| |
|
|
|
|
|
|
|||
|
Blood, Vol. 95 No. 11 (June 1), 2000:
pp. 3520-3529
NEOPLASIA
From the Department of Internal Medicine I, Division of Hematology,
Department of Clinical Chemistry and Laboratory Medicine, and
Department of Pathology, University of Vienna, Vienna, Austria; and the
Department of Medicine II, University of Kiel, Kiel, Germany.
The human t(14;18) chromosomal translocation is assumed to result
from illegitimate rearrangement between BCL-2 and
DH/JH gene segments during V(D)J recombination
in early B cells. De novo nucleotides are found inserted in most
breakpoints and have been thus far interpreted as nontemplated N region
additions. In this report, we have analyzed both direct
(BCL-2/JH) and reciprocal (DH/BCL-2)
breakpoints derived from 40 patients with follicular lymphoma with
t(14;18). Surprisingly, we found that more than 30% of the breakpoint
junctions contain a novel type of templated nucleotide insertions,
consisting of short copies of the surrounding BCL-2, DH,
and JH sequences. The features of these templated
nucleotides, including multiplicity of copies for 1 template and the
occurrence of mismatches in the copies, suggest the presence of a
short-patch DNA synthesis, templated and error-prone. In addition, our
analysis clearly shows that t(14;18) occurs during a very restricted
window of B-cell differentiation and involves 2 distinct mechanisms: V(D)J recombination, mediating the breaks on chromosome 14 during an
attempted secondary DH to JH rearrangement, and
an additional unidentified mechanism creating the initial breaks on
chromosome 18. Altogether, these data suggest that the t(14;18)
translocation is a more complex process than previously thought,
involving the interaction and/or subversion of V(D)J recombination with
multiple enzymatic machineries.
(Blood. 2000;95:3520-3529)
The t(14;18) (q32;q21) chromosomal translocation and
ensuing overexpression of the proto-oncogene BCL-2 are assumed to be the initial steps of the malignant transformation to follicular lymphoma (FL).1,2 Analysis of the breakpoint regions have shown that the BCL-2 gene on chromosome 18 is fused to 1 of the JH gene segments from the immunoglobulin (Ig)H locus on
chromosome 14,3-6 whereas the reciprocal junction consists
in most cases of the fusion of a DH gene segment from the
IgH locus on chromosome 14 with the remaining 3' BCL-2
untranslated region on chromosome 18.7-10 The involvement
of the Ig DH and JH gene segments in the recombination process, together with the presence of N regions at the
breakpoints, prompted early interpretations of the t(14;18) translocation as a mistake in the normal mechanism of V(D)J
recombination.4-6,8,11,12
V(D)J recombination is a highly orchestrated lymphoid-specific
mechanism, regulated throughout differentiation and cell cycle. Recombination is directed by recombination signal sequences (RSS), which are flanking each gene segment (for review see
Lewis13). The initiation of the V(D)J
recombination consists of a single strand cut at the precise coding
end/RSS border, followed by transesterification on the opposite strand,
generating 2 covalently sealed hairpin coding ends (for review see
Gellert14). DNA hairpins are subsequently resolved into
free ends. In case of nicks occurring on only 1 strand, the resulting
protruding strand ends with palindromic nucleotides coming from the
opposite strand. These nucleotide additions are termed P nucleotides
and are a characteristic of V(D)J recombination because they are the
direct result of DNA hairpin resolution. Alternatively, nicks could
also happen on both strands, giving rise to deletion of part of the
coding ends. Once coding ends are opened up, more modifications can
take place. One of these modifications is the addition
of nontemplated nucleotides (termed N nucleotides) to 3'OH free
ends by the terminal deoxynucleotidyl transferase (TdT). The sum of
those modifications of the coding ends before religation (P and N
addition and nucleotide deletion) is referred to as "coding end
processing" and constitutes the hallmark of the V(D)J recombination
process. Consistent with the V(D)J recombination mechanism, DNA
sequence analysis of the direct (BCL-2/JH) and reciprocal
(DH/BCL-2) junctions revealed a normal processing of the
DH and JH segments.4-10,15,16 It is
therefore likely that at least the DH and JH
counterparts of the translocation are generated by V(D)J recombination.
