|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 11 (June 1), 2000:
pp. 3548-3554
PHAGOCYTES
Interferon-gamma improves splicing efficiency of CYBB gene
transcripts in an interferon-responsive variant of chronic
granulomatous disease due to a splice site consensus region
mutation
Antonio Condino-Neto and
Peter E. Newburger
From the Department of Pediatrics and Center for Investigation in
Pediatrics, State University of Campinas Medical School, Campinas,
São Paulo, Brazil; and the Department of Pediatrics and Cancer
Center, University of Massachusetts Medical School, Worcester, MA.
 |
Abstract |
X-linked chronic granulomatous disease (CGD) derives from defects in
the CYBB gene, which encodes the gp91-phox component of
NADPH oxidase. We studied the molecular basis of the disease in a
kindred with variant CGD, due to a single base substitution at the
sixth position of CYBB first intron. The patients' phagocytes have been shown previously to greatly increase superoxide release in
response to interferon-gamma (IFN- ) in vitro and in vivo. We
examined CYBB gene expression in an Epstein-Barr virus
(EBV)-transformed B-cell line from 1 patient in this kindred. These
cells showed markedly decreased levels of CYBB transcripts in
total RNA (5% of normal) and nuclear RNA (1.4% of normal), despite
equal CYBB transcription rates in the CGD and control cells.
Incubation with IFN- produced a 3-fold increase in CYBB
total messenger RNA (mRNA) levels in the patient's cells, and
decreased nuclear transcripts to undetectable levels. Reverse
transcriptase-polymerase chain reaction analysis of RNA splicing
revealed a preponderance of unspliced CYBB transcripts in the
patient's nuclear RNA. In vitro incubation with IFN- increased by
40% the ratio of spliced relative to unspliced CYBB mRNA in
nuclei from the CGD B-cell line. Total RNA harvested from the same
patient's monocytes, on and off therapy with IFN-, showed a similar
improvement in splicing. We conclude that IFN- partially corrects a
nuclear processing defect due to the intronic mutation in the
CYBB gene in this kindred, most likely by augmentation of
nuclear export of normal transcripts, and improvement in the fidelity
of splicing at the first intron.
(Blood. 2000;95:3548-3554)
© 2000 by The American Society of Hematology.
| |
Introduction |
Chronic granulomatous disease (CGD) is a hereditary
disorder of host defense due to defective activity of a phagocyte NADPH oxidase that generates superoxide and related toxic oxygen metabolites necessary for microbial killing.1,2 Patients usually
present early in life with multiple, sometimes fatal, pyogenic
infections.3
The NADPH oxidase enzyme system responsible for superoxide generation
forms a small transmembrane electron transport system that results in
the oxidation of NADPH on the cytoplasmic surface and the generation of
superoxide on the outer surface of the membrane, which becomes the
inner surface of the phagosome on invagination during
phagocytosis.2,4 The terminal electron donor to oxygen is a
unique, low midpoint potential flavocytochrome, termed cytochrome b558 for its absorption peak at 558 nm.5 The heterodimeric molecule combines a 91-kd
glycoprotein, termed gp91-phox, for phagocyte oxidase, and a
22-kd nonglycosylated polypeptide (termed p22-phox).6,7 The CYBB gene that encodes
gp91-phox was one of the first to be identified by positional
cloning6 after chromosomal localization to Xp21.1; it
encompasses 13 exons spanning approximately 30 kilobases (kb) of
genomic DNA.8 CGD kindreds with defects in the
gp91-phox component thus show X-linked inheritance and, in most
cases, the cytochrome b558 is reduced or absent in their phagocytes. The rarer autosomal recessive forms9 of
CGD derive from defects in genes encoding p22-phox and 2 cytosolic components of the oxidase complex: p47-phox and
p67-phox.2,4
Diverse molecular defects producing X-linked CGD have been identified
within the coding region and intron boundaries of the CYBB
gene; such mutations include large multigene deletions, smaller deletions and insertions, missense and nonsense substitutions, and
splicing defects.9,10 Splice site mutations occur at or near the splice junction and, in most cases, result in a typical CGD
phenotype with no NADPH oxidase expression.9-11 However,
they can also lead to the less common and clinically less severe
"variant" form of CGD, usually characterized by a uniform
population of neutrophils that exhibit a low level of oxidase activity,
roughly proportional to the level of cytochrome
b558 expressed.9,10,12,13
We investigated the molecular basis of the variant X-linked CGD
phenotype and response to interferon gamma (IFN-) in a kindred with
a genomic DNA mutation recently identified as a single base substitution at the sixth position of CYBB gene first intron: ATT/gtaagt
ATT/gtaagc.9,14 This kindred has previously been shown to have phagocytes that are unusually responsive to IFN-, which nearly corrects the oxidase defect in vitro and in
vivo.15,16 The current studies indicate that the dramatic effect of IFN- treatment in this kindred is largely due to
posttranscriptional molecular mechanisms, including an increase of
nuclear export of CYBB transcripts and improvement in the
fidelity of splicing at the first intron.
| |
Materials and methods |
Subjects
Peripheral blood samples for cell culture and monocyte preparation
were obtained from the patient and from healthy
volunteers. The University of Massachusetts Medical Center Committees
on Protection of Human Subjects in Research approved all procedures and
consent forms.
