|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 95 No. 11 (June 1), 2000:
pp. 3620-3627
TRANSPLANTATION
Department of Veterans Affairs Medical Center, University of Nevada
Reno, Reno, NV.
Both in utero and postnatal hematopoietic stem cell (HSC)
transplantation would benefit from the development of approaches that
produce increased levels of engraftment or a reduction in the period of
time required for reconstitution. We used the in utero model of
human-sheep HSC transplantation to investigate ways of improving
engraftment and differentiation of donor cells after transplantation.
We hypothesized that providing a more suitable microenvironment in the
form of human stromal cell progenitors simultaneously with the
transplanted human HSC would result in higher rates of engraftment or
differentiation of the human cells in this xenogeneic model. The
results presented here demonstrate that the cotransplantation of both
autologous and allogeneic human bone marrow-derived stromal cell
progenitors resulted in an enhancement of long-term engraftment of
human cells in the bone marrow of the chimeric animals and in earlier
and higher levels of donor cells in circulation both during gestation
and after birth. By using marked stromal cells, we have also
demonstrated that injected stromal cells alone engraft and remain
functional within the sheep hematopoietic microenvironment. Application
of this method to clinical HSC transplantation could potentially lead
to increased levels of long-term engraftment, a reduction in the time
for hematopoietic reconstitution, and a means of delivery of foreign
genes to the hematopoietic system.
(Blood. 2000;95:3620-3627)
Bone marrow transplantation (BMT) has been used
successfully in the treatment of a wide variety of disorders including
the storage diseases and other diseases of metabolism, diseases of immune function, and many hematologic and solid tumor malignancies. More recently, in utero hematopoietic stem cell (HSC) transplantation has emerged as an alternative for a limited number of
diseases.1-4 However, although the successful application
of this procedure could circumvent many of the limitations and risks
currently associated with postnatal BMT in these diseases, in utero HSC
transplantation, like postnatal BMT, has not yet achieved its full
therapeutic potential. Thus, both in utero and postnatal BMT would
benefit from the development of approaches that produce increased
levels of engraftment or a reduction in the period of time required for reconstitution. It has been shown that the radiation exposure and
standard- and high-dose therapies currently used in postnatal BMT
induce important sequelae within the hematopoietic and stromal progenitor cell compartments.5-7 Likewise, the fetal
microenvironment may not be fully conducive for the development of
donor cells in the case of in utero HSC transplantation.8,9
In the fetus, as in pediatric and adult recipients, donor HSC primarily
engraft the bone marrow (BM).10 However, despite the
presence of significant numbers of donor stem/progenitor cells in host
marrow following in utero HSC transplantation, little or no mature
donor-derived cells or their products are detected in the circulation
until late in gestation, near birth.11,12 The mechanism(s)
underlying this delay in the differentiation and appearance of donor
cells into the peripheral blood (PB) is not known. It is possible that the onset of marrow hematopoiesis is associated with the development of
a more permissive hematopoietic environment. In this regard, we have
recently reported that cotransplantation of adult sheep stroma resulted
in increased engraftment and early differentiation of donor cells in
sheep fetuses.13 Based on this we investigated the
possibility that the presence of a human adult microenvironment in the
human-sheep xenograft model of human hematopoiesis may render the
model more biologically relevant.14 The feasibility of
engrafting marrow-derived progenitor stromal cells/mesenchymal cells
after both in utero and postnatal transplantation has been reported by
a number of authors.14-20 Pereira et al15
reported the successful long-term engraftment of normal marrow stromal cells in several organs following intravenous infusion into mice exhibiting osteogenesis imperfecta. Nilsson et al16
demonstrated that whole BM contains cells capable of engrafting
nonablated mice and giving rise to competent osteoblasts and Horwitz et
al20 demonstrated the transplantability and therapeutic
effects of BM-derived marrow stromal cells (MSCs) in children with
osteogenesis imperfecta. Also, the simultaneous injection of human
stroma and human HSCs into bnx mice resulted in increased engraftment,
