|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 11 (June 1), 2000:
pp. 3620-3627
TRANSPLANTATION
Cotransplantation of human stromal cell progenitors into preimmune
fetal sheep results in early appearance of human donor cells in
circulation and boosts cell levels in bone marrow at later time points
after transplantation
Graça Almeida-Porada,
Christopher D. Porada,
Nam Tran, and
Esmail D. Zanjani
Department of Veterans Affairs Medical Center, University of Nevada
Reno, Reno, NV.
 |
Abstract |
Both in utero and postnatal hematopoietic stem cell (HSC)
transplantation would benefit from the development of approaches that
produce increased levels of engraftment or a reduction in the period of
time required for reconstitution. We used the in utero model of
human-sheep HSC transplantation to investigate ways of improving
engraftment and differentiation of donor cells after transplantation.
We hypothesized that providing a more suitable microenvironment in the
form of human stromal cell progenitors simultaneously with the
transplanted human HSC would result in higher rates of engraftment or
differentiation of the human cells in this xenogeneic model. The
results presented here demonstrate that the cotransplantation of both
autologous and allogeneic human bone marrow-derived stromal cell
progenitors resulted in an enhancement of long-term engraftment of
human cells in the bone marrow of the chimeric animals and in earlier
and higher levels of donor cells in circulation both during gestation
and after birth. By using marked stromal cells, we have also
demonstrated that injected stromal cells alone engraft and remain
functional within the sheep hematopoietic microenvironment. Application
of this method to clinical HSC transplantation could potentially lead
to increased levels of long-term engraftment, a reduction in the time
for hematopoietic reconstitution, and a means of delivery of foreign
genes to the hematopoietic system.
(Blood. 2000;95:3620-3627)
© 2000 by The American Society of Hematology.
 |
Introduction |
Bone marrow transplantation (BMT) has been used
successfully in the treatment of a wide variety of disorders including
the storage diseases and other diseases of metabolism, diseases of immune function, and many hematologic and solid tumor malignancies. More recently, in utero hematopoietic stem cell (HSC) transplantation has emerged as an alternative for a limited number of
diseases.1-4 However, although the successful application
of this procedure could circumvent many of the limitations and risks
currently associated with postnatal BMT in these diseases, in utero HSC
transplantation, like postnatal BMT, has not yet achieved its full
therapeutic potential. Thus, both in utero and postnatal BMT would
benefit from the development of approaches that produce increased
levels of engraftment or a reduction in the period of time required for reconstitution. It has been shown that the radiation exposure and
standard- and high-dose therapies currently used in postnatal BMT
induce important sequelae within the hematopoietic and stromal progenitor cell compartments.5-7 Likewise, the fetal
microenvironment may not be fully conducive for the development of
donor cells in the case of in utero HSC transplantation.8,9
In the fetus, as in pediatric and adult recipients, donor HSC primarily
engraft the bone marrow (BM).10 However, despite the
presence of significant numbers of donor stem/progenitor cells in host
marrow following in utero HSC transplantation, little or no mature
donor-derived cells or their products are detected in the circulation
until late in gestation, near birth.11,12 The mechanism(s)
underlying this delay in the differentiation and appearance of donor
cells into the peripheral blood (PB) is not known. It is possible that the onset of marrow hematopoiesis is associated with the development of
a more permissive hematopoietic environment. In this regard, we have
recently reported that cotransplantation of adult sheep stroma resulted
in increased engraftment and early differentiation of donor cells in
sheep fetuses.13 Based on this we investigated the
possibility that the presence of a human adult microenvironment in the
human-sheep xenograft model of human hematopoiesis may render the
model more biologically relevant.14 The feasibility of
engrafting marrow-derived progenitor stromal cells/mesenchymal cells
after both in utero and postnatal transplantation has been reported by
a number of authors.14-20 Pereira et al15
reported the successful long-term engraftment of normal marrow stromal cells in several organs following intravenous infusion into mice exhibiting osteogenesis imperfecta. Nilsson et al16
demonstrated that whole BM contains cells capable of engrafting
nonablated mice and giving rise to competent osteoblasts and Horwitz et
al20 demonstrated the transplantability and therapeutic
effects of BM-derived marrow stromal cells (MSCs) in children with
osteogenesis imperfecta. Also, the simultaneous injection of human
stroma and human HSCs into bnx mice resulted in increased engraftment,
but only when the stroma was transduced before transplant with a
construct containing the human interleukin-3 (IL-3) complementary DNA
(cDNA).17 A phase one trial has also been conducted in
humans demonstrating that mesenchymal progenitor cells can be collected
from BM aspirates, subjected to ex vivo expansion, and subsequently
reinfused into patients with no adverse reactions.18 We
have shown in vitro that although sheep stroma is able to support human
hematopoiesis and induce multilineage differentiation of human
progenitor cells, it does so at levels significantly lower than that of
human stroma.21 For this reason, the human-sheep xenograft
model of in utero HSC transplantation is ideal for testing the effects
of the transplantation of stromal progenitor cells and the creation of
a suitable microenvironment to which the human HSC can home, engraft,
and proliferate/differentiate. In support of the suitability of this
model to questions of microenvironmental influence on transplanted HSC,
the in vivo administration of human cytokines such as IL-3,
granulocyte/macrophage colony-stimulating factor (GM-CSF), or stem cell
factor (SCF) to chimeric sheep resulted in an increased level of donor
cell activity in chimeric animals.11,22 In the present
studies we used the human-sheep xenograft model to determine the
effect of transplanted human stromal progenitor cells on the
engraftment and differentiation of human cells, in the hope of
providing a more suitable microenvironment for the transplanted cells.
