|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 95 No. 11 (June 1), 2000:
pp. 3514-3519
NEOPLASIA
From the Divisions of Hematology, Medical Oncology, and
Gastroenterology and Hepatology, University Hospital of Groningen,
Department of Medical Genetics, University of Groningen; Division of
Hematology, Free University Hospital Amsterdam; Division of Hematology,
University Hospital Nijmegen, The Netherlands.
Deletion of the multidrug resistance gene MRP1
has been demonstrated in acute myeloid leukemia (AML) patients with
inversion of chromosome 16 (inv[16]). These AML patients are known to
have a relatively favorable prognosis, which suggests that
MRP1 might play an important role in determining
clinical outcome. This study analyzed MRP1 deletion by
fluorescent in situ hybridization (FISH), with a focus on inv(16) AML
patients. Functional activity of multidrug resistance protein (MRP) was
studied in a flow cytometric assay with the use of the MRP substrate
carboxyfluorescein (CF) and the inhibitor MK-571. MRP1, MRP2, and MRP6
messenger RNA (mRNA) expression was determined with reverse
transcriptase-polymerase chain reaction (RT-PCR). The
results were compared with normal bone marrow cells. MRP1
deletion was detected in 7 AML patients; 2 cases showed no MRP1
FISH signals, and 5 cases had 1 MRP1 signal, whereas in 4 AML
patients with inv(16) no MRP1 deletions were observed. A
variability in MRP activity, expressed as CF efflux-blocking by
MK-571, was observed (efflux-blocking factors varied between 1.2 and
3.6); this correlated with the number of MRP1 genes
(r = 0.91, P < .01). MRP activity in the AML cases was
not different from normal hematopoietic cells. MRP1 mRNA was detected
in patients with 1 or 2 MRP1 FISH signals, but not in patients
with no MRP1 signals. MRP2 and MRP6 mRNA were expressed
predominantly in AML samples with 1 MRP1 signal, whereas in
normal bone marrow cells no MRP2 and MRP6 mRNA was observed. In
conclusion, this study shows that MRP activity varies among inv(16) AML
cases and does not differ from that in normal hematopoietic cells; this
might be in part due to the up-regulation of other MRP genes.
(Blood. 2000;95:3514-3519)
The occurrence of cross-resistance to structurally and
functionally unrelated drugs, called multidrug resistance (MDR), is a
main cause of failure in the chemotherapeutic treatment of malignant disorders. Several mechanisms of MDR have been identified1; one of these is the overexpression of adenosine triphosphate
(ATP)-dependent membrane proteins that function as drug-efflux pumps.
The multidrug resistance protein MRP12 is a member of the
superfamily of ATP-binding cassette (ABC) transporters to which
P-glycoprotein (P-gp), encoded by the MDR1 gene, also belongs.