Cell preparation
Epstein-Barr virus (EBV)-transformed B lymphocytes were developed
from peripheral blood mononuclear cells of healthy donors and from the
patient with variant X-linked CGD. To initiate B-lymphocyte cultures,
peripheral blood was fractionated by Ficoll-Hypaque centrifugation17 and the mononuclear cells were cultured
with supernatants from B95-8, an EBV-producer cell
line.18,19 After EBV-transformation, B lymphocytes from
healthy donors or from the patient with CGD were cultured in RPMI 1640 medium supplemented with 10% heat inactivated fetal bovine serum, 2 mmol/L L-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin,
at 37°C in a humid atmosphere with 5% CO2. To examine
the effects of cytokines, EBV-transformed B lymphocytes were cultured
for 7 days with human recombinant IFN- (100 U/mL), tumor necrosis
factor-alpha (TNF- b 1000 U/mL), alone or in combination. These
cytokines were chosen because they have well-characterized receptors
and transduction mechanisms in B lymphocytes,20,21 and are
strong stimulators of the NADPH oxidase system in phagocytic cell
lines.22-24 In addition, the phagocytes of this CGD kindred
show a dramatic response to IFN- both in vitro and in
vivo.15,16 Cell counts and viability, monitored on a daily
basis, were always above 90%.
RNA from the monocytes of the patient with CGD was generously provided
by Dr R. A. B. Ezekowitz. Monocytes were isolated as adherent
cells from the peripheral blood mononuclear cells of the patient
with variant X-linked CGD, before and after IFN- therapy,25 as previously described.15,16
Structure of RNA transcripts
The kindred's entire CYBB gene coding region and proximal
5' flanking region has previously been shown to have a normal
structure by the analysis of single strand conformation
polymorphisms9 and by complementary DNA (cDNA) sequencing
(R. A. B. Ezekowitz and P. E. Newburger, unpublished data). We
restudied the patient's transcripts in the regions neighboring the
affected intron, using polymerase chain reaction (PCR) amplification of
cDNA produced by reverse transcription (RT) of total RNA, isolated by
the guanidine HCl method26 from the CGD and B-cell lines.
Reverse transcription was performed with SuperScript II RT (GIBCO BRL,
Gaithersburg, MD) from random hexamer primers. The cDNA was amplified
by a 2-stage nested PCR, with forward primers corresponding to
nucleotides 334 (5'3') and 3264
(5'3') and reverse primers corresponding to nucleotides
572540 (3'5') and 537503 (3'5') of
CYBB cDNA sequence (GenBank accession number x04011). The
resultant PCR products were analyzed on agarose gels stained with
ethidium bromide, extracted from gels, subcloned into pBluescript
(Stratagene, La Jolla, CA), and sequenced by the ABI PRISM Dye
Terminator Cycle Sequencing method (Perkin Elmer, Foster City, CA).
Gene expression studies
Northern blot analysis of total cell RNA, extracted from
EBV-transformed B lymphocytes by the guanidine HCl
method,26 was performed according to standard
procedures.27 Hybridization probes were full-length cDNAs
for the human CYBB6 and NCF128 genes, encoding gp91-phox and p47-phox, respectively.
The procedures for sequential cycles of filter stripping and reprobing
were performed as previously described.29 Equal loading of
lanes was demonstrated by the examination of gels after ethidium
bromide staining and by rehybridization with a 5.8-kilobase (kb)
HindIII restriction fragment of rat 18S ribosomal
cDNA.30 Positive control RNA was obtained from HL-60 cells
differentiated with dimethyl formamide, and negative control RNA from
HeLa cells.24,31 Levels of message in CGD cells were
measured quantitatively by a computer analysis of phosphorimager data
and compared with normal cells. We have found that the oxidase
component p47-phox is expressed in parallel with
gp91-phox in EBV-transformed B cells, phagocyte cell lines, and
monocyte-derived macrophages22,32; so levels of the
p47-phox transcript served as a reference for comparison of the
gp91-phox hybridization signals from the CGD and normal
EBV-transformed B cell lines.
The transcription rates of genes encoding gp91-phox, and
p47-phox were assessed by nuclear run-on assays, with minor
modifications of previously published procedures.33
Briefly, EBV-transformed B-lymphocyte nuclei were isolated by cell
lysis in 0.05% Nonidet P-40. Freshly prepared nuclei were incubated 30 minutes at 30°C in a reaction mixture that contained
[32P]UTP (9.25 MBq [250 µCi], 1.11 × 1014 Bq/mmol [3000 Ci/mmol]) in buffer
modified from Greenberg et al33 by the addition of 0.8 mmol/L MnCl2. Newly synthesized RNA was prepared by
guanidine extraction and ethanol precipitation.26 Equal
amounts of incorporated label from each group
(1-2 × 107 cpm) were then hybridized to saturating
amounts of cDNA probes, immobilized on filters by slot blotting. The
probes used in these experiments included cDNAs for the genes encoding
gp91-phox6 and
p47-phox,28 a hybridization negative control
(plasmid without insert), and a constitutively expressed gene
( -actin or -tubulin).22,32,34 We calculated relative
rates of transcription by a computer analysis of phosphorimager data.
Reverse transcription-polymerase chain reaction
The cDNA from the CYBB gene encoding gp91-phox was
produced by RT of total and nuclear RNA, isolated by standard
procedures from the EBV-transformed patient or normal B-cell lines.
Total monocyte RNA (kindly provided by Dr R. A. B. Ezekowitz) was
similarly isolated from the patient's peripheral blood monocytes, both
before and during therapy, with recombinant human IFN-, 50 µg/m2 injected subcutaneously 3 times per
week.25 RT was performed with SuperScript II RT (GIBCO BRL)
from random hexamer primers. The cDNA was amplified by a single-step
PCR with the following primers: CYBB cDNA nucleotides 3256
(5'3') and 634600 (3'5'); also
913932 (5'3') and 11631144 (3'5');
and -actin (GenBank accession number NM001101) cDNA nucleotides
920943 (5'3') and 14941471 (3'5').
For CYBB gene splicing studies, RT-PCR analysis compared the
products of amplification from transcripts in which the first intron
had been spliced versus those in which it had remained unspliced. The
spliced transcript was amplified using primers corresponding to
CYBB cDNA nucleotides 2852 (5'3') (exon 1) and 407381 (3'5') (exon 5). The unspliced transcript
was amplified using primers corresponding to CYBB cDNA
nucleotides 2852 (5'3') (exon 1), and intron 1 nucleotides 226200 (3'5')
(CCTCCTAGGAATTCAGAAGTAAGCTAG; intron sequence kindly provided by Dr S. H. Orkin).