The involvement of the V(D)J recombination mechanism in the
BCL-2 counterpart is yet more obscure. On chromosome 18, most
breaks occur in the major breakpoint region (mbr), located in the
3' untranslated region of the BCL-2 gene.6,7 Within the mbr, Wyatt et al10 have subdefined 3 clusters of 15 to 20 base pairs (bp), in which 80%-90% of the mbr breaks occur. Despite the remarkable clustering of the breakpoints in BCL-2, compared with other similar types of translocations, no proper RSSs
were found, arguing against a role of a RAG-1/2-mediated process.
Nevertheless, the presence of many potential cryptic RSSs in the mbr
leaves the possibility of very low levels of V(D)J recombination at
those sites.17
As a consequence of the absence of RSS-mediated cuts and in contrast to
the DH and JH coding ends, the mbr breaks do
not occur at 1 precise location. Therefore, simultaneous analysis of
both direct and reciprocal breakpoints from the same translocation event is necessary to infer the initial location of the mbr breakpoint and potential subsequent processing of its 5' mbr and 3'
mbr ends. To date, only few t(14;18) translocations have been
characterized at both direct and reciprocal breakpoints, giving a
somewhat confusing picture of the possible mechanism responsible for
the initial break at the mbr locus.7-11 Initially, Bakhshi
et al7 noted a 3-bp duplication of the mbr sequence and
proposed that this could be the result of a staggered
double-strand break. However, in all cases reported so far, the
duplications were short and could also be attributed to N additions.
The issue of the presence of duplications as a general feature of the
t(14;18) translocation is of importance, since both precise breaks and
deletions are compatible with V(D)J recombination mechanism, but
duplications are not. To get a better understanding of the molecular
mechanism involved in the t(14;18) translocation, we report in this
study a detailed analysis of the first comprehensive DNA sequence
library of both direct and reciprocal breakpoint regions derived from 40 t(14;18) translocation-positive FL patients. Our results clearly show that 2 distinct mechanisms generate the breaks at the
immunoglobulin and mbr loci and reveal the presence of an unexpected
new type of error-prone templated nucleotide insertion at the
breakpoints. The implications of these new features of the t(14;18)
breakpoints shed new light on possible mechanisms involved in the
translocation process and ensuing lymphomagenesis.
Source of DNA samples
Polymerase chain reaction amplification and sequencing
Primers (5' to 3') JH primers. JHCo-B: ACCTGAGGAGACGGTGACC; JHex-B: GGACTCACCTGAGGAGAC. mbr primers. mbr6-A: CCAGCAGATTCAAATCTATGGT; mbr7-A: GAGTTGCTTTACGTGGCCTGTT; mbr5-B:GGAGGATCTTACCACGTGGAG; mbrN1-B: GGATAGCAGCACAGGATTGG. DH primary. D1: GGCCTCGGTCTCTGTGGGTG; D2: GTACAGCACTGGGCTCAGAG; D3: TGAGAGCGCTGGGCCCACAG; D4: CTGAGATCCCCAGGACGCAG; D5: TGGGAAGCTCCTCCTGACAG; D6: TTCCAGACACCAGACAGAGG; D7: ACATCAGCCCCCAGCCCCAC. DH secondary. D1N1: CACCCAGGAGGCCCCAGAG; D2N1: TGCACAGTCTCAGCAGGAG; D3N1: GACATCCCGGGTTTCCCCAG; D4N1: GACGCCTGGACCAGGGCCTG; D5N1: CCCGCCTCCAGTTCCAGGTG; D6N1: TGAGCCCAGCAAGGGAAGG; D7N1: AGGCCCCCTACCAGCCGCAG. Statistics T nucleotides are defined as short sequences in the breakpoint insertions, which present enough sequence identity with adjacent flanking sequences to exclude their concomitant presence by chance alone. The significance of each T-nucleotide observation in each sample was estimated with the use of a binomial test. If we consider as an approximation that each of the 4 bases has an equiprobability of representation, the "null probability" (ie, the probability to find a given sequence of length "h" by chance) is P0 = (1/4)h. T nucleotides are found by searching all possible sequences of length h in 1 given breakpoint de novo insertion (of length "n") and attempting to match them to homologous sequences in adjacent flanking regions (of length "N") in both direct and reverse-complement orientations. A T nucleotide observed in 1 of the breakpoint de novo insertion (n1) is either homologous to a sequence in the adjacent mbr, DH, or JH flanking sequences, or to a sequence in the other breakpoint de novo insertion of the same sample (n2). In the former case, N corresponds to the total length of the adjacent sequences looked at (~ 200 nucleotides) and in the latter case N = n2. We only considered sequences of length h of at least 5 in breakpoint de novo insertions of length n of at least 5. The expected number of perfect matches occurring by chance is: e0 = P0 × (n + 1 h) × 2 × N.