MRP1, a 190-kd protein, is encoded by the MRP1
gene located on chromosome 16p13 and has been shown to transport a
broad range of organic substrates, such as glutathione (GSH) conjugates3 and other anionic conjugates.4
Overexpression of MRP1 results in resistance to different
classes of chemotherapeutic agents.5 Recently 5 additional
MRP family members, MRP2 through MRP6, have been
identified.6-8 However, the role of these MRP1 isoforms in MDR is not well defined yet. The most recently discovered member of the MRP family, MRP6, is located on chromosome 16p13, immediately next to the MRP1 gene. The 3' end of the
MRP6 gene was found to be identical with the anthracycline
resistance-associated (ARA) gene.9
Overexpression of the complete MRP6 gene or part of it was
observed only in cell lines with MRP1 gene overexpression, suggesting a coamplification as a result of the location adjacent to MRP1.8
Studies describing MRP1 messenger RNA (mRNA) and protein expression in
AML demonstrated variable results. In a study,10 MRP1
protein expression appeared to have no impact on treatment outcome in
AML. Another study showed MRP function, but not MRP1 protein
expression, to be a poor prognostic factor for achievement of complete
remission in AML.11 Previously we reported that blasts of
AML patients express MRP1 and MRP2 mRNA and that in these blasts MRP
functional activity correlates with MRP1 protein expression.12 Recently it was demonstrated that knockout of the mrp1 gene (mrp1[-/-]) in murine embryonic stem
cells and in mice leads to an increased in vitro sensitivity to
chemotherapeutic agents that are commonly used in the treatment of
AML.13,14
Inversion of chromosome 16 is a recurrent chromosomal rearrangement
identified in a subgroup of AML patients, most commonly patients with
the French-American-British (FAB) classification M4Eo.15
These patients generally have a high response rate to chemotherapy and
a relatively favorable prognosis.16,17 The fusion of the
core binding factor B (CBFB) gene located at chromosome 16q22
and the myosin heavy chain (MYH11) gene located at 16p13 results in a chimeric translation product coding for N-terminal CBFB
and C-terminal MYH11 sequences.18 It is considered likely that this fusion protein contributes to leukemogenesis and has a
dominant effect since only 1 of the 2 chromosomes 16 is affected. Deletion of 1 MRP1 allele17 and also deletion of
the ARA gene19 have been demonstrated in cells of
patients with inv(16) and were associated with increased duration of
disease-free survival, suggesting an important role for MRP1 in
determining clinical outcome.17 This study did not evaluate
MRP activity in these inv(16) AMLs, and the occurrence of MRP1
deletion in additional subclasses of AML was not evaluated.
In the present study, we analyzed the functional activity of MRP in AML
patients, with a focus on inv(16) patients versus normal bone
marrow samples, using a flow cytometric assay with the
MRP-specific substrate carboxyfluorescein (CF) in combination with the
MRP inhibitor and leukotriene D4 receptor antagonist MK-571.20 In addition, the occurrence of MRP1
deletions was studied with the fluorescent in situ hybridization (FISH)
technique, and the expression of MRP1, MRP2, and MRP6 mRNA were
detected by means of reverse transcriptase-polymerase chain reaction
(RT-PCR).
Patients
Normal bone marrow samples
Cell lines The human small cell lung cancer cell line GLC4 and its in vitro doxorubicin-selected, MRP1-overexpressing counterpart GLC4/ADR,22 were maintained in RPMI 1640 supplemented with 10% FCS. GLC4/ADR cells were cultured in the presence of 1.2 µmol/L doxorubicin (Pharmacia and Upjohn, Woerden, The Netherlands).Cytogenetics To study cytogenetics, bone marrow cells were cultured for 24 and 48 hours in RPMI 1640 supplemented with 15% FCS. The cultures were harvested and chromosome preparations were made according to standard cytogenetic techniques. The chromosomes were G-banded with the use of trypsin or pancreatin, and karyotypes were described according to the International System for Human Cytogenetic Nomenclature ISCN 1995.Fluorescent in situ hybridization Chromosome preparations were made according to standard cytogenetic techniques, and FISH was performed on the preparations according to standard laboratory protocols. An MRP1 complementary DNA fragment containing the basepairs (bp) 1036-5590, which was excised with BamHI from the expression vector pJ3 -MRP,23
was used as a probe for hybridization. An H36 cosmid, which is located on chromosome 16q24, was used as a control of the hybridization procedure and as a detector of chromosome 16q. Detection was performed by fluorescence microscopy. The results of the FISH technique were
described as follows: 0 signals when no MRP1 signal
was detected on either of the chromosomes 16 in all observed
metaphases; 1 signal when an MRP1 signal was observed on
1 of the 2 chromosomes 16 in all observed metaphases; and 2 signals when MRP1 was detected on both chromosomes 16 in at
least 4 observed metaphases.