To this end, we transplanted preimmune 55- to 60-day-old fetal sheep
with purified adult human stem cells with or without autologous or
allogeneic marrow stromal progenitor cells and examined donor HSC
engraftment and differentiation from 43 days after transplantation
until 3 years after birth.
The results presented here demonstrate that human stromal cells are
able to engraft in preimmune fetal sheep and that cotransplantation of
stroma results in not only a significant increase of donor hematopoietic activity in fetal circulation starting early in gestation
but also in higher levels of human donor cells in BM at later time
points after transplantation.
 |
Materials and methods |
Human donor cell preparation
Heparinized human BM was obtained from healthy donors after informed
consent on experimental day 0 and 9. Low-density BM mononuclear cells
were separated by a Ficoll-Hypaque density gradient (1.077g/mL) (Sigma,
St Louis, MO) and washed twice in Iscove's modified Dulbecco's media
(IMDM) (Gibco Laboratories, Grand Island, NY). BM mononuclear cells
harvested at day 0 were used for preparation of the autologous and
allogeneic stroma, whereas BM mononuclear cells collected at day 9 were
sorted into CD34+, HLA-DR or
CD34+, Lin , Thy+ cells.
Stromal cell preparation
Stromal layers were established from human BM mononuclear cells
plated at a density of 20 × 106 cells per T75 flask
(Costar, Cambridge, MA) in 10% fetal bovine serum (FBS) (Gibco), 10%
horse serum (HS) (Gibco), and 10 6 mol/L
hydrocortisone (Sigma) in IMDM. On day 9 of culture stromal layers were
trypsinized, washed, and resuspended at the desired concentration for
injection in a volume of 0.5 mL. Day 9 was chosen because at this time,
stromal layers were found to contain the highest percentage of
STRO-1+ cells, a finding in agreement with previous
studies.23
Immunofluorescence staining for flow cytometric analysis and
selection of cells by cell sorting
Sorting of the CD34+, HLA-DR or
CD34+, Lin , Thy+ population
was performed on a FACS Vantage after labeling with CD34 (8G12 FITC), HLA-DR (phycoerythrin [PE]) (Becton Dickinson Immunocytometry Systems
[BDIS], San Jose, CA), or with CD34, CDw90 (5E10 fluorescein isothiocyanate [FITC]) (Pharmingen, San Diego, CA) and CD2, CD14, CD15, CD16, CD19 all FITC, as well as glycophorin A (AMAC, Inc, Westbrook, ME) to exclude Lin+ cells as previously
described.24,25 Flow cytometric analysis of the cell
populations was performed on a FACScan (Becton Dickinson). Monoclonal
antibodies to various cluster designations directly conjugated with
FITC or PE were used according to the manufacturer's recommendation.
These included: CD45, CD14, CD34, CD20, CD33, CD3, CD7, CD56, CD44,
CD10, CD4, CD8 (BDIS), glycophorin A (AMAC), and STRO-1.23
Creation of the human-sheep chimeras and assessment of
engraftment
An overview of the experimental design is shown in Figure
1. In autologous cotransplantation studies
32 fetal sheep were transplanted at 55 to 60 days of gestation
following the procedure that has been described in detail
previously.10-12 CD34+, Lin ,
Thy+ (0.7-6 × 104 cells/fetus) or
CD34+, HLA-DR
(6.5 × 104cells/fetus) with or without autologous
stromal cells
(5 × 104-7.5 × 105) were
injected in l mL volume by intraperitoneal injection into fetal sheep
55 to 60 days old. The transplanted sheep were analyzed for donor
(human) cell engraftment in BM, thymus, liver, spleen, and PB at 3, 6, and 9 weeks after transplantation (91, 112, and 133 days of gestation),
and after birth at 1 week, 3 months, and 1 year of age (13, 23, and 65 weeks after transplantation). Of these 32 sheep, 15 were injected with
human stroma and autologous human HSC with 1 of 2 phenotypes:
CD34+, Lin , Thy+ or
CD34+, HLA-DR . These populations were
used because we have demonstrated in previous studies that both are
equally capable of similar levels of engraftment and differentiation in
our human-sheep xenograft model.24,25 Of the remaining 17 sheep, 12 were injected with human HSC alone with 1 of the 2 phenotypes
described above. As a control, the remaining 5 sheep were injected with
human stromal cells alone. Ten additional fetuses were transplanted
with 105 CD34+, Lin ,
Thy+ cells with or without 108 allogeneic
stromal progenitor cells. In 7 animals analysis of human cell
engraftment was performed at intervals after birth up to 3 years
posttransplant (Figure 1).

View larger version (24K):
[in this window]
[in a new window]
| Fig 1.
Experimental design.