The semiquantitative PCR was performed by amplifying serial dilutions
of cDNA preparations at successive cycle numbers to obtain conditions
for linear amplification of target cDNAs. Such conditions for
CYBB transcripts were generally 35 cycles (monocyte cDNA) to 40 cycles (B cell cDNA), with normal cDNA diluted 1:20 and CGD cDNA
undiluted or 1:2; for -actin transcripts, 25 cycles for all cDNAs,
with no dilution necessary. PCR products were analyzed by agarose gel
electrophoresis and ethidium bromide staining, and quantitated by
digital photography and computer analysis with Molecular Analyst
software (Bio-Rad). Levels of CYBB transcripts were adjusted
for cDNA dilutions and normalized to -actin signals from the same
cDNA preparations.
Statistics
Results are represented as mean ± SD. The Wilcoxon rank sum test
(Mann-Whitney U test) or the paired Student t test
for matched pairs were used for comparisons between
groups35; P < .05 was considered significant.
| |
Results |
Molecular analysis of the genomic DNA of the X-linked CGD patient
has previously revealed a single base substitution,
ATT/gtaagt ATT/gtaagc,9,14 at the sixth position
of first intron in the CYBB gene, which encodes the
gp91-phox component of the phagocyte NADPH
oxidase.6 Our first hypotheses predicted that this mutation
would produce abnormal splicing with both exon skipping and normal
product, as previously noted with abnormalities of intron sequences
distal to the splice site, both in CYBB and other genes.9,36-41 To investigate the nature of the mutant
CYBB transcripts, we amplified the cDNA of the X-linked CGD
patient by RT-PCR, followed by subcloning and sequencing. No structural
changes were detected in or near the first or second exons of the
gp91-phox transcript of the X-linked CGD patient (results
not shown).
We next examined CYBB gene expression, using patient and normal
EBV-transformed B-cell lines as a model system.19,42 Figure 1 shows a representative Northern blot
(above) and a graphical analysis of 4 such experiments (below). These
data demonstrate that IFN- (100 U/mL) and TNF- (1000 U/mL)
increased the expression of gp91-phox gene 1.7- to 4.5-fold in
both the patient's and the normal cells (P < .05 in all
situations, n = 4, Mann-Whitney U test). The cytokines
also increased the expression of p47-phox gene, an unaffected
component of the NADPH oxidase system, but did not reach statistical
significance (P > .05 in all situations, n = 4,
Mann-Whitney U test). The expression of gp91-phox
was 6- to 13-fold higher in the normal cells compared with the
patient's cells in basal conditions or after cytokine stimulation
(P < .05 in all situations, n = 4, Mann-Whitney
U test). A synergistic response occurred when the patient's
cells were cultured with IFN- and TNF- in combination.
View larger version (44K):
[in this window]
[in a new window]
| Fig 1.
Northern blot of mRNA transcripts encoding
gp91-phox and p47-phox.
Each lane contains 10 µg total RNA from IFN--differentiated HL-60
cells, normal, and CGD B-cell lines, or HeLa cells, as indicated above.
The autoradiograph shows a representative blot successively probed with
32P-labeled cDNAs encoding gp91-phox,
p47-phox, and (as a control for equal loading of lanes) 18S
rRNA, as indicated in the left margin. The EBV-transformed B-cell lines
were cultured in control conditions or in the presence of IFN- (100 U/mL), TNF- (1000 U/mL), alone or in combination for 7 days, as
indicated in the top margin.
|
|
Nuclear run-on assays (Figure 2) were
performed to investigate any impairment in the transcription of the
patient's CYBB gene that could account for its low expression.
These experiments showed similar transcription rates of the
CYBB and NCF1 genes encoding, respectively,
gp91-phox and p47-phoxin both the CGD patient's and
the normal cell lines (Figure 2, P > .05 in all situations, n = 3, Mann-Whitney U test). IFN- (100 U/mL) and
TNF- (1000 U/mL) enhanced the transcription rates of these genes by
10% to 15% in both the CGD patient's and the normal cell lines, but
the changes did not reach statistical significance (P > .05
in all situations, n = 3, Mann-Whitney U test).
-Tubulin and -actin transcription rates were not affected by
these cytokines (P > .05 in all situations, n = 3,
Mann-Whitney U test).
View larger version (62K):
[in this window]
[in a new window]
| Fig 2.
Transcription rates of genes encoding gp91-phox,
and p47-phox in CGD patient's and normal B-cell lines.
Upper panel: Representative nuclear run-on assay showing transcription
rates of genes encoding gp91-phox (CYBB), and
p47-phox (NCF1) in CGD and normal B cell lines. Lower
panel: Graph representing compiled data from 3 experiments; columns
indicate means and error bars show SDs. EBV-transformed B cells were
cultured under control conditions or with IFN- (100 U/mL) and
TNF- (1000 U/mL) for 7 days. The negative control lanes contain
pBluescript plasmid alone. Genes encoding -tubulin and -actin
were included as transcriptionally constitutive controls.
|
|
Using the semiquantitative RT-PCR techniques, we performed more
detailed analyses of CYBB transcript abundance, distribution, and splicing. Figure 3 shows a
representative image of the PCR products in an ethidium bromide-stained
gel (above) and a graphical analysis of image intensity from 4 such
experiments (below). The digital camera data showed markedly decreased
levels of gp91-phox messenger RNA (mRNA), normalized to
-actin transcripts, in both total (5% of normal) and nuclear (1.4%
of normal) RNA preparations from patient-derived cells compared with
normal cells. In vitro treatment of the CGD cells with IFN- (Figure
3) increased the level of gp91-phox transcripts 3-fold in total
RNA (P < .05, n = 3, Mann-Whitney U test),
while decreasing the amount of gp91-phox transcripts in the
nuclear RNA preparations to undetectable levels.