RNA extraction and RT-PCR RNA extraction. Total cellular RNA was isolated from 10 × 106 AML blasts or 5 × 106 cell line cells with the use of 1 mL Trizol reagent (Life Technologies, Breda, The Netherlands). RNA was extracted, precipitated, and washed according to the manufacturer's protocol. RT-reaction. RNA (1 µg) was reverse transcribed in 15 µL of RT buffer containing 1.8 mmol/L each of deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate, and thymidine 5'-triphosphate (Promega Corp, Madison, WI); 9 mmol/L MgCl2; 68 mmol/L KCl; 45 mmol/L Tris/HCl (pH 8.3); 0.8 mg/mL bovine serum albumin; 28% glycerol; 10 U Moloney murine leukemia virus reverse transcriptase (M-MLV RT) (Phamacia, Woerden, The Netherlands); 4.8 U RNAguard (Pharmacia); 0.2 µg pd(N)6 random primers (Pharmacia); and 3 mmol/L dithiothreitol (Life Technologies). The reaction conditions were 65°C for 10 minutes and 37°C for 60 minutes. PCR analysis for CBFB/MYH11 mRNA fusion transcript. CBFB (0.33 µL, 50 µmol/L) and MYH11 (0.38 µL, 50 µmol/L) primers and 33.8 µL H2O were added, and the PCR reaction mix was incubated for 5 minutes at 96°C. Taq DNA polymerase (0.5 µL) (Pharmacia) was added, up to a final volume of 50 µL. The PCR reaction was subjected to 40 cycles of denaturation (94°C, 1 minute), annealing (57°C, 1 minute), and extension (72°C, 1 minute). Five µL of the reaction products were separated on a 1.5% agarose gel. The differentially spliced CBFB/MYH11 transcripts were visualized by ethidium bromide staining. The amplified product contains, depending on the nucleotide of splicing, 416 (type A), 1136 (type C), or 1343 (type D) bp. The sequences of the primers are as follows: CBFB 5'GCAGGCAAGGTATATTTGAAGG3', MYH11 5'CTCTTCTCCTCATTCTGCTC3'. PCR analysis for MRP1, MRP2, ARA/MRP6, and
Flow cytometric detection of functional drug efflux Functional activity of the MRP and P-gp transporters was demonstrated as described previously.12 To determine MRP (MRP1 and homologues MRP2 and MRP6) activity, we used the compound carboxyfluorescein diacetate (CFDA) (Sigma Chemical, Bornem, Belgium), which permeates the plasma membrane and which is transformed into the fluorescent anion CF upon cleavage of the ester bonds. CFDA was used in combination with the leukotriene D4 receptor antagonist and the MRP inhibitor MK-571 (kindly provided by Dr Ford-Hutchinson, Merck Sharp, Kirkland, Quebec, Canada).25 For the detection of P-gp activity, Rh123 (Sigma) was used together with the P-gp-specific inhibitor PSC833 (provided by Sandoz, Basel, Switzerland).Statistical analysis The paired Student t test was used to calculate significance, and correlations were calculated by means of the Pearson bivariate correlation test. A P of less than .05 was considered significant.
Patient characteristics Bone marrow samples were obtained from 11 de novo AML patients. Patient characteristics are described in Table 1. According to the FAB classification, 1 patient was M1, 1 was M2, and 9 were M4Eo. The patients were treated with intensive chemotherapy regimens according to the protocol of the Dutch-Belgian Hemato-Oncology Cooperative Group for AML (Hovon)26,27 or according to the protocol of the European Organization for the Research and Treatment of Cancer (EORTC).27,28Cytogenetic analysis and RT-PCR Cytogenetic analysis demonstrated that 10 patients had karyotypes showing clonal chromosomal abnormalities and that 1 patient had a normal karyotype. Relevant aberrations are shown in Table 1. Inv(16)(Figure 1) was demonstrated in all 9 patients with M4Eo and in 1 patient classified as M2. To confirm the cytogenetic results, RT-PCR was performed to detect the different fusion transcripts related to inv(16). In 9 patient samples, a fusion product was detected; 7 of these showed the 416-bp product of type A, 1 sample showed the 1136-bp product of type C, and 1 showed the 1343-bp product of type D (Table 1, Figure 2). In patient 10 with FAB classification M4Eo and cytogenetic karyotype inv(16), no fusion product was detected, even after 8 additional cycles of PCR.
Fluorescent in situ hybridization The FISH technique showed no MRP1 signals in 2 of the 11 AML patient samples (Table 2). One of these 2 patients was classified as M4Eo and showed inv(16) in both the cytogenetic analysis and the RT-PCR. The other patient was classified as M1, having a normal karyotype and showing no fusion transcript. In patients 3 through 7, 1 MRP1 signal was demonstrated on 1 of the 2 chromosomes 16; the other chromosome 16 did not show an MRP1 signal. Two MRP1 signals were observed in patients 8 through 11. These patients showed inv(16); 1 MRP1 signal was observed on the q arm of 1 of the chromosomes 16, while the other chromosome showed an MRP1 signal on the p arm. As a control, 3 normal bone marrow samples were studied. Two signals were observed in the normal hematopoietic cells.
MRP1, MRP2, and MRP6 mRNA expression To study whether the MRP1 deletion in AML patient samples causes a diminished MRP1 mRNA expression, semiquantitative RT-PCR analysis was performed. MRP1 mRNA was observed in all patients with 1 or 2 MRP1 FISH signals except for patient 11. MRP1 mRNA expression was not observed in the patients with no MRP1 FISH signals (patients 1 and 2, Figure 3). Since the MRP6 gene is located immediately next to the MRP1 gene at chromosome 16p13, RT-PCR was performed to study MRP6 mRNA expression in the AML samples. Patient 5 showed a distinct MRP6 mRNA band, while patients 6, 7, and 9 had a faint MRP6 mRNA expression (Figure 3). All of these patients, except for patient 9, had 1 MRP1 gene in the FISH study.
MRP and Pgp activity To test whether the deletion of an MRP1 gene causes a diminished MRP functional activity in these AML samples, we performed a flow cytometric assay using CFDA in combination with the MRP inhibitor MK-571. A variability in CF efflux-blocking of MK-571 was observed in the 11 AML patients studied (Table 2, Figure 4); efflux-blocking factors varied between 1.2 and 3.6. A significant correlation was observed between the number of MRP1 FISH signals and MRP activity (r = 0.91, P < .01) (Figure 4). To test whether the same variability could be observed with regard to the functionality of P-gp, a flow cytometric assay was performed with the use of Rh123 in combination with PSC833 to determine P-gp activity. The Rh123 efflux-blocking factors of PSC833 in these AML patient samples varied between 1.1 and 6.5. No correlation was observed between P-gp activity and MRP activity or between P-gp activity and MRP1 FISH signals. Finally, to correlate these findings with normal hematopoietic cells, MRP and P-gp activity were determined in normal bone marrow samples. The median CF efflux-blocking factor of MK-571 was 2.8 ± 0.5 (n = 9), and the P-gp activity, as determined by Rh123 efflux-blocking of PSC833, was 1.8 ± 0.4 (n = 9) (Table 2) in the normal hematopoietic bone marrow cells. These median values are not significantly different from the median values of the total group of AML patients. Furthermore, all CF efflux-blocking factors by MK-571 of the AML patient samples with 1 or 2 MRP1 FISH signals are within the range of the normal bone marrow values, whereas the 2 patient samples with no MRP1 FISH signals show lower MRP activity than the normal bone marrow samples (Figure 4).
Treatment outcome At the time of evaluation, 6 patients were alive and in continuous complete remission (CR) (follow-up time, 14 to 95 months). The median overall survival of this patient group was 52.2 months ± 35.0. Two patients achieved CR but relapsed; 1 of these died. Three additional patients died during the remission-induction phase of chemotherapy (Table 2). No distinct correlations were observed between treatment outcome and MRP1 deletion or MRP activity in this small group of AML patients.
The MRP1 gene is located at 16p13, centromeric to the MYH11 gene at a distance of approximately 150 kb.30 In the study of Kuss et al,17 a different treatment outcome in 5 inv(16) patients with MRP1 deletion and 7 inv(16) patients without MRP1 deletion was reported, suggesting that MRP1 has a critical role in determining clinical outcome in patients with inv(16). An additional study reported a deletion of between 150 kb and 350 kb, centromeric to the short-arm inversion breakpoint in the MYH11 gene, in a subgroup of inv(16) patients (6 of 38 patients studied), which did not affect the clinical outcome.29 In the present study, in a small group of AML patients we observed no correlations between treatment outcome and MRP1 deletion.
Submitted June 23, 1999; accepted January 26, 2000.
Reprints: E. Vellenga, Division of Hematology, Department of Internal Medicine, University Hospital Groningen, Hanzeplein 1, 9713 GZ Groningen, The Netherlands; e-mail: e.vellenga{at}int.azg.nl.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1.
Simon M, Schindler M.
Cell biological mechanisms of multidrug resistance in tumors.
Proc Natl Acad Sci U S A.
1994;91:3497
2.
Cole SPC, Bhardwaj G, Gerlach JH, et al.
Overexpression of a novel transporter gene in a multidrug resistant human lung cancer cell line.
Science.
1992;258:1650
3.
Müller M, Meijer C, Zaman GJ, et al.
Overexpression of the gene encoding the multidrug resistance-associated protein results in increasedATP-dependent gluthatione S-conjugate transport.
Proc Natl Acad Sci U S A.
1994;91:13,033 4. Cole SPC, Deeley RG. Multidrug resistance mediated by the ATP-binding cassette transporter protein MRP. Bioessays. 1998;20:931[Medline] [Order article via Infotrieve].
5.
Grant CE, Valdimarsson G, Hipfner DR, Almquist KC, Cole SPC, Deeley RG.
Overexpression of multidrug resistance-associated protein (MRP) increases resistance to natural product drugs.
Cancer Res.
1994;54:357
6.
Taniguchi K, Wada M, Kohno K, et al.
A human canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant human cancer cell lines with decreased drug accumulation.
Cancer Res.
1996;56:4124
7.
Kool M, de Haas M, Scheffer GL, et al.
Analysis of expression of cMOAT (MRP2), MRP3, MRP4 and MRP5, homologs of the multidrug resistance-associated protein gene (MRP1), in human cancer cell lines.
Cancer Res.
1997;57:3537
8.
Kool M, van der Linden M, de Haas M, Baas F, Borst P.
Expression of human MRP6, a homologue of the multidrug resistance protein gene MRP1, in tissues and cancer cells.
Cancer Res.
1999;59:175 9. Longhurst TJ, O'Neill GM, Harvie RM, Davey RA. The anthracycline resistance-associated (ara) gene, a novel gene associated with multidrug resistance in a human leukaemia cell line. Br J Cancer. 1996;74:1331[Medline] [Order article via Infotrieve]. 10. Filipits M, Suchomel RW, Zochbauer S, Brunner R, Lechner K, Pirker R. Multidrug resistance-associated protein in acute myeloid leukemia: no impact on treatment outcome. Clin Cancer Res. 1997;3:1419[Abstract].
11.
Legrand O, Simonin G, Perrot J-Y, Zittoun R, Marie J-P.
Pgp and MRP activities using calcein-AM are prognostic factors in adult acute myeloid leukemia patients.
Blood.
1998;91:4480 12. Van der Kolk DM, de Vries EGE, Koning JA, van den Berg E, Müller M, Vellenga E. Activity and expression of the multidrug resistance proteins MRP1 and MRP2 in acute myeloid leukemia cells, tumor cell lines and normal hematopoietic CD34+ peripheral blood cells. Clin Cancer Res. 1998;4:1727[Abstract].
13.
Lorico A, Rappa G, Finch RA, Yang D, Flavell RA, Sartorelli AC.
Disruption of the murine MRP (multidrug resistance protein) gene leads to increased sensitivity to etoposide (VP-16) and increased levels of glutathione.
Cancer Res.
1997;57:5238 14. Wijnholds J, Evers R, van Leusden MR, et al. Increased sensitivity to anticancer drugs and decreased inflammatory response in mice lacking the multidrug resistance-associated protein. Nat Med. 1997;3:1275[Medline] [Order article via Infotrieve]. 15. LeBeau MM, Larson RA, Bitter MA, Vardiman JW, Golomb HM, Rowley JD. Association of an inver-sion of chromosome 16 with abnormal marrow eosinophils in acute myelomonocytic leukemia. N Engl J Med. 1983;309:630[Abstract].
16.
Schiffer CA, Lee EJ, Tomiyasu T, Wiernik PH, Testa JR.
Prognostic impact of cytogenetic abnormalities in patients with de novo acute nonlymphocytic leukemia.
Blood.
1989;73:263 17. Kuss BJ, Deeley RG, Cole SPC, et al. Deletion of gene for multidrug resistance in acute myeloid leukaemia with inversion in chromosome 16: prognostic implications. Lancet. 1994;343:1531[Medline] [Order article via Infotrieve].
18.
Liu P, Tarlé SA, Hajra A, et al.
Fusion between transcription factor CBF 19. Kuss BJ, O'Neill GM, Eyre H, Doggett NA, Callen DF, Davey RA. ARA, a novel ABC transporter, is located at 16p13.1, is deleted in inv(16) leukemias, and is shown to be expressed in primitive hematopoietic precursors. Genomics. 1998;51:455[Medline] [Order article via Infotrieve].
20.
Leier J, Jedlitschky G, Buchholz U, Cole SPC, Deeley RG, Keppler D.
The MRP gene encodes an ATP-dependent export pump for leukotriene C4 and structurally related conjugates.
J Biol Chem.
1994;269:27,807 21. Gralnick HR. Classification of acute leukemia. Ann Intern Med. 1977;87:740.
22.
Zijlstra JG, de Vries EGE, Mulder NH.
Multifactorial drug resistance in an adriamycin-resistant human small cell lung carcinoma cell line.
Cancer Res.
1987;47:1780
23.
Zaman GJR, Flens MJ, van Leusden MR, et al.
The human multidrug resistance-associated protein MRP is a plasma membrane drug-efflux pump.
Proc Natl Acad Sci U S A.
1994;91:8822 24. O'Neill GM, Peters GB, Harvie RM, MacKenzie HB, Henness S, Davey RA. Amplification and expression of the ABC transporters ARA and MRP in a series of multidrug-resistant leukaemia cell sublines. Br J Cancer. 1998;77:2076[Medline] [Order article via Infotrieve]. 25. Jones TR, Zamboni R, Belley M, et al. Pharmacology of L-660,711 (MK-571): a novel potent and selective leukotriene D4 receptor antagonist. Can J Physiol Pharmacol. 1989;67:17[Medline] [Order article via Infotrieve].
26.
Löwenberg B, Boogaerts MA, Daenen SM, et al.
Value of different modalities of granulocyte-macrophage colony-stimulating factor applied during or after induction therapy of acute myeloid leukemia.
J Clin Oncol.
1997;15:3496
27.
Löwenberg B, Suciu S, Archimbaud E, et al.
Mitoxantrone versus daunorubicin in induction-consolidation chemotherapy 28. Zittoun R. The EORTC trials for acute myelogenous leukemia: EORTC Leukemia Cooperative Group: European Organisation of Research and Treatment of Cancer. Hematol Cell Ther. 1996;38:247[Medline] [Order article via Infotrieve]. 29. Campbell L, Challis J, Fok T, Garson OM. Chromosome 16 abnormalities associated with myeloid malignancies. Genes Chromosomes Cancer. 1991;3:55[Medline] [Order article via Infotrieve]. 30. Kuss BJ, Deeley RG, Cole SPC, et al. The biological significance of the multidrug resistance gene MRP in inversion 16 leukemias. Leuk Lymphoma. 1996;20:357[Medline] [Order article via Infotrieve].
31.
Van der Reijden BA, Lombardo M, Dauwerse H, et al.
RT-PCR diagnosis of patients with acute nonlymphocytic leukemia and inv(16)(p13q22) and identification of new alternative splicing in CBFB-MYH11 transcripts.
Blood.
1995;86:277
32.
Claxton DF, Liu P, Hsu HB, et al.
Detection of fusion transcripts generated by the inversion 16 chromosome in acute myelogenous leukemia.
Blood.
1994;83:1750
33.
Marlton P, Claxton DF, Liu P, et al.
Molecular characterization of 16p deletions associated with inversion 16 defines the critical fusion for leukemogenesis.
Blood.
1995;85:772 34. Springall FH, Lukeis RL, Tyrell V, Joshua DE, Iland HJ. Identification of a novel CBFB-MYH11 fusion transcript in a patient with AML and inversion of chromosome 16. Leukemia. 1998;12:2034[Medline] [Order article via Infotrieve].
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  D. M. van der Kolk, E. Vellenga, G. L. Scheffer, M. Muller, S. E. Bates, R. J. Scheper, and E. G. E. de Vries Expression and activity of breast cancer resistance protein (BCRP) in de novo and relapsed acute myeloid leukemia Blood, May 15, 2002; 99(10): 3763 - 3770. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Kolomietz, J. Al-Maghrabi, S. Brennan, J. Karaskova, S. Minkin, J. Lipton, and J. A. Squire Primary chromosomal rearrangements of leukemia are frequently accompanied by extensive submicroscopic deletions and may lead to altered prognosis Blood, June 1, 2001; 97(11): 3581 - 3588. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. van der Kolk, E. G. E. de Vries, W. L. J. van Putten, L. F. Verdonck, G. J. Ossenkoppele, G. E. G. Verhoef, and E. Vellenga P-glycoprotein and Multidrug Resistance Protein Activities in Relation to Treatment Outcome in Acute Myeloid Leukemia Clin. Cancer Res., August 1, 2000; 6(8): 3205 - 3214. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
196°C. Upon analysis, AML cells were thawed, treated with
DNase I (Boehringer Mannheim, Almere, The Netherlands), washed with
RPMI 1640 medium, and incubated for 1 hour in RPMI 1640 medium, supplemented with 10% FCS at 37°C, 5% CO2.
May-Grünwald Giemsa stainings were made or immunophenotyping was
performed to determine the percentage of blast cells in the AML cells.
For phenotyping, 0.5 × 106 were incubated with 5 µL of fluorescein isothiocyanate- or
phycoerythrin-labeled mouse monoclonal antibodies, CD34, CD33, or
immunoglobulin G isotype-matched control (Becton Dickinson, Mountain
View, CA) for 20 minutes at 4°C, washed with RPMI 1640 medium, and
analyzed with a FACStar flow cytometer (Becton Dickinson Medical
Systems, Sharon, MA). Viability of the cells was determined by trypan
blue exclusion.
-2 microglobin mRNA.
PCR analysis for MRP1 and MRP2 mRNA was performed as described
previously.
the value of low-dose cytarabine for maintenance of remission, and an assessment of prognostic factors in acute myeloid leukemia in the elderly: final report: European Organization for the Research and Treatment of Cancer and the Dutch-Belgian Hemato-Oncology Cooperative Hovon Group.
J Clin Oncol.
1998;15:872.