This figure depicts the overall design of our experiments to evaluate
whether autologous or allogeneic stromal cells could enhance the levels
of engraftment and donor cell differentiation of HSC transplanted in
utero. Various hematopoietic tissues from these animals were then
evaluated for the engraftment and differentiation of the transplanted
HSC or stromal cells as detailed in the text.
|
|
Tracking of human stromal cells
For these experiments, 6 fetal sheep at 55 to 60 days gestational
age were used. Four fetuses were injected with 107 human
stromal cells that were genetically marked by in vitro retroviral
transduction before transplantation and analyzed at 2 and 6 weeks after
transplant. The 2 remaining fetuses were injected with an identical
number of stromal cells that had been labeled with PKH26 and were
analyzed at day 2 and 6 after transplant.
Transduction of human stroma with G1BgSvNa retroviral vector
Subconfluent stromal layers were transduced for 48 hours with
rapidly thawed amphotropic retroviral supernatant diluted in an equal
volume of Dulbecco's modified Eagle's medium with high glucose and
10% heat-inactivated FBS in the presence of 4 µg/mL protamine
sulfate (Lyphomed, Deerfield, IL), with the vector preparation being
replaced every 12 hours, for a total of 4 cycles of transduction. Passage 4 stromal cells were then selected in medium containing 1.5 mg/mL of G418 to ensure that the transplanted stromal cells were transduced.
Labeling of stromal cells with PKH26
Stromal layers 80% confluent, grown for 9 days as described above,
were trypsinized and collected by centrifugation. Cells were then
aliquoted at 2 × 107 cells per tube and labeled
with PKH26 (Sigma) according to manufacturer's instructions.
Quantiblot of human DNA
DNA samples were prepared by using a salting-out
protocol.26 For detection and quantitation of human DNA in
the several organs, Quantiblot (Perkin Elmer, Foster City, CA) was used
according to manufacturer's instructions.
Detection of NeoR sequences by polymerase chain
reaction (PCR)
Five hundred nanograms of total genomic DNA isolated from different
sheep organs was subjected to analysis by PCR as follows: PCR primers
5'CTGAATGAACTGCAGGACGA3' and
5'AGCCAACGCTATGTCCTGAT3', which amplify a 504 base pair
(bp) fragment of the bacterial neomycin phosphotransferase
(NeoR) gene, were used at 0.5 µmol/L.
Standard dNTP and MgCl2 (2.5 mmol/L) concentrations were
used, and 1 unit of Amplitaq DNA polymerase (Perkin Elmer) was added to
each 50-µL reaction. The reactions were run for 40 cycles consisting
of denaturation at 95°C for 1 minute, annealing at 57°C for 1 minute, and extension at 72°C for 1.5 minutes. The positive control
consisted of the plasmid pUC18Neo diluted in normal sheep DNA to a
concentration of 1%.
Reverse transcriptase PCR (RT-PCR)
To examine the expression of human growth factors in the chimeric
sheep, total cellular RNA was extracted by the guanidinium thiocyanate-acidic phenol-chloroform method. For the RT-PCR 1 µg of
RNA was reverse transcribed in a 20-µL reaction mixture using a
commercially available kit according to the manufacturer's recommendations (Perkin Elmer). For the PCR reaction,
MgC12, Amplitaq DNA polymerase, PCR buffer, and 40 pmol of
each primer were added to the total first strand cDNA mixture, giving a
final volume of 100 µL, and PCR for SCF, GM-CSF, and granulocyte
colony-stimulating factor (G-CSF) was then performed.
Southern blotting of PCR products
Southern blotting was performed according to standard
procedures27 using Gene Screen Plus (DuPont) nylon
membrane. Oligonucleotide probes specific for the Neo, SCF, GM-CSF, or
G-CSF products were labeled with [32P]dATP by an
end-labeling reaction. Following transfer, the DNA was cross-linked to
the membrane by short-wave UV irradiation and the membrane was
prehybridized at 65°C for 1 hour in 6× standard sodium
citrate (SSC), 0.5% sodium dodecyl sulfate (SDS), and l00 µg/mL
salmon sperm DNA; 2 × 106 cpm of labeled probe was
added per milliliter of prehybridization solution, and dextran sulfate
was added to a final concentration of 10%. The filter was then
hybridized overnight at 65°C. The filter was washed 4 times at
65°C for 15 minutes each under conditions of increasing stringency.
The filter was then autoradiographed for 1 to 12 hours (depending on
the signal intensity) at 80°C with 2 intensifying screens
(DuPont Cronex Lightning Plus).
-Galactosidase staining of stromal layers
Stromal layers grown from the several hematopoietic organs were
stained for -galactosidase activity as follows. Cells were washed
once with phosphate-buffered saline (PBS) and were then fixed for 5 minutes at room temperature in a solution of 0.5% glutaraldehyde in
PBS. Following fixation, cells were rinsed once with PBS and were then
washed twice for 5 minutes each in PBS. -Galactosidase activity was
then detected by incubating the cells overnight at 37°C in
-galactosidase staining solution, which consisted of PBS containing
5 mmol/L K4Fe(CN)6*3H2O, 5 mmol/L K3Fe(CN)6, 2 mmol/L MgCl2, and l
mg/mL X-galactosidase. After overnight staining, the cells were washed
once with PBS and were then counterstained with nuclear fast red. The
slides were rinsed with H2O and visualized on an Olympus
light microscope.
Statistical analysis
Results are expressed as mean ± SEM. Because of small group
sizes, comparisons between experimental results were determined by a
nonparametric rank sum test. A P value of less than .05 was considered statistically significant.
 |
Results |
Cotransplantation of autologous human stroma yields increased levels
of human cells in circulation before birth: results from PB and
BM at 3, 6, and 9 weeks after transplant
To determine the effect of cotransplanting stroma on early donor HSC
engraftment and appearance of donor cells within the PB, recipients of
HSC and HSC plus stroma were killed at 3, 6, and 9 weeks after
transplant and their BM and PB were analyzed by flow cytometry for the
engraftment/differentiation of human cells. The results of flow
cytometric analyses of the BM and PB of the sheep killed before birth
are shown in Figures 2 and
3, respectively. At the time point of 3 weeks after transplant, there were no significant differences in the
levels of donor cell engraftment in the BM (Figure 2) and appearance in
PB (Figure 3) between the groups that received HSC alone (n = 2) or
with stroma (n = 2). In contrast, as early as 6 weeks after
transplant, there were marked increases in the levels of human cells
observed in the PB (Figure 3) of the animals that had received HSC with
stroma (CD45: 13.5 ± 5.5%; n = 4) when compared to the group
that had received HSC alone (CD45: 1.2 ± 0.6%; n = 3)
(P < .03). Although the presence of human cells in PB was
multilineage in both groups, the pronounced difference in the levels of
human cells between these 2 groups can be attributed primarily to the
higher levels of lymphoid progenitors (CD7) and erythroid (glycophorin
A-positive) cell precursors in sheep that received human HSC plus
stroma. The sheep that received HSC plus stroma had an average of 10% CD7+ cells versus only 3.4% in the sheep that received HSC
alone. Likewise, sheep receiving HSC plus stroma had an average of
2.25% glycophorin A-positive cells, whereas those that received HSC alone had 0.6%. Even more pronounced differences were observed in the
PB at 9 weeks after transplant, with human CD45 levels as high as
18.9 ± 6.5% in the sheep receiving stroma plus HSC (n = 4)
compared to only 0.3 ± 0.1% in those injected with HSC alone
(n = 3) (P < .03) (Figure 3). At this time, however,
pronounced increases in donor cells were seen not only in the lymphoid
and erythroid precursor cell populations, but also in the myeloid and
monocytic lineages (Table 1).

View larger version (26K):
[in this window]
[in a new window]
| Fig 2.
FACS analysis of BM at early time points after
transplantation.
Sheep that had been transplanted in utero with human HSC alone or in
combination with autologous stromal cells were killed at early time
points of 3, 6, and 9 weeks after transplant and their long bones
collected. Single cell suspension were then obtained as detailed in
"Materials and methods," and FACS analysis for human-specific
cell markers was performed to evaluate whether stromal cells could
enhance the levels of engraftment of donor human cells within the
animals transplanted in utero. Values represent the mean ± 1
SEM.
|
|

View larger version (25K):
[in this window]
[in a new window]
| Fig 3.
FACS analysis of PB at early time points after
transplantation.
Sheep that had been transplanted in utero with human HSC alone or in
combination with autologous stromal cells were killed at early time
points of 3, 6, and 9 weeks after transplant and their PB was
collected. FACS analysis for the presence of the human-specific marker
CD45 was then performed to evaluate whether stromal cells could enable
the early entry of donor human cells within the periphery of animals
transplanted in utero. Values represent the mean ± 1 SEM.
|
|
Multilineage engraftment was also seen at all 3 time points in the BM
of animals that received HSC either alone or with stroma, but no
significant differences were seen between the 2 groups (Figure 2). Of
note, however, is the fact that the levels of CD34+ cells
at both 3 and 6 weeks after transplant appear to be slightly higher in
the animals that were injected with HSC alone when compared to those
receiving stroma concomitantly (Figure 4).

View larger version (22K):
[in this window]
[in a new window]
| Fig 4.
Engraftment of CD34+ cells within the sheep
bone marrow (BM) following in utero HSC transplantation.
To determine whether cotransplanting stromal cells with the HSC graft
produced early donor cell differentiation within the periphery by
inducing all of the grafted HSC to undergo terminal differentiation, BM
was obtained from animals killed at 3, 6, and 9 weeks after transplant
and analyzed by flow cytometry for the presence of CD34. Values shown
represent the mean ± 1 SEM.
|
|
Levels of engraftment of human cells in PB and BM at 3 days, 3 months, and 12 months after birth in sheep transplanted with human HSC
with or without human autologous stroma
Once we had demonstrated that the cotransplantation of stroma with
HSC resulted in an enhancement in early donor cell appearance within
the PB, we next examined whether this enhancement was long-lasting. To
address this issue, flow cytometric analyses of PB and BM were also
performed on the transplanted sheep at 3 days, 3 months, and 1 year of
age (13, 23, and 65 weeks after transplantation, respectively). As can
be seen in Figure 5, the presence of human donor cells in PB was observed in both groups at all time points after
birth, albeit at lower levels than those seen at earlier time points
after transplantation. As in the earlier time points, however, the
levels were significantly higher in the group that had received stromal
cells compared to HSC alone. When BM from these same animals was
analyzed, we found that higher levels of human cells were present in
the animals that had been cotransplanted with autologous stroma
(2.2 ± 0.3% at birth, n = 5; 1.63 ± 0.5% at 3 months of
age, n = 5; and 0.17 ± 0.06% at 1 year of age, n = 4) when
compared with sheep receiving HSC alone in which the levels of human
cells found in the BM did not exceed 0.2% at any time. This is in
contrast to the results obtained in the sheep analyzed before birth, in
which no differences in the levels of engraftment in the BM were
observed between the 2 experimental groups. It is also of note that we
were never able, at any time point, to detect human CD45+
cells by flow cytometry in any of the sheep that were transplanted with
human stroma alone.

View larger version (22K):
[in this window]
[in a new window]
| Fig 5.
Donor human cell presence within PB after birth (13, 23, and 65 weeks after transplantation).
To determine whether cotransplanting stroma altered the long-term
engraftment/differentiation of donor human cells, sheep that had been
transplanted in utero with either HSC alone or in conjunction with
autologous stromal cells were allowed to complete gestation and were
subsequently analyzed by flow cytometry at birth, 3 months, and 12 months for the presence of human CD45+ cells in their PB.
Values represent the mean ± 1 SEM.
|
|
Cotransplantation of human allogeneic stroma with human HSC
We next examined whether allogeneic stroma was also capable of
increasing the levels of engraftment and differentiation of human donor
cells in our sheep model. To address this issue, sheep that had
received allogeneic stroma in combination with human HSC were analyzed
at 13, 23, 68, and 169 weeks after transplant and compared to the
results obtained with sheep receiving either HSC alone or HSC with
autologous stroma. Analysis of these animals revealed that the
allogeneic stroma was as effective as the autologous stroma at
enhancing the appearance of donor human cells within the PB at all
times after transplant resulting in levels of human cells in the PB
similar to those described above (data not shown). In addition, by
including the 169-week time point, we were able to demonstrate that the
pronounced enhancement in the levels of donor cells within the
periphery achieved by cotransplanting allogeneic stroma with HSC
persisted for over 3 years after transplant. As can be seen in Figure
6, the levels of human cells in the PB of sheep receiving HSC plus allogeneic stroma (n = 4) varied from 5.15%
to 10.9% (mean: 7% ± 2.5%), whereas sheep receiving HSC alone
(n = 3) had levels ranging from 0.43 to 1.91 (mean:
1% ± 0.7%) (P < .03). Furthermore, as with
autologous stroma, allogeneic stroma also produced an increase in the
levels of marrow long-term engraftment at all time points after birth
(percent human cells in BM of HSC plus stroma, 0.5 ± 0.08, n = 4;
HSC alone, 0.2 ± 0.1, n = 3) (P < .03).

View larger version (14K):
[in this window]
[in a new window]
| Fig 6.
FACS analysis on PB at 169 weeks after transplantation.
The PB was obtained at intervals from sheep transplanted in utero with
HSC alone (n = 3) or in combination with allogeneic human stromal
cells (n = 4). This scatter plot shows the levels of human
CD45+ cells in the PB of each of these sheep at 169 weeks
after transplantation as well as the mean percentage of human cells
present ± 1 SEM for each experimental group as a whole.
|
|
Detection of human DNA in human-sheep chimeras
DNA analysis was used to further demonstrate engraftment of human
cells in transplanted sheep and to investigate the possibility that
human stromal cells were able to engraft following in utero transplantation. To this end, DNA was isolated from both whole organs
and cultured BM stromal layers of the transplanted sheep and analyzed
using the Quantiblot assay to detect the presence of human DNA. Table
2 summarizes the results obtained from a Quantiblot assay performed on 8 randomly selected transplanted sheep at
9 weeks after transplantation. Human DNA was detected in all of the
freshly collected BM samples and in all but 1 of the cultured
marrow stromal layers (sheep injected with
CD34+HLA DR human BM cells). Of
note is the presence of human DNA in the BM and spleen of sheep that
had been injected with stroma alone, indicating that injected stromal
cells are capable of engraftment in the human-sheep xenograft model.
Tracking of human stromal cells in sheep fetuses
Although the Quantiblot system enabled us to demonstrate
that human stromal cells had the ability to engraft in sheep
hematopoietic organs following in utero transplantation, we wished to
find another method of tracking transplanted stromal cells that would
allow us to identify engrafted stromal cells in situ. Four additional fetal sheep were transplanted in utero with passage 4 stromal cells
that had been transduced with a retroviral vector containing the
NeoR and the LacZ genes. We then
used the presence/expression of these genes to track where the human
stromal cells had engrafted. The retroviral vector used contained a
nuclear targeting signal at the start of the LacZ gene, thus
eliminating any ambiguity caused by the presence of lysosomal enzymes
with -galactosidase-like activity. Transplanted sheep were killed
at either 2 weeks or 6 weeks after transplant, and hematopoietic
tissues collected. Stromal layers were then grown from these organs,
and histochemical staining for -galactosidase was performed. PCR for
the NeoR gene was also performed on DNA
obtained from the freshly harvested organs. Figure
7A shows a NeoR-specific PCR
performed on freshly isolated tissues from sheep transplanted with the
retroviral-marked stromal cells, showing the ability of these
transplanted human stromal cells to engraft in several hematopoietic
organs. Figure 8 shows that stromal layers grown from bone marrow, thymus, spleen, and liver all contained cells
that expressed -galactosidase, demonstrating that marked human
stromal cells are present within these organs. Although we did not use
specific markers or culture conditions that would allow us to
distinguish between the various types of cells into which human stromal
progenitors are known to be able to differentiate,28-30 by
morphologic examination we were able to identify transduced adipocytes
and fibroblast-like cells (Figure 8). Importantly, flow cytometric
analysis demonstrated that CD45+ cells were not present in
these stromal layers, thus excluding the presence of leukocytes as the
source of transduced cells in the stromal layers.

View larger version (37K):
[in this window]
[in a new window]
| Fig 7.
PCR on isolated tissues.
(A) Presence of NeoR gene in hematopoietic
organs from sheep transplanted in utero with retrovirally marked
stromal cells. Following sacrifice, single cell suspensions of liver,
spleen, thymus, and BM were prepared as detailed in "Materials and
methods," and the DNA obtained from these cells was then subjected
to PCR analysis with primers specific for the vector-encoded
NeoR gene. The reagent control consisted of
all of the constituents of the PCR reaction mixture except template DNA
(lane 1 from the left). The negative control ( ) DNA was isolated
from the PB mononuclear cells from a normal control ram (lane 2). The
positive control consisted of the plasmid pUC18Neo diluted in normal
sheep DNA to a concentration of 1% (lane 11). The remainder of the
samples consisted of DNA extracted from the organs (as labeled in the
figure) of 2 different transplanted sheep. For each organ there are 2 samples; the sample on the left is from the time point of 2 weeks after
transplant, and the sample on the right from 6 weeks after transplant.
(B) SCF RT-PCR on marrow stromal cells. To evaluate whether the
transplanted stromal cells were expressing mRNA for hematopoietic
growth factors BM stromas grown from 5 sheep transplanted with human
stroma cells alone were harvested and RNA was isolated. This RNA was
then reverse transcribed into cDNA and used as a template for
SCF-specific PCR. The reagent control consisted of all of the reaction
constituents except template DNA, and the negative control consisted of
RNA isolated from the BM mononuclear cells of a normal control sheep
(lane 1). The positive control was RNA isolated from human BM
mononuclear cells (lane 8). Lanes 2 to 6 consisted of RNA extracted
from stromal layers cultured from BM of 5 different sheep injected with
human stromal cells alone. In all but 1 animal (lane 5) we were able to
detect mRNA for SCF. We were able, however, to amplify a fragment of
-actin message from this sample demonstrating the presence of intact
RNA.
|
|

View larger version (83K):
[in this window]
[in a new window]
| Fig 8.
X-galactosidase staining confirms engraftment of
transplanted stromal cells in multiple hematopoietic organs.
Following transplantation in utero with retrovirally marked stromal
cells, sheep were killed and stromal layers established in vitro from
their liver, spleen, thymus, and BM. These layers were then evaluated
for expression of the vector-encoded LacZ gene by histochemical
X-galactosidase staining according to standard procedures. See text for
details. The control consisted of a stromal layer derived from the BM
of a normal control sheep that was processed and stained identically to
the experimental samples.
|
|
Because the stromal layers used for retroviral transduction were
passaged several times and constituted a much more homogeneous population of stromal cells than the ones cotransplanted with the HSC,
we wished to track stromal cells that had been grown under exactly the
same culture conditions that were used in the cotransplantation
experiments. Stromal layers were grown for 9 days and then marked with
PKH26 as described in "Materials and methods." Flow cytometric
analysis of these stromal layers before transplant demonstrated that
37% to 42% of the cells were STRO-1+, whereas 8% to 10%
were CD8+, 10% to 14% were CD14+, 12% to
15% were positive for CD19, and 1% to 2% were CD34+. Two
sheep fetuses were transplanted with PKH26-labeled stromal cells and
analyzed at 2 and 6 days after transplant for PKH26+,
CD45 cells. As a control, the peritoneal lavage was
also analyzed for the presence of these cells to ensure the accuracy of
the site of injection. As can be seen in Table
3, stromal cells were found in PB, BM,
liver, and spleen, corroborating the data obtained with the
retroviral-transduced stroma. Of note is that at least a percentage of
these cells use the bloodstream to migrate to their homing site as can
be seen by the presence of 1.7%
PKH26+CD45 cells in the PB at day 2 after transplant.
View this table:
[in this window]
[in a new window]
|
Table 3.
Percentage of PKH26+ detected by flow
cytometry in different organs of sheep fetuses transplanted with
labeled stromal cells
|
|
RT-PCR detects human SCF production
Based on our finding of human cells within the stromal layers
cultured from the chimeric sheep, we wished to determine if these human
cells were providing support to the transplanted human HSC. We
performed RT-PCR to evaluate whether human SCF was being produced
within the BM stromas of the sheep transplanted with stromal cells
alone. As Figure 7B shows, we were able to detect messenger RNA (mRNA)
for human SCF in the marrow stromal layers from several of these sheep.
These results demonstrate that the injected stromal cells were not only
capable of engrafting within the sheep marrow, but also maintained
their ability to produce human-specific hematopoietic factors at least
at the mRNA level. In addition, we performed RT-PCR analysis to examine
the production of human G-CSF and GM-CSF on these same sheep, but we
were not able to detect the mRNAs for either of these factors (data not shown).
 |
Discussion |
In the present studies, the human-sheep in utero
transplantation model was used to investigate whether providing a
source of exogenous stromal progenitor cells could enhance the
engraftment and differentiation of donor human HSC following
transplantation. The long-term engraftment and multilineage
differentiation of human HSC in this model have been well
documented.10-12 However, despite the presence of donor
(human) cells in the BM, their appearance in blood does not occur until
late in gestation. Because in the human-sheep model, no irradiation is
necessary, this enables us to transplant cells into a functionally
intact microenvironment that is naturally "primed" to receive
donor HSC. The requirement for functional stromal support for
definitive hematopoiesis has been well established and evidence of
qualitative differences in hematopoiesis supported by stroma derived
from different ontological environments has been
reported.8,9 In an in utero sheep-sheep transplantation
study we reported that by providing an adult BM environment we could
achieve higher and earlier levels of circulating donor cells in the PB,
demonstrating that the transplantation of a mature stromal environment
improved engraftment and qualitatively changed
hematopoiesis.13
In the human-sheep model we have also demonstrated the formation of
human stromal elements after transplantation of pure populations of
human HSC but at relatively low levels,31 probably not
enough to provide the human transplanted stem cells with a more
suitable human microenvironment. We therefore hypothesized that
cotransplanting human stromal progenitor cells would enhance the levels
of engraftment and differentiation of the donor human cells in this
xenogeneic model of in utero human HSC transplantation.
The results presented here demonstrate that the cotransplantation of
human stromal elements with human HSC results in increased levels of
circulating human donor cells within the PB starting at early time
points after transplant and that this effect was maintained for at
least 3 years after birth. In the BM, enhancement of human
hematopoiesis by human stroma was only seen at later time points but
seemed to be long-lasting as well. As early as 6 weeks after
transplantation the analysis of chimeric sheep PB transplanted with the
combined cell populations showed mean levels of human CD45+
cells as high as 13.5% ± 5.5%, levels that continued to
increase to reach a mean maximum of 18.9% ± 6.5% at 9 weeks.
Although at 6 weeks the difference in levels of human cells between the
2 transplanted groups, with or without stroma, were mainly explained by
a higher number of lymphoid cell and erythroid cell precursors in
circulation, at 9 weeks an increase of cells of all lineages was seen
in the PB. After birth the levels of human cells in blood decreased
gradually in both groups, remained higher in the group cotransplanted
with stroma, and were still present in detectable levels at 1 year of
age. The reason for this decrease is not clear, but it could be a
function of the exponential expansion in the sheep hematopoietic
compartment as the animal's age and size increase without a
synchronous proliferation of the human stem cell compartment. We also
observed, at 1 year after transplant, identical levels of
CD34+ cells in the bone marrow of both groups of animals
suggesting that the differentiation of HSC induced by stromal cells was
not responsible for the subsequent (after birth) decreased numbers of
human cells in circulation by possible exhaustion of the stem cell
compartment. Our results also demonstrate that autologous and
allogeneic stromal cells were equally effective in producing an
enhancement in the levels of human donor cells in the PB within the
fetal sheep recipients. As we reported previously, sheep stroma is able
to maintain human hematopoiesis and support multilineage differentiation, but less efficiently than its human
counterpart.21 Thus we believe that the presence of an
adult humanized microenvironment, even if allogeneic, in our model, is
beneficial for the transplanted human HSC. Also of note is that at 3 years after transplant the mean levels of human cells in PB increased
to higher levels than seen during the first year of life. Longer time
course analysis will determine if the higher levels of human cells will
be maintained in these animals or if a cycling phenomenon resulting in
periods during which human hematopoiesis is stimulated in these animals is responsible.
Our results are of particular interest given the fact that the
transplantability of stromal cells has thus far been a source of
controversy.18-20,32-36 Although several investigators have
demonstrated in preclinical animal models and in 1 human study that
stromal cells are able to be transplanted and can subsequently generate donor-derived osteoblasts, other studies performed in BMT recipients suggested that all stromal elements were host in origin with the exception of stromal macrophages.34-36 Likewise, other
studies performed in immunodeficient mice have demonstrated that
transplanted stromal cells engraft within the lung, liver, and the
spleen, but not in the BM.17 The results presented here
confirm the presence of human donor-derived stromal cells within the BM
of the recipients, providing evidence that, in our model following in
utero transplantation, stromal cells are capable of engrafting the
marrow, and retain the ability to produce SCF at least at the mRNA
level. In addition to the BM, we were also able to demonstrate the
presence of human stromal cells within the spleen, liver, and thymus of
the recipients, showing that adult human stromal cells can engraft in
multiple hematopoietic organs within the fetal sheep recipients.
Although the transplanted stromal cells were not a homogeneous
population, and did contain monocytes/macrophages, CD8+
cells, and trace numbers of CD34+ cells, roughly 40% of
the injected cells were STRO-1+, confirming that they were
stromal progenitor cells. The use of the PKH dye in conjunction with an
antibody to CD45 enabled us to confirm that the cells that engrafted
within the various hematopoietic organs were indeed stromal cells and
not simply contaminating hematopoietic cells. In addition, by injecting
stromal cells that had been transduced with a retroviral vector
containing the LacZ gene, we were able to demonstrate that the
injected stromal cells gave rise to both adipocytes and fibroblast-like
cells following their engraftment within the marrow. It is possible
that the transplanted cells possessed a wider differentiative
potential, but were restricted to these 2 lineages by the culture
conditions we used to grow the stromal layers. Because we did not
inject pure populations of stromal cell progenitors, the possibility
that either the trace amounts of CD34+ HSC or
CD8+ facilitator cells present within our stromal cells
were responsible for the enhancement of engraftment/differentiation of
human cells in our model cannot be ruled out. After comparing large
numbers of sheep that have been transplanted with widely variant
numbers of human HSC, we can conclude that the trace quantities of
CD34+ cells within our stromal cell populations could not
account for the degree of enhancement we observed in the present
studies. Although it is possible that so-called facilitator cells may
be in part responsible for this enhanced engraftment37-39
we do not feel that this is likely, because injecting autologous PB
mononuclear cells with the human HSC did not result in enhancement of
donor cell engraftment or differentiation (unpublished observations). However the role of CD8+ cells in establishing functional
stromal cell layers37 within the fetal sheep
microenvironment cannot be ruled out. Studies cotransplanting pure
populations of human stromal cell progenitors with HSC are in progress
and will allow us to answer that question.
In conclusion, these studies demonstrate that cotransplanting an
appropriate functional hematopoietic microenvironment with HSC may
represent a means of achieving higher and earlier levels of circulating
donor cells, enhance long-term engraftment within the BM, and suggest
that stromal cells may be a useful vehicle for the delivery of secreted
exogenous gene products to the hematopoietic microenvironment, making
cotransplantation of stroma a promising tool as an adjunct to a variety
of novel therapeutic applications.
 |
Footnotes |
Submitted November 9, 1999; accepted January 31, 2000.
Supported by grants HL49042, HL52955, and DK51427 from the
National Institutes of Health and the Department of Veterans Affairs.
Reprints: Graça Almeida-Porada, VA Medical Center (151B),
1000 Locust St, Reno, NV 89520; e-mail: almei_g{at}med.unr.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
 |
References |
1.
Flake AW, Zanjani ED.
In utero hematopoietic stem cell transplantation. A status report.
JAMA.
1997;278:932-937[Abstract].
2.
Flake AW, Roncarolo MG, Puck JM, et al.
Treatment of X-linked severe combined deficiency by the in utero transplantation of CD34 enriched paternal bone marrow.
N Engl J Med.
1996;335:1806-1810[Free Full Text].
3.
Wengler G, Lanfranchi A, Frusca T, et al.
In utero transplantation of parental CD34 haematopoietic progenitor cells in a patient with X-linked severe combined immunodeficiency (SCIDX1).
Lancet.
1996;384:1484-1487.
4.
Andreani M, Manna M, Lucarelli U, et al.
Persistence of mixed chimerism in patients transplanted for the treatment of thalassemia.
Blood.
1996;87:3494-3499[Abstract/Free Full Text].
5.
Carlo-Stella C, Tabilio A, Regazzi E, et al.
Effect of chemotherapy for acute myelogenous leukemia on hematopoietic and fibroblast marrow progenitors.
Bone Marrow Transplant.
1997;20:465-471[Medline]
[Order article via Infotrieve].
6.
Greenberger JS.
Toxic effects on the hematopoietic microenvironment.
Exp Hematol.
1991;19:1101-1109[Medline]
[Order article via Infotrieve].
7.
Gibson LF, Fortney J, Landreth KS, Piktel D, Ericson SG, Lynch JP.
Disruption of bone marrow stromal cell function by etoposide.
Biol Blood Marrow Transplant.
1997;3:122-132[Medline]
[Order article via Infotrieve].
8.
Slaper-Cortenbach I, Ploemacher R, Lowenberg B.
Different stimulative effects of human bone marrow and fetal liver stromal cells on erythropoiesis in long-term culture.
Blood.
1987;69:135-139[Abstract/Free Full Text].
9.
Van Den Heuvel R, Schoeters G, Leppens H, Vanderborght O.
Stromal cells in long-term cultures of liver, spleen, and bone marrow at different developmental ages have different capacities to maintain GM-CFC proliferation.
Exp Hematol.
1991;19:115-121[Medline]
[Order article via Infotrieve].
10.
Zanjani ED, Ascensao JL, Tavassoli M.
Liver-derived fetal hematopoietic stem cells selectively and preferentially home to the fetal bone marrow.
Blood.
1993;81:399-404[Abstract/Free Full Text].
11.
Zanjani ED, Pallavicini MG, Ascensao JL, et al.
Engraftment and long-term expression of human fetal hematopoietic stem cells in sheep following transplantation in utero.
J Clin Invest.
1992;89:1178-1188.
12.
Zanjani ED, Almeida-Porada G, Flake AW.
Retention and multilineage expression of human hematopoietic stem cells in human-sheep chimeras.
Stem Cells.
1995;13:101-111[Abstract].
13.
Almeida-Porada G, Flake AW, Glimp HA, Zanjani ED.
Co-transplantation of stroma results in enhancement of engraftment and early expression of donor hematopoietic stem cells in utero.
Exp Hematol.
1999;27:1569-1575[Medline]
[Order article via Infotrieve].
14.
Almeida-Porada GD, Hoffman R, Ascensao JL, Zanjani ED.
Co-transplantation of autologous stromal cells with purified adult human hematopoietic stem cells (HSC) results in increased engraftment and early donor cell expression in sheep [abstract].
Blood.
1994;84:996a.
15.
Pereira RF, O'Hara MD, Laptev AV, et al.
Marrow stromal cells as |