In case of homologous but not identical sequences, the null probability
to find a given sequence h with "m" mismatches (and h m
identities) is:
Pm = [h!/{m! × (h m)!}] × (1/4)(h m) × (3/4)m.
In this case, the expected number of matches occurring by chance is:
em = Pm × (n + 1 h) × 2 × N.
The significance of the T-nucleotide observation is then calculated
using a test statistic: Z = (observed expected)/SDe, where
"observed" is the number of copies of a given T nucleotide in a
given sample, expected is e0 or em, and SDe is
the standard deviation of the expected number calculated according to
SDe = [e × (1 Pe)]. In
some samples, T nucleotides are observed in N, n1, and n2 with or
without mismatches. In case of perfect matches, the only term changing
in the test statistic formula is "observed" (observed = 2). In
presence of mismatches, the 2 expected values em1 and
em2, and their corresponding SDem are
different. The test statistic is then calculated according to
Z = (2 em)/ SDem.
Finally, the P value is calculated by comparing the Z
value to a standard Normal (Gaussian) distribution (mean = 0,
SD = 1). A Z value of at least 1.96 corresponds to a
P value of no more than .05, and indicates that the
T-nucleotide observation is significantly different from chance.
Distinct mechanisms generate the breaks at the Ig and mbr loci Sequence libraries obtained for the direct (mbr/JH) and reciprocal (DH/mbr) breakpoints of 40 t(14;18) FL samples are represented in Tables 1 and 2, respectively. To investigate which mechanisms generate breaks at the Ig and mbr loci, we analyzed and compared the nucleotide processing of DH/JH coding ends and mbr 3'/5' ends. As previously described, inspection of DH and JH coding ends confirmed a coding end processing typical of V(D)J recombination: The coding ends involved in the breakpoints are compatible with an initial break initiated at the precise RSS-coding end border, followed by subsequent coding end processing (Table 1, JH sequences, and Table 2, DH sequences). In agreement with normal human DJH junctions, numerous deletions and virtual absence of P regions were observed.19 The only atypical observation is sample #38, in which the reciprocal junction consists of a fusion between the JH6 RSS spacer and the 3' mbr (Table 2). Because the corresponding direct junction is prototypical and uses JH6 (Table 1), this observation suggests that illegitimate recombination might have occurred during an open-and-shut break.
The "de novo nucleotide additions" in the t(14;18) breakpoints show templated insertions We carried out a detailed analysis of the de novo nucleotide additions present in the direct and reciprocal breakpoints (Tables 1 and 2). Figure 1A shows the reciprocal (D3-3/mbr) and direct (mbr/JH6) breakpoint junctions of sample #6 and their homology to the original D3-3, mbr and JH6 genomic sequences. De novo nucleotide additions are shown between the regions of homology. Surprisingly, we found that the insertions at both breakpoints contain an identical sequence: 5' ACCAACTC 3' (broken-line boxed sequences). Moreover, the sequence of the D3-3/mbr junction, 5' TAACCAACTC 3', is also present as reverse-complement in the adjacent D3-3 genomic sequence, with 1 nucleotide mismatch (A7) (solid-line boxed sequences): 5' GAG-TGGTTA 3' on the plus strand, or 5' TAACCA-CTC 3' on the minus strand. To exclude the possibility of Taq-polymerase introduced mistakes, those sequences were confirmed by a second PCR amplification and sequencing. Such long stretches of identity in such short sequences are very unlikely to be coincidental (see statistics below). The presence of a similar sequence motif in the D3-3 segment and in both breakpoints implies therefore the occurrence of a templated DNA synthesis. Insertions at the t(14;18) breakpoints were so far interpreted as N-nucleotide additions. However, N regions are nontemplated nucleotides, added to free 3'OH ends (preferentially protruding ends) by the TdT.20-23 Although N-nucleotide synthesis is not completely random, displaying a marked preference for Gs, TdT does not use any template for polymerase extension. It is therefore clear that the nucleotide insertions observed in these breakpoints are not generated by the TdT. Palindromic (P) nucleotides are also frequently found in normal V(D)J junctions. However, P nucleotides and variations thereof24,25 all result from resolution of the hairpin intermediate and, by definition, cannot be present more than once. Furthermore, P nucleotides do not require de novo synthesis and are consequently also devoid of mismatches. It is therefore clear that the templated nucleotides observed here are not derived from the hairpin-opening mechanism generating P nucleotides. Which