCATTCCGCTGACCATCAATA3'; reverse primer: 5'GGCTTCACTCAGACCCTGAGG3') and the Bcr/Abl probe (5'AGCGGCCAGTAGCATCTGACTTTGAGC3') were designed with the use of the Primer Express Software Program (Perkin Elmer). The Taqman Bcr/Abl probe, synthesized by PE-Applied Biosystems (Perkin Elmer), carried a 5'FAM reporter label and a 3'TAMRA quencher group.

FACS analysis

Approximately 1 × 105 cells were incubated with Mdr-1 antibody (diluted 1:100) for 1 hour at 4°C. Cell/antibody mixtures were diluted with 1% BSA in 1 × PBS (PBSA) and centrifuged for 10 minutes at 2000 rpm. Cell pellets were then resuspended in fluorescein isothiocyanate (FITC)-conjugated antirabbit immunoglobulin (Ig)-G (H+L) (0.5 µg/mL) (Zymed, San Francisco, CA) and incubated for 45 minutes at 4°C. Samples were diluted with PBSA and centrifuged for 10 minutes at 2000 rpm. Cell pellets were resuspended in 3% formaldehyde in PBSA and analyzed by FACS analysis. As controls, cells were incubated at 4°C in the absence of Mdr-1 and FITC-conjugated antirabbit IgG antibodies, and cells were incubated at 4°C in the presence of only FITC-conjugated antirabbit IgG antibody. FACS analysis was performed as described above using MRP1 antibody (diluted 1:100) and antigoat IgG (whole molecule) FITC conjugate (Sigma, St Louis, MO).


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

STI571 inhibits tyrosine phosphorylation in Ba/F3.p210 and K562 cells

The Abl tyrosine kinase inhibitor STI571 has previously been shown to inhibit the kinase activity of BCR/ABL.11,12 The concentration of STI571 that inhibits tyrosine phosphorylation by at least 50% in the BCR/ABL-transformed hematopoietic cell line, Ba/F3.p210, was determined by measuring tyrosine phosphorylation of cellular substrates of BCR/ABL by immunoblotting. Figure 1A shows that at 2 hours, levels of tyrosine phosphorylation began to decrease at 1 µmol/L STI571 and were barely detectable at 10 µmol/L STI571. Figure 1B shows that after 24 hours, 1 µmol/L STI571 decreased cellular tyrosine phosphorylation by more than 50%, as compared with DMSO-treated and untreated Ba/F3.p210 cells. STI571 did not appear to affect expression levels of BCR/ABL and c-Abl after 2 hours, although treatment for 24 hours with, respectively, 1 and 10 µmol/L STI571 resulted in a small reduction in the level of BCR/ABL. As with Ba/F3.p210 cells, tyrosine phosphorylation in K562 cells was potently inhibited by culturing cells in the presence of STI571 for 2 hours (Figure 1C).




View larger version (616341K):
[in this window]
[in a new window]
 
Fig 1. Inhibition of tyrosine phosphorylation in STI571-treated Ba/F3.p210 cells. (A) Ba/F3.p210 cells were incubated in the presence of increasing concentrations of STI571 (0.01 to 100 µmol/L) for 2 hours. Immunoblotting of the lysates from these cells was performed with anti-pTyr (upper panel), anti-ABL (3F12) (middle panel), and anti-SHP2 as a control for protein loading (lower panel). (B) Ba/F3.p210 cells were incubated in the presence of increasing concentrations of STI571 (0.01 to 10 µmol/L) for 24 hours. Immunoblotting of the lysates from these cells was performed as in (A). (C) K562 cells were incubated in the presence of increasing concentrations of STI571 (0.01 to 10 µmol/L) for 2 hours. Immunoblotting of the lysates from these cells was performed as in (A).

Development of STI571-resistant Ba/F3.p210 cells

Ba/F3.p210 cells were cultured in the presence of gradually increasing concentrations (0.01 µmol/L to 0.2 µmol/L) of STI571 over a period of 56 days. A subpopulation of these cells was placed in the presence of 1 µmol/L STI571, and the concentration of STI571 increased to 2.5 µmol/L in 4 steps over a period of 31 days. Protein, RNA, and DNA analyses were performed on cells resistant to 2 µmol/L STI571. Interestingly, although the cells achieved complete resistance to 2.5 µmol/L STI571, they were rapidly killed by 3 µmol/L STI571, even following several months of culturing in the presence of 2.5 µmol/L STI571 (data not shown). Whereas nonresistant Ba/F3.p210 cells rapidly die within 2 days of culture in the presence of 1 µmol/L STI571, drug-resistant Ba/F3.p210 cells grow well in 1 µmol/L STI571 (Figure 2A).



View larger version (1617K):
[in this window]
[in a new window]
 
Fig 2. Growth of STI571-resistant and nonresistant cells. (A) Growth of STI571-resistant and nonresistant Ba/F3.p210 cells. Diamonds represent nonresistant Ba/F3.p210 cells cultured in the presence of DMSO and harvested and counted by trypan blue exclusion with the use of a hemacytometer at the designated time points. Squares represent STI571-resistant Ba/F3.p210 cells cultured in the presence of 1 µmol/L STI571 and harvested and counted by trypan blue exclusion with the use of a hemacytometer at the designated time points. Triangles represent nonresistant Ba/F3.p210 cells cultured in the presence of 1 µmol/L STI571 and harvested and counted by trypan blue exclusion with the use of a hemacytometer at the designated time points. Cell number was determined by counting viable cells. (B) Growth of STI571-resistant and nonresistant K562 cells. Diamonds represent nonresistant K562 cells cultured in the presence of DMSO and harvested and counted by trypan blue exclusion with the use of a hemacytometer at the designated time points. Squares represent STI571-resistant K562 cells cultured in the presence of 0.5 µmol/L STI571 and harvested and counted by trypan blue exclusion with the use of a hemacytometer at the designated time points. Triangles represent nonresistant K562 cells cultured in the presence of 0.5 µmol/L STI571 and harvested and counted by trypan blue exclusion with the use of a hemacytometer at the designated time points. Cell number was determined by counting viable cells.

BCR/ABL protein expression and cellular tyrosine phosphorylation in STI571-resistant Ba/F3.p210 cells

Protein lysates were prepared from STI571-resistant cells with the use of lysis buffer with a standard cocktail of protease inhibitors, including aprotinin, phenyl methyl sulfonyl fluoride, and leupeptin. BCR/ABL was then detected by immunoblotting with a monoclonal antibody directed against the SH2 domain of c-Abl (3F12). There was an increase in BCR/ABL protein in STI571-resistant Ba/F3.p210 cells, but multiple proteolytic cleavage products were observed (data not shown). STI571-resistant cells were then treated with a variety of proteasome and protease inhibitors while being continuously cultured in the presence of STI571. MG-132 (20 µmol/L, 4 hours), a reversible proteasome inhibitor that diminishes 26S complex-mediated degradation of ubiquitin-conjugated proteins, and the 20S proteasome inhibitors, Proteasome Inhibitor I (30 µmol/L to 100 µmol/L, 4 hours) and clasto-Lactacystin beta -lactone (30 µmol/L, 4 hours) did not reduce proteolytic cleavage. Calpain Inhibitor I, an inhibitor of calpain I, calpain II, cathepsin B, cathepsin L, and neutral cysteine proteases (20 µmol/L and 50 µmol/L, 6 hours) had a modest effect. However, AEBSF, a specific, cell-permeable, irreversible inhibitor of serine proteases, such as trypsin, chymotrypsin, plasmin, thrombin, and kallikrein, used at a concentration of 1 mmol/L for 20 minutes effectively reduced accumulation of truncated BCR/ABL-related products and led to the reappearance of apparently full-length p210 BCR/ABL. Therefore, all subsequent experiments included AEBSF as indicated to reduce proteolytic cleavage of the amplified BCR/ABL proteins occurring primarily during cell lysis.