but only when the stroma was transduced before transplant with a
construct containing the human interleukin-3 (IL-3) complementary DNA
(cDNA).17 A phase one trial has also been conducted in
humans demonstrating that mesenchymal progenitor cells can be collected
from BM aspirates, subjected to ex vivo expansion, and subsequently
reinfused into patients with no adverse reactions.18 We
have shown in vitro that although sheep stroma is able to support human
hematopoiesis and induce multilineage differentiation of human
progenitor cells, it does so at levels significantly lower than that of
human stroma.21 For this reason, the human-sheep xenograft
model of in utero HSC transplantation is ideal for testing the effects
of the transplantation of stromal progenitor cells and the creation of
a suitable microenvironment to which the human HSC can home, engraft,
and proliferate/differentiate. In support of the suitability of this
model to questions of microenvironmental influence on transplanted HSC,
the in vivo administration of human cytokines such as IL-3,
granulocyte/macrophage colony-stimulating factor (GM-CSF), or stem cell
factor (SCF) to chimeric sheep resulted in an increased level of donor
cell activity in chimeric animals.11,22 In the present
studies we used the human-sheep xenograft model to determine the
effect of transplanted human stromal progenitor cells on the
engraftment and differentiation of human cells, in the hope of
providing a more suitable microenvironment for the transplanted cells.
To this end, we transplanted preimmune 55- to 60-day-old fetal sheep
with purified adult human stem cells with or without autologous or
allogeneic marrow stromal progenitor cells and examined donor HSC
engraftment and differentiation from 43 days after transplantation
until 3 years after birth.
The results presented here demonstrate that human stromal cells are
able to engraft in preimmune fetal sheep and that cotransplantation of
stroma results in not only a significant increase of donor hematopoietic activity in fetal circulation starting early in gestation
but also in higher levels of human donor cells in BM at later time
points after transplantation.
Human donor cell preparation
Stromal cell preparation
Immunofluorescence staining for flow cytometric analysis and selection of cells by cell sorting Sorting of the CD34+, HLA-DR or
CD34+, Lin, Thy+ population
was performed on a FACS Vantage after labeling with CD34 (8G12 FITC), HLA-DR (phycoerythrin [PE]) (Becton Dickinson Immunocytometry Systems
[BDIS], San Jose, CA), or with CD34, CDw90 (5E10 fluorescein isothiocyanate [FITC]) (Pharmingen, San Diego, CA) and CD2, CD14, CD15, CD16, CD19 all FITC, as well as glycophorin A (AMAC, Inc, Westbrook, ME) to exclude Lin+ cells as previously
described.24,25 Flow cytometric analysis of the cell
populations was performed on a FACScan (Becton Dickinson). Monoclonal
antibodies to various cluster designations directly conjugated with
FITC or PE were used according to the manufacturer's recommendation.
These included: CD45, CD14, CD34, CD20, CD33, CD3, CD7, CD56, CD44,
CD10, CD4, CD8 (BDIS), glycophorin A (AMAC), and STRO-1.23
Creation of the human-sheep chimeras and assessment of engraftment An overview of the experimental design is shown in Figure 1. In autologous cotransplantation studies 32 fetal sheep were transplanted at 55 to 60 days of gestation following the procedure that has been described in detail previously.10-12 CD34+, Lin,
Thy+ (0.7-6 × 104 cells/fetus) or
CD34+, HLA-DR
(6.5 × 104cells/fetus) with or without autologous
stromal cells
(5 × 104-7.5 × 105) were
injected in l mL volume by intraperitoneal injection into fetal sheep
55 to 60 days old. The transplanted sheep were analyzed for donor
(human) cell engraftment in BM, thymus, liver, spleen, and PB at 3, 6, and 9 weeks after transplantation (91, 112, and 133 days of gestation),
and after birth at 1 week, 3 months, and 1 year of age (13, 23, and 65 weeks after transplantation). Of these 32 sheep, 15 were injected with
human stroma and autologous human HSC with 1 of 2 phenotypes:
CD34+, Lin, Thy+ or
CD34+, HLA-DR. These populations were
used because we have demonstrated in previous studies that both are
equally capable of similar levels of engraftment and differentiation in
our human-sheep xenograft model.24,25 Of the remaining 17 sheep, 12 were injected with human HSC alone with 1 of the 2 phenotypes
described above. As a control, the remaining 5 sheep were injected with
human stromal cells alone. Ten additional fetuses were transplanted
with 105 CD34+, Lin,
Thy+ cells with or without 108 allogeneic
stromal progenitor cells. In 7 animals analysis of human cell
engraftment was performed at intervals after birth up to 3 years
posttransplant (Figure 1).