View larger version (63K):
[in this window]
[in a new window]
| Fig 3.
RT-PCR analysis of gp91-phox transcripts in total
cell and nuclear RNA preparations.
RT-PCR products of gp91-phox transcripts from the normal (Nl)
or CGD patient's EBV-transformed B-cell lines, cultured with or
without IFN-, as indicated (+IFN). Upper panel: Representative
agarose electrophoresis gels, stained with ethidium bromide, of RT-PCR
products from the RNA sources indicated below the image. Primers
corresponded to cDNAs encoding gp91-phox or -actin, as
indicated in the left margin; size markers are indicated in the right
margin. Lower panel: Graph representing compiled data from 3 experiments. Band intensity was quantitated by digital photography and
computer analysis with Molecular Analyst software. Data are expressed
as percentage expression relative to gp91-phox transcript
levels in normal total cellular RNA, adjusted for -actin signals;
columns indicate means and error bars show SDs.
|
|
The RT-PCR analysis of RNA splicing used a forward primer in the first
exon and alternative reverse primers in the fifth exon (to detect
spiced mRNA) or the first intron (to detect unspliced mRNA), as
illustrated in Figure 4. Comparison of the
ratios of spliced to unspliced gp91-phox transcripts in the
normal and the CGD patient-derived B-cell lines revealed slightly more
unspliced than spliced transcripts in the patient's nuclear RNA (0.9 spliced/unspliced ratio), in contrast to a predominance of spliced
transcripts in normal nuclear RNA (1.8 spliced/unspliced ratio), as
shown in Figure 5. In vitro incubation with
IFN- increased the amount of spliced relative to unspliced mRNA by
40% in the CGD B-cell line nuclei (P < .05, n = 4,
Mann-Whitney U test).
View larger version (19K):
[in this window]
[in a new window]
| Fig 4.
Diagram of methodology for mRNA splicing analysis by
RT-PCR.
A forward primer in the first exon and alternative reverse primers in
the first intron or the fifth exon amplified products of different
sizes, as indicated below the figure (bp = base pairs). The spliced
transcript was amplified using a forward primer (FP) corresponding to
gp91-phox cDNA exon 1 nucleotides 2852 (5'3')
and a reverse primer (RP) corresponding to exon 5 nucleotides 407381
(3'5'). The unspliced product was detected by the same
forward primer, coupled with a reverse primer corresponding to intron 1 nucleotides 226200 (3'5').
|
|
View larger version (53K):
[in this window]
[in a new window]
| Fig 5.
The effect of IFN- on splicing of nuclear CYBB
transcripts in CGD and normal B-cell lines.
RT-PCR products of CYBB nuclear mRNA amplification performed
with a forward primer in the first exon and alternative reverse primers
in the fifth exon or the first intron (as diagramed in Figure 4)
detect, respectively, spliced (S) and unspliced (U) transcripts from
nuclei prepared from normal (Nl) or CGD B-cell lines, incubated with
(+IFN) or without IFN-. Upper panel: Representative ethidium
bromide-stained agarose gel of RT-PCR products from the RNA sources
indicated below the image; size markers are shown in the right margin.
Lower panel: Graph representing compiled data from 3 experiments. Band
intensity was quantitated by digital photography and computer analysis
with Molecular Analyst software. Data are expressed as the ratio of
spliced to unspliced products; columns represent means and error bars
show SDs.
|
|
The total RNA from peripheral blood monocytes (Figure
6), harvested from the same CGD patient, on
and off therapy with IFN-, showed a similar improvement, with a 47%
increase in the ratio of spliced to unspliced message
(P < .05, n = 3, paired Student t test). The
nuclear RNA preparations could not be performed because of limitations
on the frequency and volume of blood collections from a patient.
View larger version (55K):
[in this window]
[in a new window]
| Fig 6.
The effect of IFN- on splicing of CYBB
transcripts in total cellular RNA from the CGD patient's peripheral
blood monocytes.
RT-PCR products amplified from total RNA extracted from peripheral
blood monocytes harvested from the same patient on and off therapy with
IFN-. Upper panel: Representative ethidium bromide-stained agarose
gel of RT-PCR products from the RNA sources indicated below the image;
size markers are shown in the right margin. Lower panel: Graph
representing compiled data from 3 experiments. Labeling as in Figure
5.
|
|
| |
Discussion |
The X-linked CGD derives from defects in the CYBB gene,
which encodes the gp91-phox component of the NADPH
oxidase.1,2 The propositus has a variant form of X-linked
CGD, due to a single base substitution in the first intron of
CYBB gene.9,14 His phagocytes show a dramatic
increase in superoxide release and cytochrome b levels in
response to IFN- in vitro or in vivo.15,16 Mutations at
splice junctions interfere with RNA processing and usually result in
multiple splicing products, including both normal transcripts and mRNA
species that are nonfunctional because of exon skipping or diminished
RNA stability.9,36-41
Our results in this CGD kindred show that the mutation, located 6 nucleotides downstream from the first splice site of the CYBB
gene, did not cause any structural changes in the transcript, as
demonstrated by the PCR analysis and the sequencing of the cDNA.
However, the mutation caused an impairment in the CYBB gene expression, as demonstrated by the Northern blot and RT-PCR analysis. Transcription rates were equal in the nuclear run-on assays for both
normal and CGD EBV-transformed B cells, indicating that the low levels
of CYBB transcripts reflect instability rather than decreased
synthesis. Both the nuclear and the cytoplasmic transcript levels are
markedly diminished, indicating increased degradation in the nucleus;
the relative preservation of CYBB transcript levels in the
total RNA suggests that they are more stable once exported to the
cytoplasm. The proportions of spliced and unspliced mRNA indicate a
failure to process the nuclear pre-mRNA, most likely at the mutated
splicing region in the first intron. Thus, the intronic mutation
appears to interfere with the normal splicing process, and hence leads
to low gp91-phox expression and the phenotype of variant
X-linked CGD.