Figure 3 shows BCR/ABL protein expression in nonresistant and STI571-resistant Ba/F3.p210 cells. An anti-Abl antibody and an anti-Bcr antibody were used individually to detect the BCR/ABL protein in these cells. Compared with nonresistant cells, BCR/ABL is significantly overexpressed in STI571-resistant cells. Pretreatment of nonresistant Ba/F3.p210 cells with 1 mmol/L AEBSF did not significantly affect BCR/ABL protein expression in these cells. Removal of STI571 from STI571-resistant Ba/F3.p210 cells for 24 or 48 hours substantially reduced levels of BCR/ABL protein in the drug-resistant cells, although BCR/ABL protein levels were still elevated as compared with nonresistant cells. This suggests that the continuous presence of the kinase inhibitor may be required to maintain BCR/ABL overexpression. No significant changes in expression levels of SHP2 were seen for all samples, suggesting that differences observed in BCR/ABL protein expression are not due to differences in protein loading. Elevated BCR/ABL protein levels in STI571-resistant Ba/F3.p210 cells were not associated with an increase in BCLXL protein expression (data not shown).


View larger version (41K):
[in this window]
[in a new window]
 
Fig 3. BCR/ABL protein expression in STI571-resistant Ba/F3.p210 cells. Nonresistant Ba/F3.p210 cells cultured in the presence of DMSO were treated for 20 minutes with 1 mmol/L AEBSF or water, as vehicle. STI571-resistant Ba/F3.p210 cells were cultured in the continuous presence of 1 µmol/L STI571 and then treated with 1 mmol/L AEBSF for 20 minutes. STI571-resistant Ba/F3.p210 cells were deprived of STI571 for 24 and 48 hours, respectively, and then treated with 1 mmol/L AEBSF for 20 minutes. Immunoblotting of the lysates from these cells was performed with anti-ABL (upper left-hand panel), anti-BCR (middle left-hand panel), and anti-SHP2 as a control for loading (lower left-hand panel), and anti-pTyr (upper right-hand panel).

In contrast to drug-sensitive cells, STI571-resistant Ba/F3.p210 cells cultured in the continuous presence (media changed every 2 to 3 days) of STI571 maintained high levels of cellular protein tyrosine phosphorylation (Figure 3). Interestingly, when fresh drug was added to these cells, tyrosine phosphorylation of cellular proteins declined rapidly (Figure 4), but transiently, returning to steady state levels in less than 24 hours, and in the absence of cell death (Figure 5). These results were obtained whether the media containing STI571 were removed and cells underwent short-term (2-hour) drug deprivation before undergoing culturing in fresh STI571, or whether cells were removed from "spent" media (normally changed every 2 to 3 days) and placed immediately in fresh media containing fresh STI571 (Figure 5). Also of interest is that significant changes were observed in the level of BCR/ABL protein that depended on the presence of drug. Removal of STI571 resulted in lower levels of BCR/ABL while addition of STI571 increased BCR/ABL protein levels (Figure 5). These results suggest that BCR/ABL protein levels in drug-resistant cells may be in some way modulated directly by the concentration of drug in the medium and that the BCR/ABL kinase activity remains highly sensitive to the addition of fresh drug to the cells. However, in contrast to nonresistant cells, STI571 treatment of drug-resistant cells fails to cause apoptosis, and the inhibition of tyrosine phosphorylation is quite transient.


View larger version (40K):
[in this window]
[in a new window]
 
Fig 4. Inhibition of cellular tyrosine phosphorylation in nonresistant Ba/F3.p210 cells and STI571-resistant Ba/F3.p210 cells by STI571. Nonresistant Ba/F3.p210 cells were treated for 2 hours with DMSO, 1 µmol/L STI571, or 10 µmol/L STI571. STI571-resistant Ba/F3.p210 cells were treated for 2 hours with DMSO, 1 µmol/L STI571, or 10 µmol/L STI571, following a 2-hour STI571 deprivation. Immunoblotting of the lysates from these cells was performed with anti-pTyr (left-hand panel), anti-ABL (upper right-hand panel), and anti-SHP2 as a control for loading (lower right-hand panel).



View larger version (52K):
[in this window]
[in a new window]
 
Fig 5. Transient inhibition of cellular tyrosine phosphorylation by STI571 in STI571-resistant Ba/F3.p210 cells. (A) STI571-resistant Ba/F3.p210 cells treated with 1 µmol/L STI571 for 2 to 48 hours, following a 2-hour STI571 deprivation. Immunoblotting of the lysates from these cells was performed with anti-pTyr (upper left-hand panel), anti-ABL (middle left-hand panel), and anti-SHP2 as a control for loading (lower left-hand panel). (B) STI571-resistant Ba/F3.p210 cells treated with 1 µmol/L STI571 for 2 to 48 hours, with no STI571 deprivation prior to treatments. Immunoblotting of the lysates from these cells was performed as in (A).

Expression of BCR/ABL RNA in STI571-resistant and nonresistant Ba/F3.p210 cells

To determine if drug resistance was associated with alteration of Bcr/Abl RNA expression, Northern analysis was performed on RNA extracted from DMSO-treated nonresistant and STI571-resistant Ba/F3.p210 cells, with the use of cDNA probes corresponding to c-Bcr and the C-terminus of c-Abl, respectively. A higher level of Bcr/Abl mRNA in resistant cells was observed to hybridize to both c-Bcr and c-Abl probes, as compared with nonresistant cells (Figure 6A, 6B). Re-probing the blots with a G3PDH cDNA probe confirmed equal loading of mRNA in all lanes. Northern results shown here are representative of 2 independent experiments.


View larger version (25K):
[in this window]
[in a new window]
 
Fig 6. Bcr/Abl RNA expression in STI571-resistant Ba/F3.p210 cells. Northern blotting was performed on mRNA extracted from nonresistant and STI571-resistant Ba/F3.p210 cells. (A) Northern blot using a cDNA probe from the C-terminus of c-Abl. (B) Northern blot using a cDNA probe from c-Bcr. See "Materials and methods" for details of each probe. Each Northern filter was stripped and re-probed with human G3PDH, as a control for loading.

A quantitative PCR assay was used to estimate the increase in Bcr/Abl RNA present in the resistant cell lines. Quantitative PCR was performed on total RNA extracted from STI571-resistant and DMSO-treated nonresistant Ba/F3.p210 cells. The number of Bcr/Abl mRNA copies/G3PDH mRNA copies in STI571-resistant Ba/F3.p210 cells was determined to be 2.35 × 106/4.45 × 106 (or 0.528). The number of Bcr/Abl mRNA copies/G3PDH mRNA copies in nonresistant Ba/F3.p210 cells was determined to be 2.5 × 105/9.55 × 106 (or 0.026). There is thus an approximately 20-fold increase in Bcr/Abl mRNA copy number in resistant versus nonresistant cells. Quantitative PCR results are representative of 2 independent experiments.

Analysis of BCR/ABL gene in STI571-resistant and nonresistant Ba/F3.p210 cells

To determine if the increased Bcr/Abl RNA observed in STI571-resistant cells was associated with alterations in the Bcr/Abl transgene, Southern analysis was performed on digested genomic DNA isolated from DMSO-treated Ba/F3.p210 cells and STI571-resistant cells with the use of a cDNA probe corresponding to the C-terminus of c-Abl. HindIII cleaves the 6935-bp Bcr/Abl transgene at bp 2729 and yields a single (8- to 10-kb) molecular weight DNA band that hybridized to the c-Abl probe and was amplified in STI571-resistant Ba/F3.p210 as compared with nonresistant Ba/F3.p210 (Figure 7A). Similar results were obtained with genomic DNA isolated from nonresistant and resistant Ba/F3.p210 cells that was digested with Xho I, which cleaves BCR/ABL at bp 779, and EcoRI and StuI, which cleave the transgene at or near the beginning and end of the Bcr/Abl coding region, respectively (Figure 7A). A human G3PDH probe was used to demonstrate equal loading of DNA in all lanes (Figure 7B). Southern results shown here are representative of 2 independent experiments. Stripping and re-probing of Southern filters with a c-Bcr cDNA probe also resulted in hybridization of the probe to an amplified level of genomic DNA in resistant versus nonresistant cells (data not shown).


View larger version (44K):
[in this window]
[in a new window]
 
Fig 7. Bcr/Abl gene expression in STI571-resistant Ba/F3.p210 cells. Southern blotting was performed on EcoRI-, HindIII-, StuI-, and XhoI-digested genomic DNA prepared from nonresistant and STI571-resistant Ba/F3.p210 cells. (A) Southern blot using a cDNA probe from the C-terminus of c-Abl. (B) Southern blot shown in (A) after stripping and re-probing with human G3PDH, a control for loading.