Tracking of human stromal cells For these experiments, 6 fetal sheep at 55 to 60 days gestational age were used. Four fetuses were injected with 107 human stromal cells that were genetically marked by in vitro retroviral transduction before transplantation and analyzed at 2 and 6 weeks after transplant. The 2 remaining fetuses were injected with an identical number of stromal cells that had been labeled with PKH26 and were analyzed at day 2 and 6 after transplant.Transduction of human stroma with G1BgSvNa retroviral vector Subconfluent stromal layers were transduced for 48 hours with rapidly thawed amphotropic retroviral supernatant diluted in an equal volume of Dulbecco's modified Eagle's medium with high glucose and 10% heat-inactivated FBS in the presence of 4 µg/mL protamine sulfate (Lyphomed, Deerfield, IL), with the vector preparation being replaced every 12 hours, for a total of 4 cycles of transduction. Passage 4 stromal cells were then selected in medium containing 1.5 mg/mL of G418 to ensure that the transplanted stromal cells were transduced.Labeling of stromal cells with PKH26 Stromal layers 80% confluent, grown for 9 days as described above, were trypsinized and collected by centrifugation. Cells were then aliquoted at 2 × 107 cells per tube and labeled with PKH26 (Sigma) according to manufacturer's instructions.Quantiblot of human DNA DNA samples were prepared by using a salting-out protocol.26 For detection and quantitation of human DNA in the several organs, Quantiblot (Perkin Elmer, Foster City, CA) was used according to manufacturer's instructions.Detection of NeoR sequences by polymerase chain reaction (PCR) Five hundred nanograms of total genomic DNA isolated from different sheep organs was subjected to analysis by PCR as follows: PCR primers 5'CTGAATGAACTGCAGGACGA3' and 5'AGCCAACGCTATGTCCTGAT3', which amplify a 504 base pair (bp) fragment of the bacterial neomycin phosphotransferase (NeoR) gene, were used at 0.5 µmol/L. Standard dNTP and MgCl2 (2.5 mmol/L) concentrations were used, and 1 unit of Amplitaq DNA polymerase (Perkin Elmer) was added to each 50-µL reaction. The reactions were run for 40 cycles consisting of denaturation at 95°C for 1 minute, annealing at 57°C for 1 minute, and extension at 72°C for 1.5 minutes. The positive control consisted of the plasmid pUC18Neo diluted in normal sheep DNA to a concentration of 1%.Reverse transcriptase PCR (RT-PCR) To examine the expression of human growth factors in the chimeric sheep, total cellular RNA was extracted by the guanidinium thiocyanate-acidic phenol-chloroform method. For the RT-PCR 1 µg of RNA was reverse transcribed in a 20-µL reaction mixture using a commercially available kit according to the manufacturer's recommendations (Perkin Elmer). For the PCR reaction, MgC12, Amplitaq DNA polymerase, PCR buffer, and 40 pmol of each primer were added to the total first strand cDNA mixture, giving a final volume of 100 µL, and PCR for SCF, GM-CSF, and granulocyte colony-stimulating factor (G-CSF) was then performed.Southern blotting of PCR products Southern blotting was performed according to standard procedures27 using Gene Screen Plus (DuPont) nylon membrane. Oligonucleotide probes specific for the Neo, SCF, GM-CSF, or G-CSF products were labeled with [32P]dATP by an end-labeling reaction. Following transfer, the DNA was cross-linked to the membrane by short-wave UV irradiation and the membrane was prehybridized at 65°C for 1 hour in 6× standard sodium citrate (SSC), 0.5% sodium dodecyl sulfate (SDS), and l00 µg/mL salmon sperm DNA; 2 × 106 cpm of labeled probe was added per milliliter of prehybridization solution, and dextran sulfate was added to a final concentration of 10%. The filter was then hybridized overnight at 65°C. The filter was washed 4 times at 65°C for 15 minutes each under conditions of increasing stringency. The filter was then autoradiographed for 1 to 12 hours (depending on the signal intensity) at 80°C with 2 intensifying screens
(DuPont Cronex Lightning Plus).
 -galactosidase activity as follows. Cells were washed
once with phosphate-buffered saline (PBS) and were then fixed for 5 minutes at room temperature in a solution of 0.5% glutaraldehyde in
PBS. Following fixation, cells were rinsed once with PBS and were then
washed twice for 5 minutes each in PBS. -Galactosidase activity was
then detected by incubating the cells overnight at 37°C in
-galactosidase staining solution, which consisted of PBS containing
5 mmol/L K4Fe(CN)6*3H2O, 5 mmol/L K3Fe(CN)6, 2 mmol/L MgCl2, and l
mg/mL X-galactosidase. After overnight staining, the cells were washed
once with PBS and were then counterstained with nuclear fast red. The
slides were rinsed with H2O and visualized on an Olympus
light microscope.
Statistical analysis Results are expressed as mean ± SEM. Because of small group sizes, comparisons between experimental results were determined by a nonparametric rank sum test. A P value of less than .05 was considered statistically significant.
Cotransplantation of autologous human stroma yields increased levels of human cells in circulation before birth: results from PB and BM at 3, 6, and 9 weeks after transplant To determine the effect of cotransplanting stroma on early donor HSC engraftment and appearance of donor cells within the PB, recipients of HSC and HSC plus stroma were killed at 3, 6, and 9 weeks after transplant and their BM and PB were analyzed by flow cytometry for the engraftment/differentiation of human cells. The results of flow cytometric analyses of the BM and PB of the sheep killed before birth are shown in Figures 2 and 3, respectively. At the time point of 3 weeks after transplant, there were no significant differences in the levels of donor cell engraftment in the BM (Figure 2) and appearance in PB (Figure 3) between the groups that received HSC alone (n = 2) or with stroma (n = 2). In contrast, as early as 6 weeks after transplant, there were marked increases in the levels of human cells observed in the PB (Figure 3) of the animals that had received HSC with stroma (CD45: 13.5 ± 5.5%; n = 4) when compared to the group that had received HSC alone (CD45: 1.2 ± 0.6%; n = 3) (P < .03). Although the presence of human cells in PB was multilineage in both groups, the pronounced difference in the levels of human cells between these 2 groups can be attributed primarily to the higher levels of lymphoid progenitors (CD7) and erythroid (glycophorin A-positive) cell precursors in sheep that received human HSC plus stroma. The sheep that received HSC plus stroma had an average of 10% CD7+ cells versus only 3.4% in the sheep that received HSC alone. Likewise, sheep receiving HSC plus stroma had an average of 2.25% glycophorin A-positive cells, whereas those that received HSC alone had 0.6%. Even more pronounced differences were observed in the PB at 9 weeks after transplant, with human CD45 levels as high as 18.9 ± 6.5% in the sheep receiving stroma plus HSC (n = 4) compared to only 0.3 ± 0.1% in those injected with HSC alone (n = 3) (P < .03) (Figure 3). At this time, however, pronounced increases in donor cells were seen not only in the lymphoid and erythroid precursor cell populations, but also in the myeloid and monocytic lineages (Table 1).
Levels of engraftment of human cells in PB and BM at 3 days, 3 months, and 12 months after birth in sheep transplanted with human HSC
with or without human autologous stroma
Cotransplantation of human allogeneic stroma with human HSC
Detection of human DNA in human-sheep chimeras
Tracking of human stromal cells in sheep fetuses
RT-PCR detects human SCF production
In the present studies, the human-sheep in utero
transplantation model was used to investigate whether providing a
source of exogenous stromal progenitor cells could enhance the
engraftment and differentiation of donor human HSC following
transplantation. The long-term engraftment and multilineage
differentiation of human HSC in this model have been well
documented.10-12 However, despite the presence of donor
(human) cells in the BM, their appearance in blood does not occur until
late in gestation. Because in the human-sheep model, no irradiation is
necessary, this enables us to transplant cells into a functionally
intact microenvironment that is naturally "primed" to receive
donor HSC. The requirement for functional stromal support for
definitive hematopoiesis has been well established and evidence of
qualitative differences in hematopoiesis supported by stroma derived
from different ontological environments has been
reported.8,9 In an in utero sheep-sheep transplantation
study we reported that by providing an adult BM environment we could
achieve higher and earlier levels of circulating donor cells in the PB,
demonstrating that the transplantation of a mature stromal environment
improved engraftment and qualitatively changed
hematopoiesis.13
Submitted November 9, 1999; accepted January 31, 2000.
Supported by grants HL49042, HL52955, and DK51427 from the
National Institutes of Health and the Department of Veterans Affairs.
Reprints: Graça Almeida-Porada, VA Medical Center (151B),
1000 Locust St, Reno, NV 89520; e-mail: almei_g{at}med.unr.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
1.
Flake AW, Zanjani ED.
In utero hematopoietic stem cell transplantation. A status report.
JAMA.
1997;278:932-937
2.
Flake AW, Roncarolo MG, Puck JM, et al.
Treatment of X-linked severe combined deficiency by the in utero transplantation of CD34 enriched paternal bone marrow.
N Engl J Med.
1996;335:1806-1810
3.
Wengler G, Lanfranchi A, Frusca T, et al.
In utero transplantation of parental CD34 haematopoietic progenitor cells in a patient with X-linked severe combined immunodeficiency (SCIDX1).
Lancet.
1996;384:1484-1487.
4.
Andreani M, Manna M, Lucarelli U, et al.
Persistence of mixed chimerism in patients transplanted for the treatment of thalassemia.
Blood.
1996;87:3494-3499
5.
Carlo-Stella C, Tabilio A, Regazzi E, et al.
Effect of chemotherapy for acute myelogenous leukemia on hematopoietic and fibroblast marrow progenitors.
Bone Marrow Transplant.
1997;20:465-471[Medline]
[Order article via Infotrieve].
6.
Greenberger JS.
Toxic effects on the hematopoietic microenvironment.
Exp Hematol.
1991;19:1101-1109[Medline]
[Order article via Infotrieve].
7.
Gibson LF, Fortney J, Landreth KS, Piktel D, Ericson SG, Lynch JP.
Disruption of bone marrow stromal cell function by etoposide.
Biol Blood Marrow Transplant.
1997;3:122-132[Medline]
[Order article via Infotrieve].
8.
Slaper-Cortenbach I, Ploemacher R, Lowenberg B.
Different stimulative effects of human bone marrow and fetal liver stromal cells on erythropoiesis in long-term culture.
Blood.
1987;69:135-139
9.
Van Den Heuvel R, Schoeters G, Leppens H, Vanderborght O.
Stromal cells in long-term cultures of liver, spleen, and bone marrow at different developmental ages have different capacities to maintain GM-CFC proliferation.
Exp Hematol.
1991;19:115-121[Medline]
[Order article via Infotrieve].
10.
Zanjani ED, Ascensao JL, Tavassoli M.
Liver-derived fetal hematopoietic stem cells selectively and preferentially home to the fetal bone marrow.
Blood.
1993;81:399-404
11.
Zanjani ED, Pallavicini MG, Ascensao JL, et al.
Engraftment and long-term expression of human fetal hematopoietic stem cells in sheep following transplantation in utero.
J Clin Invest.
1992;89:1178-1188.
12.
Zanjani ED, Almeida-Porada G, Flake AW.
Retention and multilineage expression of human hematopoietic stem cells in human-sheep chimeras.
Stem Cells.
1995;13:101-111[Medline]
[Order article via Infotrieve].
13.
Almeida-Porada G, Flake AW, Glimp HA, Zanjani ED.
Co-transplantation of stroma results in enhancement of engraftment and early expression of donor hematopoietic stem cells in utero.
Exp Hematol.
1999;27:1569-1575[Medline]
[Order article via Infotrieve].
14.
Almeida-Porada GD, Hoffman R, Ascensao JL, Zanjani ED.
Co-transplantation of autologous stromal cells with purified adult human hematopoietic stem cells (HSC) results in increased engraftment and early donor cell expression in sheep [abstract].
Blood.
1994;84:996a.
15.
Pereira RF, O'Hara MD, Laptev AV, et al.
Marrow stromal cells as a source of progenitor cells for nonhematopoietic tissues in transgenic mice with a phenotype of osteogenesis imperfecta.
Proc Natl Acad Sci U S A.
1998;95:1142-1147
16.
Nilsson SK, Dooner MS, Weier HU, et al.
Cells capable of bone production engraft from whole bone marrow transplants in nonablated mice.
J Exp Med.
1999;189:729-734
17.
Nolta JA, Hanley MB, Kohn DB.
Sustained human hematopoiesis in immunodeficient mice by co-transplantation of marrow stroma expressing human interleukin-3: analysis of gene transduction of long-lived progenitors.
Blood.
1994;83:3041-3051
18.
Lazarus HM, Haynesworth SE, Gerson SL, Rosenthal NS, Caplan AI.
Ex vivo expansion and subsequent infusion of human bone marrow-derived stromal progenitor cells (mesenchymal progenitor cells): implications for therapeutic use.
Bone Marrow Transplant.
1995;16:557-564[Medline]
[Order article via Infotrieve].
19.
Prockop DJ.
Marrow stromal cells as stem cells for nonhematopoietic tissues.
Science.
1997;276:71-74
20.
Horwitz EM, Prockop DJ, Fitzpatrick LA, et al.
Transplantability and therapeutic effects of bone marrow-derived mesenchymal cells in children with osteogenesis imperfecta.
Nat Med.
1999;5:309-313[Medline]
[Order article via Infotrieve].
21.
Almeida-Porada G, Ascensao JL, Zanjani ED.
The role of sheep stroma in human haemopoiesis in the human/sheep chimaeras.
Br J Haematol.
1996;93:795-802[Medline]
[Order article via Infotrieve].
22.
Flake AW, Hendrick MH, Rice HE, Tavassoli M, Zanjani ED.
Enhancement of human hematopoiesis by mast cell growth factor in human-sheep chimeras created by the in utero transplantation of human fetal hematopoietic cells.
Exp Hematol.
1995;23:252-257[Medline]
[Order article via Infotrieve].
23.
Simmons PJ, Torok-Storb B.
Identification of stromal cell precursors in human bone marrow by a novel monoclonal antibody, STRO-1.
Blood.
1991;78:55-62
24.
Srour EF, Zanjani ED, Cornetta K, et al.
Persistence of human multilineage, self-renewing lymphohematopoietic stem cells in chimeric sheep.
Blood.
1993;82:3333-3342
25.
Sutherland DR, Yeo EL, Stewart AK, et al.
Identification of CD34+ subsets after glycoprotease selection: engraftment of CD34+ Thy-1+ Lin
26.
Lahiri DK, Bye S, Nurnberger JI Jr, Hodes ME, Crisp M.
A non-organic and non-enzymatic extraction method gives higher yields of genomic DNA from whole-blood samples than do nine other methods tested.
J Biochem Biophys Methods.
1992;25:193-205[Medline]
[Order article via Infotrieve].
27.
Sambrook J, Fritsch EF, Maniatis T.
Molecular Cloning. A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989.
28.
Majumdar MK, Thiede MA, Mosca JD, Moorman M, Gerson SL.
Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells.
J Cell Physiol.
1998;176:57-66[Medline]
[Order article via Infotrieve].
29.
Prockop DJ.
Marrow stromal cells as stem cells for continual renewal of nonhematopoietic tissues and as potential vectors for gene therapy.
J Cell Biochem Suppl.
1998;30-31:284-285.
30.
Gronthos S, Graves SE, Ohta S, Simmons PJ.
The STRO-1+ fraction of adult human bone marrow contains the osteogenic precursors.
Blood.
1994;84:4164-4173
31.
Almeida-Porada GD, Hoffman R, Manalo P, Gianni AM, Zanjani ED.
Detection of human cells in human/sheep chimeric lambs with in vitro human stroma-forming potential.
Exp Hematol.
1996;24:482-487[Medline]
[Order article via Infotrieve].
32.
Anklesaria P, FitzGerald TJ, Kase K, Ohara A, Greenberger JS.
Improved hematopoiesis in anemic Sl/Sld mice by splenectomy and therapeutic transplantation of a hematopoietic microenvironment.
Blood.
1989;74:1144-1151
33.
Fleischman RA, Mintz B.
Prevention of genetic anemias in mice by microinjection of normal hematopoietic stem cells into the fetal placenta.
Proc Natl Acad Sci U S A.
1979;76:5736-5740
34.
Simmons PJ, Przepiorka D, Thomas ED, Torok-Storb B.
Host origin of marrow stromal cells following allogeneic bone marrow transplantation.
Nature.
1987;328:429-432[Medline]
[Order article via Infotrieve].
35.
Galotto M, Berisso G, Delfino L, et al.
Stromal damage as consequence of high-dose chemo/radiotherapy in bone marrow transplant recipients.
Exp Hematol.
1999;27:1460-1466[Medline]
[Order article via Infotrieve].
36.
Koc ON, Peters C, Aubourg P, et al.
Bone marrow-derived mesenchymal stem cells remain host-derived despite successful hematopoietic engraftment after allogeneic transplantation in patients with lysosomal and peroxisomal storage diseases.
Exp Hematol.
1999;27:1675-1681[Medline]
[Order article via Infotrieve].
37.
Gaines BA, Colson YL, Kaufman CL, Ildstad S.
Facilitating cells enable engraftment of purified fetal liver stem cells in allogeneic recipients.
Exp Hematol.
1996;24:902-913[Medline]
[Order article via Infotrieve].
38.
Kaufman CL, Colson YL, Wren SM, Watkins S, Simmons RL, Ildstad ST.
Phenotypic characterization of a novel bone marrow-derived cell that facilitates engraftment of allogeneic bone marrow stem cells.
Blood.
1994;84:2436-2446
39.
Yaroslavskiy B, Colson Y, Ildstad S, Parrish D, Boggs SS.
Addition of a bone marrow "facilitating cell" population increases stem cell-derived cobblestone area formation in impaired long-term bone marrow culture stroma.
Exp Hematol.
1998;26:604-611[Medline]
[Order article via Infotrieve].
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