mechanism could account for the generation of these templated insertions? The multiplicity of "copies" for 1 template together with the occurrence of mismatches in the template/copy pair strongly suggest the presence of a short-patch DNA synthesis consisting of an error-prone copy of a template, followed by its insertion at a breakpoint. This possibility is illustrated in Figure 2: The D3-3 sequence provides a template for an error-prone synthesis (Figure 2A), followed by insertion of the copy at the reciprocal breakpoint (Figure 2B). Since the presence of multiple copies containing identical mismatches is more likely issued from vertical than horizontal lineage, this new sequence could in turn provide the template for another copy (Figure 2B) subsequently inserted in the other breakpoint (Figure 2C).
Templated nucleotides are a general feature of the t(14;18) breakpoint insertions To see if this observation was an isolated case or a general feature of the t(14;18) breakpoint insertions, we searched our sequence library for similar observations. Strikingly, we found numerous examples in which the de novo additions present in the breakpoints are templated. In sample #5 for example (Figure 1B), the D2-2 11-bp sequence 5' GTGAGGATATT 3' is found in the direct breakpoint with 1 nucleotide deletion (solid-line boxes), and the D2-2 neighboring 8-bp sequence 5' CCAGC-TGC 3' is found in the reciprocal breakpoint with 2 mismatches (broken-line boxes). In this example, the templated nucleotides constitute the quasi totality of the breakpoint insertions. In sample #13 (Figure 1C), the 10-bp sequence 5' GCTTTCTCAT 3' is found in the mbr and in the reciprocal breakpoint in reverse-complement orientation. The origin of 2 of the 10 nucleotides in the reciprocal breakpoint sequence is ambiguous because these nucleotides could either belong to the mbr 3' end or to the templated insert or both. The presence of a short stretch of homology at both the insert and the mbr ends could in fact provide an anchoring site for the insertion of the copy, a mechanism extensively used during nonhomologous recombination and V(D)J recombination.26,27 Another typical example is sample #28 (Figure 1D), in which 4 immediately adjacent sequences in the mbr are also found in both direct and reciprocal breakpoint inserts. Two of those contiguous mbr sequences (solid- and dash-line rectangular boxes) are found overlapping in the direct breakpoint. One possibility is that those mbr sequences would have constituted a unique template for a long error-prone copy of the sequence 5' CCACCAAGAAAGCAGGAA 3', subsequently inserted in the direct breakpoint. Alternatively, those 2 templates could have generated 2 copies (1 from the plus strand and 1 from the minus strand of the mbr) with the AA/TT overlapping doublet providing an anchoring site for a tandem insertion. This last type of "patchwork" insertion displaying the assembly of fragmented pieces is observed in the reciprocal breakpoint of the same sample. Here, the 2 adjacent mbr sequences 5' CTTCCTGAA 3' and 5' GTGGTCGTT 3' (solid- and dash-line ovoid boxes) are found inserted in reverse-complement orientation, but in inverse order (dash-line ovoid followed by solid-line ovoid, 5' to 3', minus strand), excluding the possibility of a single copy.Most templated nucleotide insertions constitute highly significant observations We have found many more examples of templated insertions of various length. However, it is clear that the shorter the identity between the sequences, the less obvious the identification and the higher the risk of fortuitous comparisons. To avoid such fortuitous comparisons, the significance of each sequence homology in each sample was estimated using a binomial test as described in the "Materials and methods" section. This test was designed with a conservative approach and is therefore very stringent (ie, more likely to accept than to reject the null hypothesis that the observation is due to chance only). As a reference point, the average length of the breakpoint insertions in this survey is n = 15 nucleotides. Although the "null" probability to find a given sequence of length h = 7 nucleotides by chance is ~61 × 10 6 in other words, an
event happening by chance only once every 16 kb the calculated
P value is P = .1. The observation is in this case
considered not significantly different from chance. Here, only a
perfect match of at least 8 nucleotides would be considered as highly
significant (P < .0001). For example, the sequence
CCAGC-TGC in sample #5 and the sequence
CTTCCTGAA in sample #28 have associated P values of
.30 and .37, respectively, and are therefore considered not
significantly different from chance under this test.