Development of STI571-resistant K562 cells

Since Ba/F3.p210 cells express BCR/ABL from a transgene introduced by transfection, we also generated STI571 resistance in the human Ph-chromosome-positive cell line K562. K562 cells were cultured in the presence of 0.2 µmol/L STI571 for a total of 4 months, and the drug concentration was gradually increased to 0.5 µmol/L STI571 over a period of 1 and a half months. Whereas nonresistant K562 cells die at 0.5 µmol/L STI571, STI571-resistant K562 cells proliferate well in the presence of 0.5 µmol/L STI571 (Figure 2B).

BCR/ABL protein expression and cellular tyrosine phosphorylation in STI571-resistant K562 cells

Immunoblotting studies performed with an anti-c-ABL antibody reproducibly demonstrated an increase in levels of BCR/ABL protein in STI571-resistant cells, as compared with nonresistant K562 cells (Figure 8). Results shown here are representative of 7 independent experiments. Cellular protein tyrosine phoshorylation is elevated, consistent with increased BCR/ABL protein expression. Addition of fresh STI571 again transiently decreased cellular protein phosphorylation, as was the case with drug-resistant Ba/F3.p210 cells, but to a lesser extent.


View larger version (69K):
[in this window]
[in a new window]
 
Fig 8. Inhibition of cellular tyrosine phosphorylation by STI571 in nonresistant and STI571-resistant K562 cells. Nonresistant K562 cells were treated for 2 hours with DMSO, 1 µmol/L STI571, and 10 µmol/L STI571 (lanes 1-3). STI571-resistant K562 cells were treated with DMSO, 1 µmol/L, and 10 µmol/L STI571 following continuous culturing in the presence of 0.5 µmol/L STI571 prior to treatments (lanes 4-6), and following STI571 deprivation for 2 hours prior to treatments (lanes 7-9). Immunoblotting of the lysates from these cells was performed with anti-pTyr (upper panel), anti-ABL (middle panel), and anti-SHP2 as a loading control for protein (bottom panel).

Expression of BCR/ABL RNA in STI571-resistant and nonresistant K562 cells

To determine if drug resistance in K562 cells was associated with changes in BCR/ABL RNA expression, Northern analysis was performed on mRNA extracted from DMSO-treated nonresistant and STI571-resistant K562 cells, with the use of a cDNA probe corresponding to the C-terminus of c-Abl. No detectable difference in BCR/ABL mRNA could be seen between resistant cells and nonresistant cells (data not shown). Quantitative PCR performed with the use of total RNA extracted from nonresistant and STI571-resistant K562 cells confirmed Northern results (data not shown).

Analysis of BCR/ABL gene in STI571-resistant and nonresistant K562 cells

The BCR/ABL gene was investigated for amplification/alteration in STI571-resistant K562 cells. Southern analysis was performed on HindIII- and EcoRI-digested genomic DNA isolated from DMSO-treated nonresistant K562 cells and STI571-resistant K562 cells as described above. No differences were observed between nonresistant and STI571-resistant K562 cells in either DNA-banding pattern or signal intensity (data not shown).

Mdr-1 and MRP1 protein expression in STI571-resistant K562 cells

Flow cytometry was performed to determine if drug-resistant K562 cells had altered p-glycoprotein (Pgp) expression, as compared with nonresistant cells. No significant difference in levels of Mdr-1 or MRP1 was observed between the 2 cell populations (data not shown).


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

STI571 inhibits c-Abl tyrosine kinase activity by acting as a competitor for ATP.11 As a result of this inhibition, the proliferation of cells transformed by v-Abl, p190Bcr/Abl, p210Bcr/Abl, and TEL-ABL is suppressed.11-13,17 STI571 also inhibits colony formation and tumorigenicity of BCR/ABL- and Ph+ cells.11-13 STI571 induces apoptosis in BCR/ABL-positive cells14-16 without causing cell differentiation14; STI571-induced programmed cell death is accompanied by caspase activation.15

Here we report the generation of 2 BCR/ABL-positive cell lines that have developed partial resistance to STI571. BCR/ABL-transformed Ba/F3 hematopoietic cells were made resistant to apoptotic death in the presence of up to 2.5 µmol/L STI571. Resistant cells were found to have an increase in Bcr/Abl mRNA, amplification of the Bcr/Abl transgene by over 5-fold, and increased levels of Bcr/Abl protein. The Southern blots using either Abl or Bcr-derived probes did not show any major rearrangements of the transgene in STI571-resistant Ba/F3 cells. Similarly, the existence of 1 major mRNA transcript of the same size in resistant and nonresistant cells, as observed in Northern blotting experiments, also suggests that the entire transgene was amplified without major rearrangements. In addition, a region of C-ABL spanning the ATP-binding site (amino acid sequence LGGGQYGEVYE) was amplified from nonresistant and ST1571-resistant Ba/F3.p210 and K562 cells by RT-PCR. No difference in sequence was observed between resistant and nonresistant cells (data not shown).

In contrast to Ba/F3.p210 cells, drug-resistant K562 cells did not undergo detectable amplification of the BCR/ABL gene, despite the fact they displayed a several-fold increase in p210BCR/ABL protein. However, although both cell lines displayed increased levels of BCR/ABL protein and kinase activity, we hypothesize that the mechanism of resistance in both cell lines is likely to involve additional mechanisms. The addition of fresh drug to cultures still resulted in rapid, but transient, inhibition of protein tyrosine phosphorylation, but with preservation of cell viability. Several mechanisms could explain these results. First, the cell lines may have developed methods to increase degradation or metabolism of the drug, which cannot currently be assayed. Second, increased drug efflux may be present, and further studies are ongoing in our laboratory to identify such mechanisms. We did not detect an increase in Mdr-1 or MRP1 protein expression by flow cytometry. Finally, the cells may have accumulated compensating mutations in other genes, such as loss of tyrosine phosphatase activity, loss of apoptosis genes, or gain-of-function mutations in viability genes. One prominent BCR/ABL-associated viability gene, Bcl-X, was studied here, and no changes were seen. Overall, our results suggest that the mechanism of resistance in these lines may be multifactorial and interesting from a biochemical standpoint, with the common end result of an increase in the expression of the target protein and a reduction in the apoptosis effects of the drug.

Gene amplification as a mechanism of drug resistance is also commonly observed where the drug inhibits an enzyme within a critical biosynthetic pathway. For example, methotrexate resistance is associated with amplification of the dihydrofolate reductase (DHFR) gene22; thymidylate synthase (TS) can be amplified in response to a variety of TS inhibitors23; resistance to hydroxyurea is associated with amplification of the M2 subunit of dihydrofolate reductase24; and PALA (N-phosphonoacetyl-L-aspartate) resistance is correlated with amplification of the carbamyl phosphate synthetase-aspartate transcarbamylase-dihydroorotase gene.25 Thus, amplification of genes encoding drug targets or enzymes that can bypass a drug effect is a frequent mechanism of drug resistance. However, amplification of a tyrosine kinase in response to a tyrosine kinase inhibitor has not previously been reported.

The mechanisms of gene amplification are not well understood. Genes may be amplified in situ at intrachromosomal locations through a mechanism that may involve repeated cycles of breakage-fusion-bridge cycles where chromosome breakage is initiated at fragile sites.26,27 Amplification of the DHFR gene has also been reported to occur owing to unequal sister chromatid exchange.28 Intrachromosomal gene amplification is typically associated with "homogeneously staining regions" (HSR) in specific chromosomes, and HSR has been used to localize genes involved in drug resistance.28-30 In other situations, gene amplification may be associated with extrachromosomal accumulation of genetic material in the form of double minute (DM) chromosomes.31 DMs are acentric and atelomeric chromatin composed of circular DNA and are seen in a substantial proportion of human cancers. In most cases, however, the genes being amplified by the accumulation of DM are still unknown. Spontaneous amplification of Bcr/Abl has been described during the transition from chronic phase to blast phase, either in the form of duplication of the Ph chromosome or as isolated gene amplification.32,33 Similarly, Ph+ cell lines have been reported to show amplification of the Bcr/Abl gene during tissue culture.34

Although we observed increased expression of Bcr/Abl in both resistant Ba/F3.p210 and K562 cells, overall our results do not suggest that the increase in the level of target protein, by itself, is sufficient to account for the high level of drug resistance we observed. Altered drug metabolism or efflux deserves further study and could account for some of the resistance seen in this report. Although we did not observe overexpression of Mdr-1 in the resistant K562 cells studied here, overexpression of Mdr-1 or other "drug pumps" is commonly thought to occur in drug-resistant cells.35,36 Other genes conferring multidrug resistance, such as MRP and LRP, have also been shown to be amplified in cell lines and patient specimens.29

In the case of both K562 and Ba/F3.p210 cell lines, we were unable to derive lines that were resistant to drug levels of more than 0.5 µmol/L and more than 2.5 µmol/L STI571, respectively, despite several attempts and many months of drug exposure. Overall, the results suggest that resistance to STI571 may be relative, and it may be worthwhile to treat patients who become resistant to standard doses of STI571 with increased doses of the drug.