Most notably, in vitro incubation with IFN- increased the ratio of
spliced relative to unspliced CYBB transcripts in nuclei from
the B-cell line of the patient with CGD. A less dramatic but similar
improvement in the splicing defect occurred in vivo, shown in the
proportions of spliced and unspliced transcripts in the total RNA
isolated from the patient's peripheral blood monocytes before and
during therapy with IFN-. Thus, in this kindred, IFN- may improve
cytochrome b558 levels and partially correct the
CGD phenotype by increasing the rate of splicing at the CYBB
first intron, which thus allows the nuclei to export greater quantities
of the spliced mRNA to be translated into gp91-phox, the normal
protein product.
These results provide a molecular basis for our previous observations
of IFN- induction of the CYBB gene expression in this kindred.15,16,43 Previous studies of these patients with
variant X-linked CGD have shown phagocyte superoxide production at 5% to 10% normal rates, with corresponding levels of cytochrome
b13; they show an unusual, dramatic increase in
these measures in response to IFN-, both in vitro and in
vivo.15,16 This response derives at least in part from an
enhancement on the expression of CYBB gene, as demonstrated in
both previous15,16 and current experiments. In contrast,
most patients with CGD show no biochemical or molecular response to
IFN-,44 despite demonstrated clinical
efficacy.25,45
Previous studies of the current CGD kindred demonstrated larger
increases in the cytochrome b558 protein levels,
and still greater rises in superoxide generation and bacterial killing, compared with the magnitude of change in mRNA encoding the
gp91-phox component.15,16,43 As might be expected
from a multicomponent system, NADPH oxidase activity does not strictly
correlate with the amount of any single component.15,16,46
In addition, further posttranslational mechanisms could contribute to
the activation of the NADPH oxidase system and hence, the quantitative
differences between the cytochrome b558 content and
the NADPH oxidase activity results.47-50 Thus, the
physiological responses observed in these patients probably derives in
part from the change in splicing reported here, with a major additional
contribution from the functional amplification provided by the partial
restoration of a missing component to an otherwise competent, or even
primed, system.
The model system of EBV-transformed B lymphocytes has some limitations
because of the relatively low transcriptional expression of genes
encoding components of the NADPH oxidase system, compared with
monocytes or phagocytic cell lines.32 Studies of
cytokine-mediated gene regulation in granulocytes and monocyte-derived
macrophages,23,24 human monocytic THP-1
cells,22 and human myeloid leukemia cells51 have demonstrated synergistic induction of CYBB expression by IFN- and TNF- that was at least in part transcriptional. Thus, unlike the EBV-transformed B-cell lines, cells in the monocytic-myeloid lineage probably up-regulate gp91-phox expression in response to IFN- by both transcriptional and posttranscriptional mechanisms.
Interferon- has previously been reported to augment expression of
several other genes by increasing both transcription rates and mRNA
stability. Examples include human Clara cell secretory protein
production by human epithelial cells,52 synthesis of complement components in monocytes and fibroblasts,53-55
expression of intercellular adhesion molecule 1 in
fibroblasts56 and monocytes,57 and TNF-
generation in macrophages.58 The effect of IFN- on CYBB splicing has some precedent in previously reported
cytokine effects on alternative splicing of transcripts encoding
Trp-tRNA synthetase.59
The effect of IFN- on expression of the gp91-phox gene in
phagocytes from patients with X-linked CGD15 provided, in
part, the basis for the clinical use of IFN- for prevention of
infection in CGD.25 However, the large majority of patients
appear to benefit clinically from other, unknown mechanisms of IFN-
action, because most do not show a change in oxidase
activity.44 The current studies demonstrate a new mechanism
by which IFN- can up-regulate CYBB gene expression and may
explain in part its unusually dramatic biochemical effect in this kindred.
| |
Acknowledgments |
We thank Drs. John Curnutte and Alan Ezekowitz for sharing data,
materials, and helpful discussions; we thank Constance Whitney and
Carolyn Padden for excellent technical assistance.
| |
Footnotes |
Submitted October 21, 1999; accepted February 2, 2000.
Supported by Brazil's Conselho Nacional de Desenvolvimento
Científico e Tecnolólogico grant 200955/95-0,
Fundação de Amparo à Pesquisa do Estado de São
Paulo grant 96/11666-2, and State University of Campinas Medical School
in house grant; by US National Institutes of Health grants DK54369 and
TW00883; and by an award from the Howard Hughes Medical Institute to
the University of Massachusetts Medical School under the Research
Resources Program for Medical Schools.
Reprints: Peter E. Newburger, Department of Pediatrics,
University of Massachusetts Medical School, 373 Plantation St,
Worcester, MA 01605; e-mail: peter.newburger{at}umassmed.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1. Dinauer MC, Nauseef WM, Newburger PE. Inherited disorders of phagocyte
killing. In: Scriver CR, Beaudet AL, Sly WS, Valle D, Childs B,
Vogelstein B, eds. The Metabolic and Molecular Basis of Inherited
Disease. 8th ed. New York, NY: McGraw-Hill. In press.
2.
Malech HL, Nauseef WM.
Primary inherited defects in neutrophil function: etiology and treatment.
Semin Hematol.
1997;34:279-290[Medline]
[Order article via Infotrieve].
3.
Thrasher AJ, Keep NH, Wientjes F, Segal AW.
Chronic granulomatous disease.
Biochim Biophys Acta Mol Basis Dis.
1994;1227:1-24[Medline]
[Order article via Infotrieve].
4.
Dinauer MC.
The phagocyte system and disorders of granulopoiesis and granulocyte function. In:
Nathan DG,Orkin ST, eds.