Features of templated nucleotides
Biased usage of 5' DH and 3' JH gene segments associated with t(14;18) breakpoints To investigate if particular DH and JH gene segments are preferentially associated with the translocation process, we analyzed the frequency of DH and JH gene usage in DH/mbr and mbr/JH breakpoints (Figure 3). As shown in Figure 3A, the overall use of DH segments is nonrandom, D2-2 (23%) and D3-3 (20.5%) contributing to the majority of segments found in the reciprocal breakpoints. Similarly, JH segment usage is strikingly biased toward JH6 (71%) (Figure 3B). Biased usage of gene segments could be due to difference in the RSS sequences. However, 3' RSS sequences are very conserved between members of the D2 or D3 family.18 In addition, the marked predominance for D2-2, D3-3, and JH6 usage contrasts with the distribution observed in normal V(D)J junctions at all stages of differentiation.18,19,28 Therefore, preferential usage of the most 5' DH segments together with preferential usage of the most 3' JH segments strongly suggests that the t(14;18) translocation process occurs during an attempted secondary DH to JH rearrangement.
Somatic mutations are observed on the DH segment of rare mbr to DJH direct breakpoints In the majority of samples, we found a prototypic mbr/JH fusion in the direct breakpoint and DH/mbr fusion in the reciprocal breakpoint (Tables 1 and 2). However, we observed 4 samples containing a mbr/DH/JH fusion (#5, #19, #28, #33, Table 1). Compatible with an attempted secondary D to DJH rearrangement on the same chromosome, all samples used a more 5' DH in the reciprocal breakpoint than the 1 used in the DJH junction (eg, D3-3 to D3-10/JH6, sample #28). Unexpectedly, the DH segments used in the mbr/DH/JH direct breakpoint of 3 of those 4 samples (#5, #28, and #33) contained somatic mutations (underlined in Table 1). To exclude the possibility that those mutations are due to Taq-polymerase introduced mistakes, the sequence of those samples were confirmed by a second PCR-amplification and sequencing. Remarkably, those DH segments constitute the only sequences in which somatic mutations are found, since none of the sequences of the flanking mbr in the direct breakpoint (Table 1) or DH and mbr regions in the reciprocal breakpoints (Table 2) presented a single-point mutation, including the ones corresponding to those 4 cases. If the somatic hypermutation process had happened posttranslocation, it would not have been limited to 3 of these 4 already infrequent cases or to the sequence of the DH segments. On the contrary, mutations would be expected in the adjacent mbr and in at least some of the other direct breakpoints. Furthermore, in the recombined der 14 chromosome, the closest promoter 5' of the mbr/JH breakpoint is the BCL-2 promoter. However, the BCL-2 promoter has not been described to target somatic hypermutation and is not located at a proper distance from the mbr breakpoint. It is therefore very unlikely that the somatic hypermutation happened posttranslocation. Thus, since bystander DJH rearrangements on the nonfunctional allele have been shown to undergo low levels of somatic hypermutation along with the VHDJH rearrangement on the functional allele,29,30 this suggests that both alleles underwent at least 1 round of somatic hypermutation before the translocation took place.
Fundamental questions concerning the mechanism of t(14;18) translocation remain to be answered. Is the V(D)J recombination mechanism involved in the generation of both Ig and mbr breaks? If not, which mechanisms are responsible for the initial breaks at the mbr locus and for subsequent illegitimate joining? The goal of this study was to extend current understanding of the molecular mechanism involved in the t(14;18) translocation. We report here a detailed analysis of the first comprehensive DNA sequence library of both direct and reciprocal breakpoint regions derived from 40 t(14;18) translocation-positive FL patients. Our survey confirms that the JH and DH coding ends engaged in the direct and reciprocal breakpoints of t(14;18) translocation show features of normal V(D)J recombination. This implies the presence and involvement of a functional and active V(D)J recombination machinery at the time of the translocation. However, our analysis also clearly shows that the formation of duplications is a general feature of the mechanism creating breaks at the mbr locus. Although both deletion and precise ends are still compatible with RAG-mediated coding end formation and processing, the presence of duplications is not compatible with RAG-mediated hairpin formation. Furthermore, precise breaks and deletions are not a particular feature of V(D)J recombination and are also found together with duplications during nonhomologous end-joining and somatic hypermutation mechanisms.31-34 Altogether, the absence of proper RSS signals in the mbr, the presence of a distinct mechanism from V(D)J recombination for a substantial fraction of the breaks, and the presence of a break signature compatible with other types of mechanisms strongly suggest that V(D)J recombination is not responsible for the initial breaks at the mbr locus. Thus, 2 distinct mechanisms are creating the initial breaks at the Ig and mbr loci, as previously proposed.7
We are grateful to Jim Koziol for advice on the statistical analysis and to Ann J. Feeney, David Schatz, Rolf Marschalek, and Rodrig Marculescu for helpful comments and suggestions on the manuscript.
Submitted October 4, 1999; accepted January 28, 2000.
Supported by a grant for the Interdisciplinary Cooperation Project (ICP) "Molecular Medicine" from the University of Vienna.
The sequence data have been submitted to the DDJB/EMBL/Genbank databases under accession numbers AF147979 to AF148063.
Reprints: Bertrand Nadel, Department of Internal Medicine I, Division of Hematology, University of Vienna, Waehringer Guertel 18-20, A-1090 Vienna, Austria; e-mail: bertrand.nadel{at}akh-wien.ac.at.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1. Seto M, Jaeger U, Hockett RD, et al. Alternative promoters and exons, somatic mutation and deregulation of the Bcl-2-Ig fusion gene in lymphoma. EMBO J. 1988;7:123-131[Medline] [Order article via Infotrieve]. 2. McDonnell TJ, Deane N, Platt FM, et al. bcl-2-immunoglobulin transgenic mice demonstrate extended B cell survival and follicular lymphoproliferation. Cell. 1989;57:79-88[Medline] [Order article via Infotrieve].
3.
Tsujimoto Y, Yunis J, Onorato-Showe L, et al.
Molecular cloning of the chromosomal breakpoint of B-cell lymphomas and leukemias with the t(11;14) chromosome translocation.
Science.
1984;224:1403-1406 4. Bakhshi A, Jensen JP, Goldman P, et al. Cloning the chromosomal breakpoint of t(14;18) human lymphomas: clustering around JH on chromosome 14 and near a transcriptional unit on 18. Cell. 1985;41:899-906[Medline] [Order article via Infotrieve].
5.
Tsujimoto Y, Gorham J, Cossman J, Jaffe E, Croce CM.
The t(14;18) chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ joining.
Science.
1985;229:1390-1393
6.
Cleary ML, Sklar J.
Nucleotide sequence of a t(14;18) chromosomal breakpoint in follicular lymphoma and demonstration of a breakpoint-cluster region near a transcriptionally active locus on chromosome 18.
Proc Natl Acad Sci U S A.
1985;82:7439-7443
7.
Bakhshi A, Wright JJ, Graninger W, et al.
Mechanism of the t(14;18) chromosomal translocation: structural analysis of both derivative 14 and 18 reciprocal partners.
Proc Natl Acad Sci U S A.
1987;84:2396-2400 8. Tsujimoto Y, Louie E, Bashir MM, Croce CM. The reciprocal partners of both the t(14;18) and the t(11;14) translocations involved in B-cell neoplasms are rearranged by the same mechanism. Oncogene. 1988;2:347-351[Medline] [Order article via Infotrieve].
9.
Cotter F, Price C, Zucca E, Young BD.
Direct sequence analysis of the 14q+ and 18q- chromosome junctions in follicular lymphoma.
Blood.
1990;76:131-135
10.
Wyatt RT, Rudders RA, Zelenetz A, Delellis RA, Krontiris TG.
BCL2 oncogene translocation is mediated by a chi-like consensus.