    Acknowledgments

We are grateful to Dr Jerry Ritz and Antoinette Chillemi from the Dana Farber Cancer Institute for technical assistance with quantitative PCR.


    Footnotes

Submitted August 5, 1999; accepted January 18, 2000.

Reprints: James D. Griffin, Dana Farber Cancer Institute, Department of Adult Oncology, 44 Binney St, Boston, MA 02115; e-mail: james_griffin{at}dfci.harvard.edu.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Shtivelman E, Lifshitz B, Gale RP, Canaani E. Fused transcript of abl and bcr genes in chronic myelogenous leukaemia. Nature. 1985;315:550[Medline] [Order article via Infotrieve].

2. Heisterkamp N, Stam K, Groffen J, de Klein A, Grosveld G. Structural organization of the bcr gene and its role in the Ph' translocation. Nature. 1985;315:758[Medline] [Order article via Infotrieve].

3. Ben-Neriah Y, Daley GQ, Mes-Masson AM, Witte ON, Baltimore D. The chronic myelogenous leukemia-specific P210 protein is the product of the Bcr/Abl hybrid gene. Science. 1986;233:212[Abstract/Free Full Text].

4. Daley GQ, McLaughlin J, Witte ON, Baltimore D. The CML-specific P210 Bcr/Abl protein, unlike v-abl, does not transform NIH/3T3 fibroblasts. Science. 1987;237:532[Abstract/Free Full Text].

5. Daley GQ, Baltimore D. Transformation of an interleukin 3-dependent hematopoietic cell line by the chronic myelogenous leukemia-specific P210Bcr/Abl protein. Proc Natl Acad Sci U S A. 1988;85:9312[Abstract/Free Full Text].

6. Lugo TG, Pendergast AM, Muller AJ, Witte ON. Tyrosine kinase activity and transformation potency of bcr-abl oncogene products. Science. 1990;247:1079[Abstract/Free Full Text].

7. McWhirter JR, Galasso DL, Wang JY. A coiled-coil oligomerization domain of Bcr is essential for the transforming function of Bcr-Abl oncoproteins. Mol Cell Biol. 1993;13:7587[Abstract/Free Full Text].

8. Yaish P, Gazit A, Gilon C, Levitzki A. Blocking of EGF-dependent cell proliferation by EGF receptor kinase inhibitors. Science. 1988;242:933[Abstract/Free Full Text].

9. Anafi M, Gazit A, Zehavi A, Ben-Neriah Y, Levitzki A. Tyrphostin-induced inhibition of p210bcr-abl tyrosine kinase activity induces K562 to differentiate. Blood. 1993;82:3524[Abstract/Free Full Text].

10. Kaur G, Gazit A, Levitzki A, Stowe E, Cooney DA, Sausville EA. Tyrphostin induced growth inhibition: correlation with effect on p210bcr-abl autokinase activity in K562 chronic myelogenous leukemia. Anticancer Drugs. 1994;5:213[Medline] [Order article via Infotrieve].

11. Buchdunger E, Zimmermann J, Mett H, et al. Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative. Cancer Res. 1996;56:100[Abstract/Free Full Text].

12. Druker BJ, Tamura S, Buchdunger E, et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med. 1996;2:561[Medline] [Order article via Infotrieve].

13. Deininger MW, Goldman JM, Lydon N, Melo JV. The tyrosine kinase inhibitor CGP57148B selectively inhibits the growth of BCR-ABL-positive cells. Blood. 1997;90:3691[Abstract/Free Full Text].

14. Gambacorti-Passerini C, le Coutre P, Mologni L, et al. Inhibition of the ABL kinase activity blocks the proliferation of BCR/ABL+ leukemic cells and induces apoptosis. Blood Cells Mol Dis. 1997;23:380[Medline] [Order article via Infotrieve].

15. Dan S, Naito M, Tsuruo T. Selective induction of apoptosis in Philadelphia chromosome-positive chronic myelogenous leukemia cells by an inhibitor of BCR-ABL tyrosine kinase, CGP 57148. Cell Death Differ. 1998;5:710[Medline] [Order article via Infotrieve].

16. Beran M, Cao X, Estrov Z, et al. Selective inhibition of cell proliferation and BCR-ABL phosphorylation in acute lymphoblastic leukemia cells expressing Mr 190,000 BCR-ABL protein by a tyrosine kinase inhibitor (CGP-57148). Clin Cancer Res. 1998;4:1661[Abstract].

17. Carroll M, Ohno-Jones S, Tamura S, et al. CGP57148, a tyrosine kinase inhibitor, inhibits the growth of cells expressing BCR-ABL, TEL-ABL, and TEL-PDGFR fusion proteins. Blood. 1997;90:4947[Abstract/Free Full Text].

18. Druker BJ, Talpaz M, Resta D, et al. Clinical efficacy and safety of an ABL specific tyrosine kinase inhibitor as targeted therapy for chronic myelogenous leukemia [abstract]. Blood. 1999;99(suppl 1):368a.

19. le Coutre P, Mologni L, Cleris L, et al. In vivo eradication of human BCR/ABL-positive leukemia cells with an ABL kinase inhibitor. J Natl Cancer Inst. 1999;91:163[Abstract/Free Full Text].

20. Sattler M, Salgia R, Okuda K, et al. The proto-oncogene product p120CBL and the adaptor proteins CRKL and c-CRK link c-Abl, p190BCR/ABL, and p210BCR/ABL to the phosphatidylinositol-3' kinase pathway. Oncogene. 1996;12:839[Medline] [Order article via Infotrieve].

21. Mensink E, van de Locht A, Schattenberg A, et al. Quantitation of minimal residual disease in Philadelphia chromosome positive chronic myeloid leukaemia patients using real-time quantitative RT-PCR. Br J Haematol. 1998;102:768[Medline] [Order article via Infotrieve].

22. Kuo MT, Sen S, Hittelman WN, Hsu TC. Chromosomal fragile sites and DNA amplification in drug-resistant cells. Biochem Pharmacol. 1998;56:7[Medline] [Order article via Infotrieve].

23. Tong Y, Liu-Chen X, Ercikan-Abali EA, et al. Isolation and characterization of thymitaq (AG337) and 5-fluoro-2-deoxyuridylate-resistant mutants of human thymidylate synthase from ethyl methanesulfonate-exposed human sarcoma HT1080 cells. J Biol Chem. 1998;273:11,611[Abstract/Free Full Text].

24. Lewis WH, Srinivasan PR. Chromosome-mediated gene transfer of hydroxurea resistance and amplification of ribonucleotide activity. Mol Cell Biol. 1983;3:1053[Abstract/Free Full Text].

25. Schaefer DI, Livanos EM, White AE, Tlsty TD. Multiple mechanisms of N-(phosphonoacetyl)-L-aspartate drug resistance in SV40-infected precrisis human fibroblasts. Cancer Res. 1993;53:4946[Abstract/Free Full Text].

26. Kuo MT, Vyas RC, Jiang LX, Hittelman WN. Chromosome breakage at a major fragile site associated with P-glycoprotein gene amplification in multidrug-resistant CHO cells. Mol Cell Biol. 1994;14:5202[Abstract/Free Full Text].

27. Coquelle A, Pipiras E, Toledo F, Buttin G, Debatisse M. Expression of fragile sites triggers intrachromosomal mammalian gene amplification and sets boundaries to early amplicons. Cell. 1997;89:215[Medline] [Order article via Infotrieve].

28. Bostock CJ, Clark EM. Satellite DNA in large marker chromosomes of methotrexate-resistant mouse cells. Cell. 1980;19:709[Medline] [Order article via Infotrieve].