Hematology of Infancy and Childhood. Philadelphia, PA: WB Saunders; 1998:889-920.
5.
Segal AW, Cross AR, Garcia RC, et al.
Absence of cytochrome b245 in chronic granulomatous disease: a multicenter European evaluation of its incidence and relevance.
N Engl J Med.
1983;308:245-251[Abstract].
6.
Royer-Pokora B, Kunkel LM, Monaco AP, et al.
Cloning the gene for an inherited disorderchronic granulomatous diseaseon the basis of its chromosomal location.
Nature.
1986;322:32-38[Medline]
[Order article via Infotrieve].
7.
Parkos CA, Dinauer MC, Walker LE, Allen RA, Jesaitis AJ, Orkin SH.
The primary structure and unique expression of the 22 kilodalton light chain of human neutrophil cytochrome b.
Proc Natl Acad Sci U S A.
1988;85:3319-3323[Abstract/Free Full Text].
8.
Skalnik DG, Strauss EC, Orkin SH.
CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter.
J Biol Chem.
1991;266:16,736-16,744[Abstract/Free Full Text].
9.
Rae J, Newburger PE, Dinauer MC, et al.
X-linked chronic granulomatous disease: mutations in the CYBB gene encoding the gp91-phox component of the respiratory burst oxidase.
Am J Hum Genet.
1998;62:1320-1331[Medline]
[Order article via Infotrieve].
10.
Roos D, de Boer M, Kuribayashi F, et al.
Mutations in the X-linked and autosomal recessive forms of chronic granulomatous disease.
Blood.
1996;87:1663-1681[Free Full Text].
11.
De Boer M, Bolscher BGJM, Dinauer MC, et al.
Splice site mutations are a common cause of X-linked chronic granulomatous disease.
Blood.
1992;80:1553-1558[Abstract/Free Full Text].
12.
Lew PD, Southwick FS, Stossel TP, Whitin JC, Simons ER, Cohen HJ.
A variant of chronic granulomatous disease: deficient oxidative metabolism due to a low-affinity NADPH oxidase.
N Engl J Med.
1981;305:1329-1333[Medline]
[Order article via Infotrieve].
13.
Newburger PE, Luscinskas FW, Ryan T, et al.
Variant chronic granulomatous disease: modulation of the neutrophil defect by severe infection.
Blood.
1986;68:914-919[Abstract/Free Full Text].
14.
Condino-Neto A, Rae J, Padden C, Whitney C, Curnutte JT, Newburger PE.
An intronic mutation in CYBB gene leading to RNA instability and variant X-linked chronic granulomatous disease [abstract].
Blood.
1997;90:599.
15.
Ezekowitz RAB, Orkin SH, Newburger PE.
Recombinant interferon gamma augments phagocyte superoxide production and X-chronic granulomatous disease gene expression in X-linked variant chronic granulomatous disease.
J Clin Invest.
1987;80:1009-1016.
16.
Ezekowitz RAB, Dinauer MC, Jaffe HS, Orkin SH, Newburger PE.
Partial correction of the phagocyte defect in patients with X-linked chronic granulomatous disease by subcutaneous interferon gamma.
N Engl J Med.
1988;319:146-151[Abstract].
17.
Boyum A.
Isolation of mononuclear cells and granulocytes from human blood.
Scand J Clin Lab Invest.
1968;21(suppl 97):1-77.
18.
Nilsson K, Klein G, Henle W, Henle G.
The establishment of lymphoblastoid cell lines from adult and fetal human lymphoid tissue and its dependence on EBV.
Int J Cancer.
1971;8:443-450[Medline]
[Order article via Infotrieve].
19.
Volkman DJ, Buescher ES, Gallin JI, Fauci AS.
B cell lines as models for inherited phagocytic diseases: superoxide generation in chronic granulomatous disease and granules in Chediak-Higashi syndrome.
J Immunol.
1984;133:3006-3009[Abstract].
20.
Corcione A, Ottonello L, Tortolina G, et al.
Recombinant tumor necrosis factor enhances the locomotion of memory and naive B lymphocytes from human tonsils through the selective engagement of the type II receptor.
Blood.
1997;90:4493-4501[Abstract/Free Full Text].
21.
Jouanguy E, Lamhamedi-Cherradi S, Altare F, et al.
Partial interferon-gamma receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guerin infection and a sibling with clinical tuberculosis.
J Clin Invest.
1997;100:2658-2664[Medline]
[Order article via Infotrieve].
22.
Condino-Neto A, Whitney C, Newburger PE.
Dexamethasone but not indomethacin down-regulates the human NADPH oxidase by inhibiting the expression of genes encoding components of the NADPH oxidase system.
J Immunol.
1998;161:4960-4967[Abstract/Free Full Text].
23.
Newburger PE, Dai Q, Whitney C.
In vitro regulation of human phagocyte cytochrome b heavy and light chain gene expression by bacterial lipopolysaccharide and recombinant human cytokines.
J Biol Chem.
1991;266:16,171-16,177[Abstract/Free Full Text].
24.
Newburger PE, Ezekowitz RAB, Whitney C, Wright J, Orkin SH.
Induction of phagocyte cytochrome b heavy chain gene expression by interferon gamma.
Proc Natl Acad Sci U S A.
1988;85:5215-5219[Abstract/Free Full Text].
25.
The International Chronic Granulomatous Disease Cooperative Study Group.
A controlled trial of interferon gamma to prevent infection in chronic granulomatous disease.
N Engl J Med.
1991;324:509-5160[Abstract].
26.
Subrahmanyam YVBK, Baskaran N, Newburger PE, Weissman SM.
A modified method for the display of 3'-end restriciton fragments of cDNAs: molecular profiling of gene expression in neutrophils.
Methods Enzymol.
1999;303:272-297[Medline]
[Order article via Infotrieve].
27.
Maniatis T, Fritsch EF, Sambrook J.
Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1990.
28.
Lomax KJ, Leto TL, Nunoi H, Gallin JI, Malech HL.
Recombinant 47-kilodalton cytosol factor restores NADPH oxidase in chronic granulomatous disease.
Science.
1989;245:409-412[Abstract/Free Full Text].
29.
Gatti RA, Concannon P, Salser W.
Multiple use of Southern blots.
Biotechniques.
1984;2:148-155.
30.
Katz RA, Erlanger BF, Guntaka RV.
Evidence for extensive methylation of ribosomal RNA genes in a rat XC cell line.
Biochim Biophys Acta.
1983;739:258-264[Medline]
[Order article via Infotrieve].
31.
Newburger PE, Speier C, Borregaard N, Walsh CE, Whitin JC, Simons ER.
Development of the superoxide-generating system during differentiation of the HL-60 promyelocytic leukemia cell line.
J Biol Chem.
1984;259:3771-3776[Abstract/Free Full Text].
32.
Condino-Neto A, Newburger PE.
NADPH oxidase activity and cytochrome b558 content of human Epstein-Barr virus transformed B lymphocytes correlate with expression of genes encoding components of the oxidase system.
Arch Biochem Biophys.
1998;360:158-164[Medline]
[Order article via Infotrieve].
33.
Greenberg ME, Greene LA, Ziff EB.
Nerve growth factor and epidermal growth factor induce rapid transient changes in proto-oncogene transcription in PC12 cells.
J Biol Chem.
1985;260:14,101-14,110[Abstract/Free Full Text].
34.
Krowczynska A, Yenofsky R, Brawerman G.
Regulation of messenger RNA stability in mouse erythroleukemia cells.
J Mol Biol.
1985;181:231-239[Medline]
[Order article via Infotrieve].
35.
Bhattacharyya GK, Johnson RA.
Nonparametric inference. In:
Bhattacharyya GK,Johnson RA, eds.
Statistical Concepts and Methods. Singapore: John Wiley; 1977:505-547.
36.
Hashinaka K, Nishio C, Hur S, Sakiyama F, Tsunasawa S, Yamada M.
Multiple species of myeloperoxidase messenger RNAs produced by alternative splicing and differential polyadenylation.
Biochemistry.
1988;27:5906-5914[Medline]
[Order article via Infotrieve].
37.
Kornblihtt AR, Pesce CG, Alonso CR, et al.
The fibronectin gene as a model for splicing and transcription studies.
FASEB J.
1996;10:248-257[Abstract].
38.
Bayes M, Hartung AJ, Ezer S, et al.
The anhidrotic ectodermal dysplasia gene (EDA) undergoes alternative splicing and encodes ectodysplasin-A with deletion mutations in collagenous repeats.
Hum Mol Genet.
1998;7:1661-1669[Abstract/Free Full Text].
39.
Cichon S, Anker M, Vogt IR, et al.
Cloning, genomic organization, alternative transcripts and mutational analysis of the gene responsible for autosomal recessive universal congenital alopecia.
Hum Mol Genet.
1998;7:1671-1679[Abstract/Free Full Text].
40.
Kojima T, Horiuchi T, Nishizaka H, et al.
Genetic basis of human complement C8alpha-gamma deficiency.
J Immunol.
1998;161:3762-3766[Abstract/Free Full Text].
41.
Tabata Y, Isashiki Y, Kamimura K, Nakao K, Ohba N.
A novel splice site mutation in the tissue inhibitor of the metalloproteinases-3 gene in Sorby's fundus dystrophy with unusual clinical features.
Hum Genet.
1998;103:179-182[Medline]
[Order article via Infotrieve].
42.
Maly F-E, Nakamura M, Gauchat J-F, et al.
Superoxide-dependent nitroblue tetrazolium reduction and expression of cytochrome b245 components by human tonsillar B lymphocytes and B cell lines.
J Immunol.
1989;142:1260-1267[Abstract].
43.
Ezekowitz RAB, Sieff CA, Dinauer MC, Nathan DG, Orkin SH, Newburger PE.
Restoration of phagocyte function by interferon-gamma in X-linked chronic granulomatous disease occurs at the level of a progenitor cell.
Blood.
1990;76:2443-2448[Abstract/Free Full Text].
44.
Woodman RC, Erickson RW, Rae J, Jaffe HS, Curnutte JT.
Prolonged recombinant interferon-gamma therapy in chronic granulomatous disease: evidence against enhanced neutrophil oxidase activity.
Blood.
1992;79:1558-1562[Abstract/Free Full Text].
45.
Bemiller LS, Roberts DH, Starko KM, Curnutte JT.
Safety and effectiveness of long-term interferon gamma therapy in patients with chronic granulomatous disease.
Blood Cells Mol Dis.
1995;21:239-247[Medline]
[Order article via Infotrieve].
46.
Yagisawa M, You A, Yonemaru M, et al.
Superoxide release and NADPH oxidase components in mature human phagocytes: correlation between functional capacity and amount of functional proteins.
Biochem Biophys Res Commun.
1996;228:510-516[Medline]
[Order article via Infotrieve].
47.
Forehand JR, Pabst MJ, Phillips WA, Johnston RB Jr.
Lipopolysaccharide priming of human neutrophils for an enhanced respiratory burst: role of intracellular free calcium.
J Clin Invest.
1989;83:74-83.
48.
Berkow RL, Dodson MR.
Biochemical mechanisms involved in the priming of neutrophils by tumor necrosis factor.
J Leukoc Biol.
1988;44:345-352[Abstract].
49.
Johnston JJ, Rintels P, Chung J, Sather J, Benz EJ Jr, Berliner N.
Lactoferrin gene promoter: structural integrity and nonexpression in HL60 cells.
Blood.
1992;79:2998-3006[Abstract/Free Full Text].
50.
Woodman RC, Curnutte JT, Babior BM.