J Exp Med.
1992;175:1575-1588 11. Meijerink JP, Raemaekers JM, Mensink EJ. New type of t(14;18) in a non-Hodgkin's lymphoma provides insight in molecular events in early B-cell differentiation. Br J Haematol. 1995;91:630-639[Medline] [Order article via Infotrieve]. 12. Stamatopoulos K, Kosmas C, Belessi C, et al. t(14;18) chromosomal translocation in follicular lymphoma: an event occurring with almost equal frequency both at the D to J(H) and at later stages in the rearrangement process of the immunoglobulin heavy chain gene locus. Br J Haematol. 1997;99:866-872[Medline] [Order article via Infotrieve]. 13. Lewis SM. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses. Adv Immunol. 1994;56:27-150[Medline] [Order article via Infotrieve]. 14. Gellert M. Recent advances in understanding V(D)J recombination. Adv Immunol. 1997;64:39-64[Medline] [Order article via Infotrieve].
15.
Crescenzi M, Seto M, Herzig GP, et al.
Thermostable DNA polymerase chain amplification of t(14;18) chromosome breakpoints and detection of minimal residual disease.
Proc Natl Acad Sci U S A.
1988;85:4869-4873
16.
Gauwerky CE, Haluska FG, Tsujimoto Y, Nowell PC, Croce CM.
Evolution of B-cell malignancy: pre-B-cell leukemia resulting from MYC activation in a B-cell neoplasm with a rearranged BCL2 gene.
Proc Natl Acad Sci U S A.
1988;85:8548-8552 17. Lewis SM, Agard E, Suh S, Czyzyk L. Cryptic signals and the fidelity of V(D)J joining. Mol Cell Biol. 1997;17:3125-3136[Abstract]. 18. Corbett SJ, Tomlinson IM, Sonnhammer EL, Buck D, Winter G. Sequence of the human immunoglobulin diversity (D) segment locus: a systematic analysis provides no evidence for the use of DIR segments, inverted D segments, "minor" D segments or D-D recombination. J Mol Biol. 1997;270:587-597[Medline] [Order article via Infotrieve].
19.
Yamada M, Wasserman R, Reichard BA, et al.
Preferential utilization of specific immunoglobulin heavy chain diversity and joining segments in adult human peripheral blood B lymphocytes.
J Exp Med.
1991;173:395-407
20.
Landau NR, Schatz DG, Rosa M, Baltimore D.
Increased frequency of N-region insertion in a murine pre-B-cell line infected with a terminal deoxynucleotidyl transferase retroviral expression vector.
Mol Cell Biol.
1987;7:3237-3243
21.
Kallenbach S, Doyen N, Fanton DA, Rougeon F.
Three lymphoid-specific factors account for all junctional diversity characteristic of somatic assembly of T-cell receptor and immunoglobulin genes.
Proc Natl Acad Sci U S A.
1992;89:2799-2803
22.
Gilfillan S, Dierich A, Lemeur M, Benoist C, Mathis D.
Mice lacking TdT: mature animals with an immature lymphocyte repertoire.
Science.
1993;261:1175-1178
23.
Komori T, Okada A, Stewart V, Alt FW.
Lack of N regions in antigen receptor variable region genes of TdT- deficient lymphocytes.
Science.
1993;261:1171-1175 24. Zhang Y, Cado D, Asarnow DM, et al. The role of short homology repeats and TdT in generation of the invariant gamma delta antigen receptor repertoire in the fetal thymus. Immunity. 1995;3:439-447[Medline] [Order article via Infotrieve]. 25. Ezekiel UR, Sun T, Bozek G, Storb U. The composition of coding joints formed in V(D)J recombination is strongly affected by the nucleotide sequence of the coding ends and their relationship to the recombination signal sequences. Mol Cell Biol. 1997;17:4191-4197[Abstract].
26.
Roth DB, Wilson JH.
Nonhomologous recombination in mammalian cells: role for short sequence homologies in the joining reaction.
Mol Cell Biol.
1986;6:4295-4304 27. Feeney AJ, Victor KD, Vu K, Nadel B, Chukwuocha RU. Influence of the V(D)J recombination mechanism on the formation of the primary T and B cell repertoires. Semin Immunol. 1994 |