29. Slovak ML, Ho JP, Cole SP, et al. The LRP gene encoding a major vault protein associated with drug resistance maps proximal to MRP on chromosome 16: evidence that chromosome breakage plays a key role in MRP or LRP gene amplification. Cancer Res. 1995;55:4214[Abstract/Free Full Text].

30. Eijdems EW, De Haas M, Coco-Martin JM, et al. Mechanisms of MRP over-expression in four human lung-cancer cell lines and analysis of the MRP amplicon. Int J Cancer. 1995;60:676[Medline] [Order article via Infotrieve].

31. Coquelle A, Toledo F, Stern S, Bieth A, Debatisse M. A new role for hypoxia in tumor progression: induction of fragile site triggering genomic rearrangements and formation of complex DMs ad HSRs. Mol Cell. 1998;2:259[Medline] [Order article via Infotrieve].

32. Collins SJ. Breakpoints on chromosomes 9 and 22 in Philadelphia chromosome-positive chronic myelogenous leukemia (CML): amplification of rearranged c-Abl oncogenes in CML blast crisis. J Clin Invest. 1986;78:1392.

33. Collins SJ, Groudine MT. Chronic myelogenous leukemia: amplification of a rearranged c-Abl oncogene in both chronic phase and blast crisis. Blood. 1987;69:893[Abstract/Free Full Text].

34. Wu SQ, Voelkerding KV, Sabatini L, Chen XR, Huang J, Meisner LF. Extensive amplification of Bcr/Abl fusion genes clustered on three marker chromosomes in human leukemic cell line K-562. Leukemia. 1995;9:858[Medline] [Order article via Infotrieve].

35. Mechetner EB, Roninson IB. Efficient inhibition of p-glycoprotein-mediated multidrug resistance with a monoclonal antibody. Proc Natl Acad Sci U S A. 1992;89:5824[Abstract/Free Full Text].

36. Serra M, Scotlandi K, Manara MC, et al. Establishment and characterization of multidrug-resistant human osteosarcoma cell lines. Anticancer Res. 1993;13:323[Medline] [Order article via Infotrieve].


© 2000 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Letter in Blood Online:

Another possible mechanism of resistance to STI571
Zachary A. Knight;, Carlo Gambacorti-Passerini, Philipp le Coutre, Elena Tassi, and Holger Ruchatz
Blood 2000 96: 4003-4005. [Full Text] [PDF]



This article has been cited by other articles:


Home page
BloodHome page
E. Jabbour, H. M. Kantarjian, D. Jones, J. Shan, S. O'Brien, N. Reddy, W. G. Wierda, S. Faderl, G. Garcia-Manero, S. Verstovsek, et al.
Imatinib mesylate dose escalation is associated with durable responses in patients with chronic myeloid leukemia after cytogenetic failure on standard-dose imatinib therapy
Blood, March 5, 2009; 113(10): 2154 - 2160.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. Michor
Mathematical Models of Cancer Stem Cells
J. Clin. Oncol., June 10, 2008; 26(17): 2854 - 2861.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Mayerhofer, K. V. Gleixner, J. Mayerhofer, G. Hoermann, E. Jaeger, K. J. Aichberger, R. G. Ott, K. Greish, H. Nakamura, S. Derdak, et al.
Targeting of heat shock protein 32 (Hsp32)/heme oxygenase-1 (HO-1) in leukemic cells in chronic myeloid leukemia: a novel approach to overcome resistance against imatinib
Blood, February 15, 2008; 111(4): 2200 - 2210.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. V. Boddy, J. Sludden, M. J. Griffin, C. Garner, J. Kendrick, P. Mistry, C. Dutreix, D. R. Newell, and S. G. O'Brien
Pharmacokinetic Investigation of Imatinib Using Accelerator Mass Spectrometry in Patients with Chronic Myeloid Leukemia
Clin. Cancer Res., July 15, 2007; 13(14): 4164 - 4169.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Peng, J. Brain, Y. Hu, A. Goodrich, L. Kong, D. Grayzel, R. Pak, M. Read, and S. Li
Inhibition of heat shock protein 90 prolongs survival of mice with BCR-ABL-T315I-induced leukemia and suppresses leukemic stem cells
Blood, July 15, 2007; 110(2): 678 - 685.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Ray, S. W. Cowan-Jacob, P. W. Manley, J. Mestan, and J. D. Griffin
Identification of BCR-ABL point mutations conferring resistance to the Abl kinase inhibitor AMN107 (nilotinib) by a random mutagenesis study
Blood, June 1, 2007; 109(11): 5011 - 5015.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
F. Michor
Chronic Myeloid Leukemia Blast Crisis Arises from Progenitors
Stem Cells, May 1, 2007; 25(5): 1114 - 1118.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Baran, A. Salas, C. E. Senkal, U. Gunduz, J. Bielawski, L. M. Obeid, and B. Ogretmen
Alterations of Ceramide/Sphingosine 1-Phosphate Rheostat Involved in the Regulation of Resistance to Imatinib-induced Apoptosis in K562 Human Chronic Myeloid Leukemia Cells
J. Biol. Chem., April 13, 2007; 282(15): 10922 - 10934.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Weisberg, L. Catley, R. D. Wright, D. Moreno, L. Banerji, A. Ray, P. W. Manley, J. Mestan, D. Fabbro, J. Jiang, et al.
Beneficial effects of combining nilotinib and imatinib in preclinical models of BCR-ABL+ leukemias
Blood, March 1, 2007; 109(5): 2112 - 2120.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Baccarani, G. Saglio, J. Goldman, A. Hochhaus, B. Simonsson, F. Appelbaum, J. Apperley, F. Cervantes, J. Cortes, M. Deininger, et al.
Evolving concepts in the management of chronic myeloid leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet
Blood, September 15, 2006; 108(6): 1809 - 1820.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Copland, A. Hamilton, L. J. Elrick, J. W. Baird, E. K. Allan, N. Jordanides, M. Barow, J. C. Mountford, and T. L. Holyoake
Dasatinib (BMS-354825) targets an earlier progenitor population than imatinib in primary CML but does not eliminate the quiescent fraction
Blood, June 1, 2006; 107(11): 4532 - 4539.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Piwocka, S. Vejda, T. G. Cotter, G. C. O'Sullivan, and S. L. McKenna
Bcr-Abl reduces endoplasmic reticulum releasable calcium levels by a Bcl-2-independent mechanism and inhibits calcium-dependent apoptotic signaling
Blood, May 15, 2006; 107(10): 4003 - 4010.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. Koyama, S. Koschmieder, S. Tyagi, I. Portero-Robles, J. Chromic, S. Myloch, H. Nurnberger, T. Rossmanith, W.-K. Hofmann, D. Hoelzer, et al.
Inhibition of phosphotyrosine phosphatase 1B causes resistance in BCR-ABL-positive leukemia cells to the ABL kinase inhibitor STI571.
Clin. Cancer Res., April 1, 2006; 12(7 Pt 1): 2025 - 2031.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Chandra, J. Tracy, D. Loegering, K. Flatten, S. Verstovsek, M. Beran, M. Gorre, Z. Estrov, N. Donato, M. Talpaz, et al.
Adaphostin-induced oxidative stress overcomes BCR/ABL mutation-dependent and -independent imatinib resistance
Blood, March 15, 2006; 107(6): 2501 - 2506.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M. Caraglia, D. Santini, M. Marra, B. Vincenzi, G. Tonini, and A. Budillon
Emerging anti-cancer molecular mechanisms of aminobisphosphonates.
Endocr. Relat. Cancer, March 1, 2006; 13(1): 7 - 26.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. P. Radich, H. Dai, M. Mao, V. Oehler, J. Schelter, B. Druker, C. Sawyers, N. Shah, W. Stock, C. L. Willman, et al.
Gene expression changes associated with progression and response in chronic myeloid leukemia
PNAS, February 21, 2006; 103(8): 2794 - 2799.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Z. Carter, D. H. Mak, W. D. Schober, M. Cabreira-Hansen, M. Beran, T. McQueen, W. Chen, and M. Andreeff
Regulation of survivin expression through Bcr-Abl/MAPK cascade: targeting survivin overcomes imatinib resistance and increases imatinib sensitivity in imatinib-responsive CML cells
Blood, February 15, 2006; 107(4): 1555 - 1563.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. Pricl, M. Fermeglia, M. Ferrone, and E. Tamborini
T315I-mutated Bcr-Abl in chronic myeloid leukemia and imatinib: insights from a computational study
Mol. Cancer Ther., August 1, 2005; 4(8): 1167 - 1174.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Golemovic, S. Verstovsek, F. Giles, J. Cortes, T. Manshouri, P. W. Manley, J. Mestan, M. Dugan, L. Alland, J. D. Griffin, et al.
AMN107, a Novel Aminopyrimidine Inhibitor of Bcr-Abl, Has In vitro Activity against Imatinib-Resistant Chronic Myeloid Leukemia
Clin. Cancer Res., July 1, 2005; 11(13): 4941 - 4947.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Lee, Y.-J. Kim, C.-K. Min, H.-J. Kim, K.-S. Eom, D.-W. Kim, J.-W. Lee, W.-S. Min, and C.-C. Kim
The effect of first-line imatinib interim therapy on the outcome of allogeneic stem cell transplantation in adults with newly diagnosed Philadelphia chromosome-positive acute lymphoblastic leukemia
Blood, May 1, 2005; 105(9): 3449 - 3457.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. J. Aichberger, M. Mayerhofer, M.-T. Krauth, H. Skvara, S. Florian, K. Sonneck, C. Akgul, S. Derdak, W. F. Pickl, V. Wacheck, et al.
Identification of mcl-1 as a BCR/ABL-dependent target in chronic myeloid leukemia (CML): evidence for cooperative antileukemic effects of imatinib and mcl-1 antisense oligonucleotides
Blood, April 15, 2005; 105(8): 3303 - 3311.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
H. Volk, H. Potschka, and W. Loscher
Immunohistochemical Localization of P-glycoprotein in Rat Brain and Detection of Its Increased Expression by Seizures Are Sensitive to Fixation and Staining Variables
J. Histochem. Cytochem., April 1, 2005; 53(4): 517 - 531.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Deininger, E. Buchdunger, and B. J. Druker
The development of imatinib as a therapeutic agent for chronic myeloid leukemia
Blood, April 1, 2005; 105(7): 2640 - 2653.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. von Bubnoff, D. R. Veach, H. van der Kuip, W. E. Aulitzky, J. Sanger, P. Seipel, W. G. Bornmann, C. Peschel, B. Clarkson, and J. Duyster
A cell-based screen for resistance of Bcr-Abl-positive leukemia identifies the mutation pattern for PD166326, an alternative Abl kinase inhibitor
Blood, February 15, 2005; 105(4): 1652 - 1659.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Gumireddy, S. J. Baker, S. C. Cosenza, P. John, A. D. Kang, K. A. Robell, M. V. R. Reddy, and E. P. Reddy
A non-ATP-competitive inhibitor of BCR-ABL overrides imatinib resistance
PNAS, February 8, 2005; 102(6): 1992 - 1997.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. M. Kantarjian, J. E. Cortes, S. O'Brien, R. Luthra, F. Giles, S. Verstovsek, S. Faderl, D. Thomas, G. Garcia-Manero, M. B. Rios, et al.
Long-term survival benefit and improved complete cytogenetic and molecular response rates with imatinib mesylate in Philadelphia chromosome-positive chronic-phase chronic myeloid leukemia after failure of interferon-{alpha}
Blood, October 1, 2004; 104(7): 1979 - 1988.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. S. Baker, J. G. Gurney, K. K. Ness, R. Bhatia, S. J. Forman, L. Francisco, P. B. McGlave, L. L. Robison, D. S. Snyder, D. J. Weisdorf, et al.
Late effects in survivors of chronic myeloid leukemia treated with hematopoietic cell transplantation: results from the Bone Marrow Transplant Survivor Study
Blood, September 15, 2004; 104(6): 1898 - 1906.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Harata, Y. Soda, K. Tani, J. Ooi, T. Takizawa, M. Chen, Y. Bai, K. Izawa, S. Kobayashi, A. Tomonari, et al.
CD19-targeting liposomes containing imatinib efficiently kill Philadelphia chromosome-positive acute lymphoblastic leukemia cells
Blood, September 1, 2004; 104(5): 1442 - 1449.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Kantarjian, M. Talpaz, S. O'Brien, G. Garcia-Manero, S. Verstovsek, F. Giles, M. B. Rios, J. Shan, L. Letvak, D. Thomas, et al.
High-dose imatinib mesylate therapy in newly diagnosed Philadelphia chromosome-positive chronic phase chronic myeloid leukemia
Blood, April 15, 2004; 103(8): 2873 - 2878.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Bagrintseva, R. Schwab, T. M. Kohl, S. Schnittger, S. Eichenlaub, J. W. Ellwart, W. Hiddemann, and K. Spiekermann
Mutations in the tyrosine kinase domain of FLT3 define a new molecular mechanism of acquired drug resistance to PTK inhibitors in FLT3-ITD-transformed hematopoietic cells
Blood, March 15, 2004; 103(6): 2266 - 2275.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. J. Donato, J. Y. Wu, J. Stapley, H. Lin, R. Arlinghaus, B. Aggarwal, S. Shishodin, M. Albitar, K. Hayes, H. Kantarjian, et al.
Imatinib Mesylate Resistance Through BCR-ABL Independence in Chronic Myelogenous Leukemia
Cancer Res., January 15, 2004; 64(2): 672 - 677.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. T. Ferrao, M. J. Frost, S.-P. Siah, and L. K. Ashman
Overexpression of P-glycoprotein in K562 cells does not confer resistance to the growth inhibitory effects of imatinib (STI571) in vitro
Blood, December 15, 2003; 102(13): 4499 - 4503.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Grunberger, P. Demin, O. Rounova, N. Sharfe, L. Cimpean, H. Dadi, A. Freywald, Z. Estrov, and C. M. Roifman
Inhibition of acute lymphoblastic and myeloid leukemias by a novel kinase inhibitor
Blood, December 1, 2003; 102(12): 4153 - 4158.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
K. M. Kirschner and K. Baltensperger
Erythropoietin Promotes Resistance Against the Abl Tyrosine Kinase Inhibitor Imatinib (STI571) in K562 Human Leukemia Cells
Mol. Cancer Res., November 1, 2003; 1(13): 970 - 980.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
J. M. Goldman and J. V. Melo
Chronic Myeloid Leukemia -- Advances in Biology and New Approaches to Treatment
N. Engl. J. Med., October 9, 2003; 349(15): 1451 - 1464.
[Full Text] [PDF]


Home page
BloodHome page
J. Kuroda, S. Kimura, H. Segawa, Y. Kobayashi, T. Yoshikawa, Y. Urasaki, T. Ueda, F. Enjo, H. Tokuda, O. G. Ottmann, et al.
The third-generation bisphosphonate zoledronate synergistically augments the anti-Ph+ leukemia activity of imatinib mesylate
Blood, September 15, 2003; 102(6): 2229 - 2235.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
M. W. N. Deininger and B. J. Druker
Specific Targeted Therapy of Chronic Myelogenous Leukemia with Imatinib
Pharmacol. Rev., September 1, 2003; 55(3): 401 - 423.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Cortes, F. Giles, S. O'Brien, D. Thomas, G. Garcia-Manero, M. B. Rios, S. Faderl, S. Verstovsek, A. Ferrajoli, E. J. Freireich, et al.
Result of high-dose imatinib mesylate in patients with Philadelphia chromosome--positive chronic myeloid leukemia after failure of interferon-{alpha}
Blood, July 1, 2003; 102(1): 83 - 86.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Branford, Z. Rudzki, S. Walsh, I. Parkinson, A. Grigg, J. Szer, K. Taylor, R. Herrmann, J. F. Seymour, C. Arthur, et al.
Detection of BCR-ABL mutations in patients with CML treated with imatinib is virtually always accompanied by clinical resistance, and mutations in the ATP phosphate-binding loop (P-loop) are associated with a poor prognosis
Blood, July 1, 2003; 102(1): 276 - 283.
[Abstract] [Full Text] [PDF]


Home page
ANN INTERN MEDHome page
R. Kurzrock, H. M. Kantarjian, B. J. Druker, and M. Talpaz
Philadelphia Chromosome-Positive Leukemias: From Basic Mechanisms to Molecular Therapeutics
Ann Intern Med, May 20, 2003; 138(10): 819 - 830.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Yu, M. Rahmani, J. Almenara, M. Subler, G. Krystal, D. Conrad, L. Varticovski, P. Dent, and S. Grant
Histone Deacetylase Inhibitors Promote STI571-mediated Apoptosis in STI571-sensitive and -resistant Bcr/Abl+ Human Myeloid Leukemia Cells
Cancer Res., May 1, 2003; 63(9): 2118 - 2126.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
K. Ohmine, T. Nagai, T. Tarumoto, T. Miyoshi, K. Muroi, H. Mano, N. Komatsu, F. Takaku, and K. Ozawa
Analysis of Gene Expression Profiles in an Imatinib-Resistant Cell Line, KCL22/SR
Stem Cells, May 1, 2003; 21(3): 315 - 321.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Nimmanapalli, L. Fuino, C. Stobaugh, V. Richon, and K. Bhalla
Cotreatment with the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) enhances imatinib-induced apoptosis of Bcr-Abl-positive human acute leukemia cells
Blood, April 15, 2003; 101(8): 3236 - 3239.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. N. Mohamed, P. Pemberton, J. Zonder, and C. A. Schiffer
The Effect of Imatinib Mesylate on Patients with Philadelphia Chromosome-positive Chronic Myeloid Leukemia with Secondary Chromosomal Aberrations
Clin. Cancer Res., April 1, 2003; 9(4): 1333 - 1337.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F.-X. Mahon, F. Belloc, V. Lagarde, C. Chollet, F. Moreau-Gaudry, J. Reiffers, J. M. Goldman, and J. V. Melo
MDR1 gene overexpression confers resistance to imatinib mesylate in leukemia cell line models
Blood, March 15, 2003; 101(6): 2368 - 2373.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
A. Nakajima, T. Tauchi, M. Sumi, W. R. Bishop, and K. Ohyashiki
Efficacy of SCH66336, a Farnesyl Transferase Inhibitor, in Conjunction with Imatinib against BCR-ABL-positive Cells
Mol. Cancer Ther., March 1, 2003; 2(3): 219 - 224.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Tatton, G. M. Morley, R. Chopra, and A. Khwaja
The Src-selective Kinase Inhibitor PP1 Also Inhibits Kit and Bcr-Abl Tyrosine Kinases
J. Biol. Chem., February 7, 2003; 278(7): 4847 - 4853.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Gambacorti-Passerini, M. Zucchetti, D. Russo, R. Frapolli, M. Verga, S. Bungaro, L. Tornaghi, F. Rossi, P. Pioltelli, E. Pogliani, et al.
{alpha}1 Acid Glycoprotein Binds to Imatinib (STI571) and Substantially Alters Its Pharmacokinetics in Chronic Myeloid Leukemia Patients
Clin. Cancer Res., February 1, 2003; 9(2): 625 - 632.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. J. Donato, J. Y. Wu, J. Stapley, G. Gallick, H. Lin, R. Arlinghaus, and M. Talpaz
BCR-ABL independence and LYN kinase overexpression in chronic myelogenous leukemia cells selected for resistance to STI571
Blood, January 15, 2003; 101(2): 690 - 698.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. M. Kantarjian, M. Talpaz, S. O'Brien, F. Giles, G. Garcia-Manero, S. Faderl, D. Thomas, J. Shan, M. B. Rios, and J. Cortes
Dose escalation of imatinib mesylate can overcome resistance to standard-dose therapy in patients with chronic myelogenous leukemia
Blood, January 15, 2003; 101(2): 473 - 475.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
J. V. Melo, T. P. Hughes, and J. F. Apperley
Chronic Myeloid Leukemia
Hematology, January 1, 2003; 2003(1): 132 - 152.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
R. P. DeMatteo
The GIST of Targeted Cancer Therapy: A Tumor (Gastrointestinal Stromal Tumor), a Mutated Gene (c-kit), and a Molecular Inhibitor (STI571)
Ann. Surg. Oncol., November 1, 2002; 9(9): 831 - 839.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Ricci, B. Scappini, V. Divoky, S. Gatto, F. Onida, S. Verstovsek, H. M. Kantarjian, and M. Beran
Mutation in the ATP-binding Pocket of the ABL Kinase Domain in an STI571-resistant BCR/ABL-positive Cell Line
Cancer Res., November 1, 2002; 62(21): 5995 - 5998.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Nimmanapalli, E. O'Bryan, M. Huang, P. Bali, P. K. Burnette, T. Loughran, J. Tepperberg, R. Jove, and K. Bhalla
Molecular Characterization and Sensitivity of STI-571 (Imatinib Mesylate, Gleevec)-resistant, Bcr-Abl-positive, Human Acute Leukemia Cells to SRC Kinase Inhibitor PD180970 and 17-Allylamino-17-demethoxygeldanamycin
Cancer Res., October 15, 2002; 62(20): 5761 - 5769.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Yu, G. Krystal, P. Dent, and S. Grant
Flavopiridol Potentiates STI571-induced Mitochondrial Damage and Apoptosis in BCR-ABL-positive Human Leukemia Cells
Clin. Cancer Res., September 1, 2002; 8(9): 2976 - 2984.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
O. G. Ottmann, B. J. Druker, C. L. Sawyers, J. M. Goldman, J. Reiffers, R. T. Silver, S. Tura, T. Fischer, M. W. Deininger, C. A. Schiffer, et al.
A phase 2 study of imatinib in patients with relapsed or refractory Philadelphia chromosome-positive acute lymphoid leukemias
Blood, August 28, 2002; 100(6): 1965 - 1971.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Wisniewski, C. L. Lambek, C. Liu, A. Strife, D. R. Veach, B. Nagar, M. A. Young, T. Schindler, W. G. Bornmann, J. R. Bertino, et al.
Characterization of Potent Inhibitors of the Bcr-Abl and the c-Kit Receptor Tyrosine Kinases
Cancer Res., August 1, 2002; 62(15): 4244 - 4255.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Roche-Lestienne, V. Soenen-Cornu, N. Grardel-Duflos, J.-L. Lai, N. Philippe, T. Facon, P. Fenaux, and C. Preudhomme
Several types of mutations of the Abl gene can be found in chronic myeloid leukemia patients resistant to STI571, and they can pre-exist to the onset of treatment
Blood, July 18, 2002; 100(3): 1014 - 1018.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. R. Hoover, F.-X. Mahon, J. V. Melo, and G. Q. Daley
Overcoming STI571 resistance with the farnesyl transferase inhibitor SCH66336
Blood, July 18, 2002; 100(3): 1068 - 1071.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. B. Dash, I. R. Williams, J. L. Kutok, M. H. Tomasson, E. Anastasiadou, K. Lindahl, S. Li, R. A. Van Etten, J. Borrow, D. Housman, et al.
A murine model of CML blast crisis induced by cooperation between BCR/ABL and NUP98/HOXA9
PNAS, May 28, 2002; 99(11): 7622 - 7627.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. L. Sawyers, A. Hochhaus, E. Feldman, J. M. Goldman, C. B. Miller, O. G. Ottmann, C. A. Schiffer, M. Talpaz, F. Guilhot, M. W. N. Deininger, et al.
Imatinib induces hematologic and cytogenetic responses in patients with chronic myelogenous leukemia in myeloid blast crisis: results of a phase II study
Blood, May 15, 2002; 99(10): 3530 - 3539.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Branford, Z. Rudzki, S. Walsh, A. Grigg, C. Arthur, K. Taylor, R. Herrmann, K. P. Lynch, and T. P. Hughes
High frequency of point mutations clustered within the adenosine triphosphate-binding region of BCR/ABL in patients with chronic myeloid leukemia or Ph-positive acute lymphoblastic leukemia who develop imatinib (STI571) resistance
Blood, May 1, 2002; 99(9): 3472 - 3475.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Talpaz, R. T. Silver, B. J. Druker, J. M. Goldman, C. Gambacorti-Passerini, F. Guilhot, C. A. Schiffer, T. Fischer, M. W. N. Deininger, A. L. Lennard, et al.
Imatinib induces durable hematologic and cytogenetic responses in patients with accelerated phase chronic myeloid leukemia: results of a phase 2 study
Blood, March 15, 2002; 99(6): 1928 - 1937.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Baron, A. G. Turhan, J. Giron-Michel, B. Azzarone, M. Bentires-Alj, V. Bours, J. H. Bourhis, S. Chouaib, and A. Caignard
Leukemic target susceptibility to natural killer cytotoxicity: relationship with BCR-ABL expression
Blood, March 15, 2002; 99(6): 2107 - 2113.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W.-K. Hofmann, L. C. Jones, N. A. Lemp, S. de Vos, H. Gschaidmeier, D. Hoelzer, O. G. Ottmann, and H. P. Koeffler
Ph+ acute lymphoblastic leukemia resistant to the tyrosine kinase inhibitor STI571 has a unique BCR-ABL gene mutation
Blood, March 1, 2002; 99(5): 1860 - 1862.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
D. G. Savage and K. H. Antman
Imatinib Mesylate -- A New Oral Targeted Therapy
N. Engl. J. Med., February 28, 2002; 346(9): 683 - 693.
[Full Text] [PDF]


Home page
BloodHome page
B. M. F. Mow, J. Chandra, P. A. Svingen, C. G. Hallgren, E. Weisberg, T. J. Kottke, V. L. Narayanan, M. R. Litzow, J. D. Griffin, E. A. Sausville, et al.
Effects of the Bcr/abl kinase inhibitors STI571 and adaphostin (NSC 680410) on chronic myelogenous leukemia cells in vitro
Blood, January 15, 2002; 99(2): 664 - 671.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. G. Jorgensen, M. A. Elliott, E. K. Allan, C. E. Carr, T. L. Holyoake, and K. D. Smith
alpha 1-Acid glycoprotein expressed in the plasma of chronic myeloid leukemia patients does not mediate significant in vitro resistance to STI571
Blood, January 15, 2002; 99(2): 713 - 715.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. J. Mauro, M. O'Dwyer, M. C. Heinrich, and B. J. Druker
STI571: A Paradigm of New Agents for Cancer Therapeutics
J. Clin. Oncol., January 1, 2002; 20(1): 325 - 334.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Yu, G. Krystal, L. Varticovksi, R. McKinstry, M. Rahmani, P. Dent, and S. Grant
Pharmacologic Mitogen-activated Protein/Extracellular Signal-regulated Kinase Kinase/Mitogen-activated Protein Kinase Inhibitors Interact Synergistically with STI571 to Induce Apoptosis in Bcr/Abl-expressing Human Leukemia Cells
Cancer Res., January 1, 2002; 62(1): 188 - 199.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Hawk, T. Sun, S. Xie, Y. Wang, Y. Wu, J. Liu, and R. B. Arlinghaus
Inhibition of the Bcr-Abl Oncoprotein by Bcr Requires Phosphoserine 354
Cancer Res., January 1, 2002; 62(2): 386 - 390.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Q. Zhang, P. N. Raghunath, L. Xue, M. Majewski, D. F. Carpentieri, N. Odum, S. Morris, T. Skorski, and M. A. Wasik
Multilevel Dysregulation of STAT3 Activation in Anaplastic Lymphoma Kinase-Positive T/Null-Cell Lymphoma
J. Immunol., January 1, 2002; 168(1): 466 - 474.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. M. Graham, H. G. Jorgensen, E. Allan, C. Pearson, M. J. Alcorn, L. Richmond, and T. L. Holyoake
Primitive, quiescent, Philadelphia-positive stem cells from patients with chronic myeloid leukemia are insensitive to STI571 in vitro
Blood, January 1, 2002; 99(1): 319 - 325.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. C. Wolff and R. L. Ilaria Jr
Establishment of a murine model for therapy-treated chronic myelogenous leukemia using the tyrosine kinase inhibitor STI571
Blood, November 1, 2001; 98(9): 2808 - 2816.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
C. Barthe, P. Cony-Makhoul, J. V. Melo, J. R. F.-X. Mahon, A. Hochhaus, S. Kreil, A. Corbin, P. La Rosee, T. Lahaye, U. Berger, et al.
Roots of Clinical Resistance to STI-571 Cancer Therapy
Science, September 21, 2001; 293(5538): 2163a - 2163.
[Full Text] [PDF]


Home page
The OncologistHome page
B. A. Chabner
The Oncologic Four-Minute Mile
Oncologist, June 1, 2001; 6(3): 230 - 232.
[Full Text] [PDF]


Home page
The OncologistHome page
M. J. Mauro and B. J. Druker
STI571: Targeting BCR-ABL as Therapy for CML
Oncologist, June 1, 2001; 6(3): 233 - 238.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
B. J. Druker, C. L. Sawyers, H. Kantarjian, D. J. Resta, S. F. Reese, J. M. Ford, R. Capdeville, and M. Talpaz
Activity of a Specific Inhibitor of the BCR-ABL Tyrosine Kinase in the Blast Crisis of Chronic Myeloid Leukemia and Acute Lymphoblastic Leukemia with the Philadelphia Chromosome
N. Engl. J. Med., April 5, 2001; 344(14): 1038 - 1042.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
J. M. Goldman and J. V. Melo
Targeting the BCR-ABL Tyrosine Kinase in Chronic Myeloid Leukemia
N. Engl. J. Med., April 5, 2001; 344(14): 1084 - 1086.
[Full Text] [PDF]


Home page
BloodHome page
X. Sun, J. E. Layton, A. Elefanty, and G. J. Lieschke
Comparison of effects of the tyrosine kinase inhibitors AG957, AG490, and STI571 on BCR-ABL-expressing cells, demonstrating synergy between AG490 and STI571
Blood, April 1, 2001; 97(7): 2008 - 2015.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Nimmanapalli, E. O’Bryan, and K. Bhalla
Geldanamycin and Its Analogue 17-Allylamino-17-demethoxygeldanamycin Lowers Bcr-Abl Levels and Induces Apoptosis and Differentiation of Bcr-Abl-positive Human Leukemic Blasts
Cancer Res., March 1, 2001; 61(5): 1799 - 1804.
[Abstract] [Full Text]


Home page
BloodHome page
D. G. Peters, R. R. Hoover, M. J. Gerlach, E. Y. Koh, H. Zhang, K. Choe, P. Kirschmeier, W. R. Bishop, and G. Q. Daley
Activity of the farnesyl protein transferase inhibitor SCH66336 against BCR/ABL-induced murine leukemia and primary cells from patients with chronic myeloid leukemia
Blood, March 1, 2001; 97(5): 1404 - 1412.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Nimmanapalli, M. Porosnicu, D. Nguyen, E. Worthington, E. O’Bryan, C. Perkins, and K. Bhalla
Cotreatment with STI-571 Enhances Tumor Necrosis Factor {{alpha}}-related Apoptosis-inducing Ligand (TRAIL or Apo-2L)- induced Apoptosis of Bcr-Abl-positive Human Acute Leukemia Cells
Clin. Cancer Res., February 1, 2001; 7(2): 350 - 357.
[Abstract] [Full Text]


Home page
ASH Education BookHome page
B. J. Druker, C. L. Sawyers, R. Capdeville, J. M. Ford, M. Baccarani, and J. M. Goldman
Chronic Myelogenous Leukemia
Hematology, January 1, 2001; 2001(1): 87 - 112.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Z. A. Knight;, C. Gambacorti-Passerini, P. le Coutre, E. Tassi, and H. Ruchatz
Another possible mechanism of resistance to STI571
Blood, December 1, 2000; 96(12): 4003 - 4005.
[Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
C. Gambacorti-Passerini, R. Barni, P. le Coutre, M. Zucchetti, G. Cabrita, L. Cleris, F. Rossi, E. Gianazza, J. Brueggen, R. Cozens, et al.
Role of {alpha}1 Acid Glycoprotein in the In Vivo Resistance of Human BCR-ABL+ Leukemic Cells to the Abl Inhibitor STI571
J Natl Cancer Inst, October 18, 2000; 92(20): 1641 - 1650.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
M. L. Grossbard
Hematologic Malignancies: Selected Abstracts and Commentary
Oncologist, August 1, 2000; 5(4): 280 - 284.
[Abstract] [Full Text]


Home page
ScienceHome page
M. E. Gorre, M. Mohammed, K. Ellwood, N. Hsu, R. Paquette, P. N. Rao, and C. L. Sawyers
Clinical Resistance to STI-571 Cancer Therapy Caused by BCR-ABL Gene Mutation or Amplification
Science, August 3, 2001; 293(5531): 876 - 880.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weisberg, E.
Right arrow Articles by Griffin, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weisberg, E.
Right arrow Articles by Griffin, J. D.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrowRelated Letter in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2000 by American Society of Hematology         Online ISSN: 1528-0020