Evidence that de novo protein synthesis participates in a time-dependent augmentation of the chemotactic peptide-induced respiratory burst in neutrophils.
Free Radic Biol Med.
1988;5:355-361[Medline]
[Order article via Infotrieve].
51.
Cassatella MA, Hartman L, Perussia B, Trinchieri G.
Tumor necrosis factor and immune interferon synergistically induce cytochrome b245 heavy chain gene expression and nicotinamide-adenine dinucleotide phosphate oxidase in human leukemic myeloid cells.
J Clin Invest.
1989;83:1570-1579.
52.
Yao XL, Ikezono T, Cowan M, Logun C, Angus CW, Shelhamer JH.
Interferon-gamma stimulates human Clara cell secretory protein production by human airway epithelial cells.
Am J Physiol.
1998;274:L864-L869[Abstract/Free Full Text].
53.
Mitchell TJ, Naughton M, Norsworthy P, Davies KA, Walport MJ, Morley BJ.
IFN-gamma up-regulates expression of the complement components C3 and C4 by stabilization of mRNA.
J Immunol.
1996;156:4429-4434[Abstract].
54.
Lappin DF, Guc D, Hill A, McShane T, Whaley K.
Effect of interferon-gamma on complement gene expression in different cell types.
Biochem J.
1992;281:437-442.
55.
Lappin DF, Whaley K.
Interferon-induced transcriptional and post-transcriptional modulation of factor H and C4 binding-protein synthesis in human monocytes.
Biochem J.
1990;271:767-772[Medline]
[Order article via Infotrieve].
56.
Ohh M, Takei F.
Interferon-gamma- and phorbol myristate acetate-responsive elements involved in intercellular adhesion molecule-1 mRNA stabilization.
J Biol Chem.
1994;269:30,117-30,120[Abstract/Free Full Text].
57.
Ohh M, Smith CA, Carpenito C, Takei F.
Regulation of intercellular adhesion molecule-1 gene expression involves multiple mRNA stabilization mechanisms: effects of interferon-gamma and phorbol myristate acetate.
Blood.
1994;84:2632-2639[Abstract/Free Full Text].
58.
Suk K, Erickson KL.
Differential regulation of tumour necrosis factor-alpha mRNA degradation in macrophages by interleukin-4 and interferon-gamma.
Immunology.
1996;87:551-558[Medline]
[Order article via Infotrieve].
59.
Tolstrup AB, Bejder A, Fleckner J, Justesen J.
Transcriptional regulation of the interferon-gamma-inducible tryptophanyl-tRNA synthetase includes alternative splicing.
J Biol Chem.
1995;270:397-403[Abstract/Free Full Text].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Luengo-Blanco, C. Prando, J. Bustamante, W. C. Aragao-Filho, P. V. S. Pereira, J. Rehder, C. Padden, J.-L. Casanova, P. E. Newburger, and A. Condino-Neto
Essential role of nuclear factor-{kappa}B for NADPH oxidase activity in normal and anhidrotic ectodermal dysplasia leukocytes
Blood,
August 15, 2008;
112(4):
1453 - 1460.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Foster, S. Hulme, M. Lovell, K. Reed, and P. Barrow
Stimulation of gp91 Phagocytic Oxidase and Reactive Oxygen Species in Neutrophils by an Avirulent Salmonella enterica Serovar Infantis Strain Protects Gnotobiotic Piglets from Lethal Challenge with Serovar Typhimurium Strain F98 without Inducing Intestinal Pathology
Infect. Immun.,
August 1, 2005;
73(8):
4539 - 4547.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Thomas, S. Samanta, C. Wu, N. Berliner, and E. Fikrig
Anaplasma phagocytophilum Modulates gp91phox Gene Expression through Altered Interferon Regulatory Factor 1 and PU.1 Levels and Binding of CCAAT Displacement Protein
Infect. Immun.,
January 1, 2005;
73(1):
208 - 218.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Qiao, S. Prabhakar, A. Canova, Y. Hoshino, M. Weiden, and R. Pine
Posttranscriptional Inhibition of Gene Expression by Mycobacterium tuberculosis Offsets Transcriptional Synergism with IFN-{gamma} and Posttranscriptional Up-Regulation by IFN-{gamma}
J. Immunol.,
March 1, 2004;
172(5):
2935 - 2943.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Foster, S. D. Hulme, and P. A. Barrow
Induction of Antimicrobial Pathways during Early-Phase Immune Response to Salmonella spp. in Murine Macrophages: Gamma Interferon (IFN-{gamma}) and Upregulation of IFN-{gamma} Receptor Alpha Expression Are Required for NADPH Phagocytic Oxidase gp91-Stimulated Oxidative Burst and Control of Virulent Salmonella spp.
Infect. Immun.,
August 1, 2003;
71(8):
4733 - 4741.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Ishibashi, T. Mizukami, S. Kanegasaki, L. Motoda, R. Kakinuma, F. Endo, and H. Nunoi
Improved superoxide-generating ability by interferon {gamma} due to splicing pattern change of transcripts in neutrophils from patients with a splice site mutation in CYBB gene
Blood,
July 15, 2001;
98(2):
436 - 441.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. R. Snyder, J. F. Waring, S. Z. Zhu, S. Kaplan, J. Schultz, and G. D. Ginder
A 3'-Transcribed Region of the HLA-A2 Gene Mediates Posttranscriptional Stimulation by IFN-{{gamma}}
J. Immunol.,
March 15, 2001;
166(6):
3966 - 3974.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L.-C. Yu, Y.-C. Twu, C.-Y. Chang, and M. Lin
Molecular Basis of the Kell-null Phenotype. A MUTATION AT THE SPLICE SITE OF HUMAN KEL GENE ABOLISHES THE EXPRESSION OF KELL BLOOD GROUP ANTIGENS
J. Biol. Chem.,
March 23, 2001;
276(13):
10247 - 10252.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction