Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirby, S.
Right arrow Articles by Smithies, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirby, S.
Right arrow Articles by Smithies, O.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Transplantation
Right arrow Gene Therapy
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 95 No. 12 (June 15), 2000: pp. 3710-3715

GENE THERAPY

Hematopoietic stem cells with controllable tEpoR transgenes have a competitive advantage in bone marrow transplantation

Suzanne Kirby, William Walton, and Oliver Smithies

From the Department of Medicine, the Lineberger Comprehensive Cancer Center, and the Department of Pathology, University of North Carolina, Chapel Hill, NC.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

In a previous study, it was found that a truncated erythropoietin receptor transgene (tEpoR tg) enables multilineage hematopoietic progenitor amplification after treatment with erythropoietin (epo) in vitro and in vivo. This study used competitive bone marrow (BM) repopulation to show that tEpoR tg facilitates transplantation by hematopoietic stem cells (HSC). Individual multilineage colonies, committed myeloid progenitor colonies, and lymphoid colonies (pre-B colony-forming units) were grown from the marrow of animals 6 months after they received a 50/50 mixture of transgene and wild-type BM cells. In epo-treated recipients, the transgene-bearing cells significantly outcompeted the wild-type cells (84%-100% versus 16%-0%, respectively). In recipients treated with phosphate-buffered saline, the repopulation was minimally different from the donor mixture (49%-64% transgene versus 51%-36% wild-type). The epo-induced repopulation advantage is maintained in secondary transplants. In addition, neither accelerated HSC depletion nor uncontrollable proliferation occurred during epo-stimulated serial transplants of transgene-containing BM. Thus, the tEpoR tg functions in a benign fashion in HSC and allows for a significant and controllable repopulation advantage in vivo without excessive HSC depletion relative to wild-type BM. (Blood. 2000;95:3710-3715)

© 2000 by The American Society of Hematology.


    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Bone marrow transplantation (BMT) is often limited by low donor availability and the toxicity of the procedure. One approach to partially ameliorate these limitations is by controlling the survival or proliferation of hematopoietic stem cells (HSC). This has been attempted by a number of investigators, both in vivo with cells containing transgenes allowing for a selection advantage1-4 and in vitro through cytokine-mediated expansion.5-9 The former approach has to date been implemented by selecting progenitors or HSC resistant to toxic substances; consequently, it does not enhance proliferation and therefore would not help with low numbers of HSC, for example, with umbilical cord blood transplants given to adult patients. A problem with the latter approach has been the loss of long-term repopulating ability with the induced expansion, thought to be due to HSC exhaustion/depletion.10-12 Our efforts have centered on using a benign transgene as a means of giving donor bone marrow (BM) cells a controllable transplantation advantage over untreated endogenous BM cells. Toward this end, we previously generated mice expressing a truncated erythropoietin receptor transgene (tEpoR tg).13 We now use BM from these animals in competitive transplants to test whether short-term treatment with erythropoietin (epo) at the time of transplant can give the transgene-containing HSC an advantage over wild-type HSC in repopulating lethally irradiated animals. The results of the competitive transplantation show that this does occur, that the effect is sustainable in secondary transplants and in older animals, and that in repeated epo-stimulated serial transplants, the repopulating ability of the HSC is not significantly exhausted by the presence of the tEpoR tg.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Animals

Transgenic mice expressing tEpoR were generated as previously described.13 These animals contain a functional hypoxanthine phosphoribosyltransferase(HPRT) transgene and 2 copies of a tEpoR tg driven by a human beta -actin promoter inserted into the X-linked HPRT locus. All animals were maintained in microisolator cages with autoclaved food. Male transgenic animals used for repopulation experiments had been back-crossed more than 6 times to C57BL/6 inbred animals. Competitor animals were inbred C57BL/6 males that carry, as a distinguishing marker, an inactivating deletion of the HPRT locus, which does not affect their hematopoiesis. Female inbred C57BL/6 animals of at least 8 weeks of age were used as recipients. For serial transplantation experiments, female B6.SJL-PtprcaPep3b/ByJ (Ly5.1) mice (Jackson Laboratory, Bar Harbor, ME), which express the Ly 5.1 antigen on their hematopoietic cells, were used as recipients; the corresponding wild-type and transgene C57BL/6 donors express the Ly5.2 antigen.

Competitive repopulation assays

Lethally irradiated mice (9.5 Gy total body irradiation from a 137Cs source) were anesthetized with tribromoethanol (Avertin) before receiving by retro-orbital injection a 50/50 mixture of BM cells from the donor transgene and the wild-type competitor (2 × 106 cells total). Starting on the day of transplant, the recipient animals were treated by intraperitoneal injection for 2 weeks with either epo (10 U/mouse, about 400 U/kg, given 3 times per week) or a similar volume (0.1 mL) of sterile phosphate-buffered saline (PBS). The transplanted animals were maintained in microisolator cages with autoclaved food and acidified sterile water supplemented with neomycin sulfate for the first 2 weeks after transplant. In one experiment, wild-type littermates expressing a functional HPRT gene were used as the competitor with no significant repopulation difference noted between this experiment and those when the competitor lacks a functional HPRT gene. Secondary transplants were performed in a similar manner except with the donor BM coming from animals having previously received a 50/50 mixture of wild-type and transgene BM and PBS treatment at the time of the original transplant. Secondarily transplanted animals were treated with the same dose and schedule of either epo or PBS as the primary recipients.

Clonogenic assays

Anesthetized animals that were 6 months or more after transplant were killed and BM was harvested from their femora into RPMI media containing 10% fetal calf serum (FCS) and penicillin/streptomycin. Clonogenic assays for committed myeloid progenitor colonies (CFC), colony-forming units-granylocyte, erythrocyte, macrophage, megakaryocyte (CFU-GEMM), and pre-B colony-forming units (pre-B CFU) were established in methylcellulose media (Media 3434 and 3630; Stem Cell Technologies, Vancouver, BC, Canada) as previously described.13 Pre-B colonies and CFC were counted at day 7. CFU-GEMM colonies were counted at day 14. Individual colonies were picked in a sterile fashion with a glass micropipette for analysis by polymerase chain reaction (PCR).

Hematologic analysis

Peripheral blood was collected into EDTA by retro-orbital puncture after anesthesia. Complete blood counts and differential counts were performed on a Roche Hematology Analyzer equipped with software for murine blood analyses.

PCR analyses

Individual colonies picked from cultures were washed with PBS to remove excess methylcellulose, centrifuged, and then resuspended in 50 µL of sterile water in Eppendorf tubes. Samples were heated to 95°C for 10 minutes and cooled briefly on ice. Proteinase K (PK; 40 µg/sample) was added and digestion was carried out at 55°C for 4 hours. PK was inactivated by heating again at 95°C for 10 minutes. Two microliters of the digested samples were used for PCR analysis. PCR reactions were carried out in a Perkin-Elmer 9700 PCR machine. Amplification was performed (after an initial 1 minute at 95°C) for 35 cycles of 1 minute at 95°C, 1 minute at the indicated annealing temperature, and 2 minutes at 72°C. Annealing temperatures were 68°C for the Y chromosome marker (to identify male donor-origin colonies), 66°C for the adrenomedullin (AM) gene (a genotype-independent positive control), 63°C for tEpoR tg (to identify tEpoR donor-origin colonies), and 64°C for the Neo gene (to confirm tEpoR donor-origin colonies). Primers for the Y chromosome 5' AGACAAGTTTTGGACTGGTGAC3' and 5'AGCCCTCCGATGAGGCTGATA3' amplify a 277 bp product; AM primers 5'CCCACGACTTAGCGCCCACTTATT-CCAC3' and 5'ATGAAGCTGGTTTCCATCGCC3' amplify a 266 bp product; tEpoR primers 5'CCTCTGTCTCCTACTTGCTGG3' and 5'CTCAGAACACACTCAGTG-CGG3' amplify a 578 bp product; Neo primers 5'GTGTTCCGGCTGTCAGCGCA3' and 5'GTCCTGATAGCGGTCCGCCA3' amplify a 550 bp product. PCR reaction products were separated on 1.0% agarose gels and visualized after ethidium bromide staining.

Serial transplantation assays

The Ly5.1 primary recipient animals were lethally irradiated (9.5-Gy total body irradiation) and transplanted with either 2 or 4 × 106 BM cells from either wild-type Ly5.2 or transgene Ly5.2 donors. After 6 to 8 weeks of engraftment, BM was harvested from the femora of these recipients and analyzed by flow cytometry. BM from some of the recipient animals was transplanted into secondary, lethally irradiated Ly5.1 recipients. Tertiary transplants were performed in a similar fashion using BM harvested after 6 to 8 weeks of engraftment in the secondary recipients. The primary, secondary, and tertiary serial transplant recipients all received epo in the standard 2-week protocol.

Flow cytometry analysis

Bone marrow was harvested from the femora and tibiae of the serially transplanted recipients (primary, secondary, tertiary). After lysis of red blood cells with ACK solution, nucleated cells were stained with the following fluorochrome-labeled monoclonal antibody combinations: anti-Ly5.2-fluorescein isothiocyanate (FITC) and anti-CD3-phycoerythrin (PE) (Pharmingen). Cells were stained for 30 minutes at 4°C (1 µg antibody/106 cells) and then washed 3 times before analyses (FACScan; Becton Dickinson Biosciences, San Jose, CA) with Cyclops software (Cytomation, Ft Collins, CO).

Statistical analysis

Two-tailed Student t tests were performed for comparisons of complete blood counts and clonogenic cell contents of posttransplant BM from epo-treated compared to PBS-treated transplanted animals and for comparison of percentage donor engraftment between wild-type and transgene donors in the serial transplantation experiments. The z test was used to compare the observed versus input proportions of transgene repopulation in the primary transplant recipients. Sigmastat software (for Windows 98) was used for statistical calculations.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Competitive repopulation assay

Mice expressing tEpoR tg were created as previously described.13 BM was harvested from male tEpoR tg-bearing and wild-type mice, and mixtures of BM cells were prepared to contain 50% tEpoR tg cells and 50% wild-type competitor cells. This mixture of cells (2 × 106 nucleated cells/animal) was retro-orbitally injected into lethally irradiated female recipient mice. Starting at the time of transplant, the recipient animals were treated with injections of either PBS or epo (10 U/mouse) 3 times per week for 2 weeks. No further injections were given after the initial 2 weeks, although endogenous epo is naturally present. Animals were then maintained for up to 12 months after transplant, with most analyses being performed at 6 to 8 months. After the chosen time, BM was harvested from the femora of transplanted animals for clonal assays to assess the total clonogenic cell content and the source (transgene donor, wild-type donor, or recipient) of the clonogenic cells.

Hematologic analyses after competitive repopulation

To determine that adequate BM engraftment had occurred, peripheral blood and marrow specimens from the primary 50/50 transplant recipients were examined histologically and complete blood counts were performed with a Roche hematology analyzer. At the time of BM harvest (6 months after transplant), there were no significant differences in the white blood cell count, platelet counts, hemoglobin concentrations, or leukocyte differential counts between untreated mice and the primary BM recipients treated with either epo or with PBS (data not shown). Thus functional engraftment following the 50/50 transplant was complete.

Recovery of clonogenic cells after competitive repopulation

To look for changes in the recipient BMs in the animals receiving the 50/50 mix and treated with epo or with PBS, we performed a series of clonogenic assays. The upper portion of Table 1 presents the resulting data from animals 6 months after the primary 50/50 transplantation. There were significant modest increases (range, 131%-159%) in the total recovery of myeloid CFU-GEMM (P = .013) and CFC (P < .001) in the epo-treated compared to the PBS-treated primary transplanted animals. The epo treatment had no significant effect on the total recovery of lymphoid pre-B CFU. There were also modest increases (116%-139%) in all transgenic CFU with epo treatment after secondary transplant. There was no significant increase (data not shown) in the total nucleated cell content of the BM in response to the epo treatment (based on 4 bones harvested). Thus, the presence of the transgene in the donor cells caused a modest increase in recovery of clonogenic cells when the recipient was treated with exogenous epo, but the repopulated BM from untreated animals showed no indications of excessive proliferation of transgenic compared to wild-type clonogenic cells.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Bone marrow clonogenic cells recovered from competitively transplanted animals

Epo-inducible competitive repopulation by the donor transgenic HSC

To determine the source of the clonogenic cells recovered from recipients 6 months or more after the primary 50/50 transplantation, we performed PCR analyses of individual colonies (Figure 1). The upper portion of Table 2 presents the percentages of clonogenic cells derived from the transgene-bearing donor HSC in the BM of the primary recipients after PBS or epo treatment at the time of transplant. No colonies of the recipient genotype were recovered (data not shown), indicating that the irradiation dose used pretransplantation was adequate to suppress endogenous hematopoiesis. The PBS-treated recipients of the primary 50/50 mix of transgene and wild-type BM cells showed repopulation of all lineages with transgene cells at close to the input 50% level (range 49%-64%). Of the clonogenic precursors analyzed in these primary recipients, only the proportion of transgene CFU-GEMM (64%) differed significantly (P = .04) from the expected 50% proportion. This suggests that a slight increase in the transgene-bearing donor population of progenitors occurred even in the absence of exogenous epo, probably under the influence of the increased endogenous epo levels present after irradiation.14-17 In the epo-treated recipients, in contrast, all categories of CFU were nearly completely repopulated with progeny from the tEpoR tg HSC (range 84%-100%; P versus PBS-treated <=  .05 and versus the input 50/50 ratio < .001). Thus, the brief epo treatment at the time of transplantation gives the tEpoR tg HSC a considerable repopulation advantage over wild-type cells. The transgene donors in these experiments were back-crossed 6 to 9 times. No differences from these experiments have been seen in more recent experiments with animals back-crossed more than 10 times (data not shown).


View larger version (19K):
[in this window]
[in a new window]
 
Fig 1. PCR analyses of individual colonies. DNA was processed from individually picked colonies (CFU-GEMM, CFC, and pre-B CFU) and analyzed by PCR for (1) quality of DNA preparation using the AM (an autosomal gene) primers, (2) donor rather than recipient origin using Y chromosome-specific primers, and (3) transgene donor origin using both tEpoR and Neo primers. Shown is a representative sample of the PCR products from a male tEpoR tg donor (lanes 2, 5, 8, 11), male wild-type donor (lanes 3, 6, 9, 12), and female wild-type recipient (lanes 4, 7, 10, 13). Lane 1 contains Gibco 100-bp marker fragments. The primers used are indicated above the lane numbers. The bands corresponding to the primers are marked by arrows. Note, for example, the presence of the transgene-specific and Neo-specific bands in lanes 2 and 5, indicative of male-derived transgene-bearing colonies, and the absence of the Y-specific band in lane 13, indicative of a female-derived colony.


                              
View this table:
[in this window]
[in a new window]
 
Table 2. Competitive repopulation in primary and secondary transplants

The tEpoR tg can provide an advantage in secondary transplants

To determine whether the transgene-bearing HSC are still present after a primary transplant, we performed secondary transplants 6 months after the 50/50 initial transplant. The secondary recipients received 2 × 106 nucleated BM cells from primary recipients that had been treated with PBS. The secondary recipients were treated with PBS or with epo, and their BM was harvested and analyzed in the same way as in the primary transplanted animals. The total clonogenic CFU-GEMM and CFC recoveries in the secondarily transplanted recipients, PBS or epo-treated, were not significantly different from those recovered in the primary recipients (Table 1, lower part compared with upper part). There was a decrease in pre-B CFU in both PBS and epo-treated secondary recipients compared with the primary transplant animals. This was not unexpected because several studies have shown that lymphoid populations decrease with aging and after serial transplantation in mice.18-20

The source of the recovered clonogenic cells after the secondary transplant was determined in the same manner as was used in the primary transplant. The resulting data (Table 2, lower part) show that the proportion of all categories of transgene-bearing cells is now significantly greater than the input 50/50 mix (P < .001 versus 50/50) even in the PBS-treated recipients; this was again expected because the HSC have been twice exposed to increased endogenous epo. Nevertheless the secondary recipients still show a further increase in transgene-bearing cells of all categories when treated with exogenous epo. These data demonstrate that transgene-bearing HSC can be easily detected during a secondary transplant 6 months after the primary transplantation and that epo can enhance their effectiveness in repopulation.

The tEpoR tg does not accelerate HSC exhaustion

To determine whether epo stimulation of transgene-bearing HSC results in their exhaustion, we performed serial transplants of un-fractionated BM cells from wild-type or transgene donors carrying the Ly5.2 antigenic marker into recipients carrying the Ly5.1 marker, with the recipients receiving 2 weeks of epo supplementation at the time of each serial transplant. After 6 to 8 weeks of engraftment, BM was harvested from the femora of recipients and analyzed by flow cytometry to determine the percent donor versus recipient contribution to myeloid and lymphoid cells. Representative analyses are shown in Figure 2. The overall data are presented in Table 3 and show that the trangsene and wild-type donor BM are not significantly different in their engraftment capabilities during the successive transplants, although both the transgene and wild-type donors show some HSC loss with each serial transplant. We conclude that the transgene donor HSC following serial transplantation (accompanied by epo stimulation at each transplant) are not depleted relative to wild-type HSC. It is also notable that this repeated exposure to pharmacologic doses of epo did not lead to any uncontrollable expansion in the transgene donor BM cells as judged by the normality of their BM and peripheral blood cell counts. Nor were any quantitative abnormalities seen in the lymphoid populations (data not shown). Lastly, in some of these animals both peripheral blood and BM were harvested, with no significant differences seen in the relative repopulation of each compartment by either transgene or wild-type donors (data not shown). In addition, in more recent sublethal irradiation experiments BM, peripheral blood, and spleen hematopoietic cells were harvested simultaneously and analyzed by flow cytometry. The percentage repopulation with Ly5.2+ donor cells did not differ significantly in these compartments (unpublished data).


View larger version (30K):
[in this window]
[in a new window]
 
Fig 2. Flow cytometry analyses of BM cells after serial transplantation. Lethally irradiated Ly5.1 primary recipient animals received either wild-type or transgene Ly5.2 donor cells (2-4 × 106 unfractionated BM cells). After 6 to 8 weeks, BM was harvested from the recipient animals, stained with fluorochrome-labeled antibodies as shown, and analyzed by flow cytometry to determine their origin (donor or endogenous). Secondary recipients received BM from several of these primary recipient animals. Tertiary transplants were performed in a similar fashion after 6 to 8 weeks of engraftment in secondary recipients. All recipient animals received epo supplementation for a period of 2 weeks after BM transplant. Shown is a representative sample of the BM from wild-type (A) and transgene donor (B) transplanted secondary recipients analyzed by flow cytometry. Note the presence in the recipient animals of both donor (right upper quadrant) and recipient (left upper quadrant) T cells and donor and recipient myeloid/B cells (right lower quadrant and left lower quadrant, respectively) present in the recipient animals.


                              
View this table:
[in this window]
[in a new window]
 
Table 3. Percent donor composition of BM after serial transplantation

Transgene-bearing HSC function is maintained with aging

Any potential agent for enhancing BM transplantation should not lead to any undesirable loss of BM function or to malignant transformation later in life. To test for these possibilities we examined untreated, nontransplanted wild-type and transgene animals at 19 to 22 months of age. Table 4 shows the recovery of clonogenic cells from these older animals. There was a slight deficit in transgene-bearing CFU-GEMM (21%; P = .40) and CFC (28%; P = .012) and a slight excess in transgene-bearing pre-B CFU (119%; P = .30), but none of these changes are sufficient to signal biologically significant expansion or exhaustion of clonogenic precursors. Hematologic analyses of the primarily transplanted animals (both PBS and epo treated) performed 1 year after their initial transplant showed no differences in peripheral blood counts and differential counts compared to the counts at 6 months (data not shown), indicating that the donor cells were neither increased nor lost over time after the initial expansion. Furthermore, no signs of any myeloproliferative disorders, leukemia, or lymphoma have developed in any of our animals with the tEpoR tg even when (data not shown) treated with epo for as long as 8 weeks. We conclude from these tests that the EpoR tg is completely benign within the limits of the current experiments.

                              
View this table:
[in this window]
[in a new window]
 
Table 4. CFU from aged animals


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Bone marrow transplantation is a powerful therapeutic modality, which could be more widely applicable if the procedure were less toxic, if HSC could be expanded in vitro or in vivo, or if the HSC could be given a repopulation advantage over endogenous cells during transplantation. Expansion of HSC in vitro has been attempted by improving the environment for culturing the BM cells, by using new types of stroma,21-25 or by adding exogenous growth factors.5-9 Although expansion of progenitor cells has been fairly easily obtained in this manner, there has not yet been proven expansion of long-term repopulating cells. Indeed, there have been several reports of the loss of long-term repopulating function during attempts to achieve in vitro expansion.10-12 These difficulties motivated our interest in generating an in vivo repopulation advantage. Generating a selection advantage for transplanted cells has been successful by transduction with genes conferring resistance to chemotherapeutic agents,1-4 but the selective agents used are themselves toxic. Our aim, therefore, has been to develop a suitable transgene that will enable a benign repopulation advantage to be conferred on HSC during transplantation without leading to their subsequent depletion or aberrant proliferation. We have chosen to test this concept by using a tEpoR tg targeted to a known locus so that in the future we can easily compare other transgenes. We previously showed that the tEpoR tg enables expansion of multilineage clonogenic progenitors under the stimulation of exogenous epo, both in vivo and in vitro. We also showed that even after 5 months of exposure to epo in vitro, the cultured BM cells from the transgene animals never transformed into malignant progeny or became factor independent.

This present study demonstrated that this transgene is effective in long-term repopulating HSC by showing that BM containing the transgene outcompetes wild-type BM cells during the repopulation of lethally irradiated recipients. We have further demonstrated that this advantage can be controlled during the transplantation by the administration of exogenous epo. Thus, a very short-term exposure to doses of epo in the therapeutic range was sufficient to produce considerably enhanced repopulation by transgene HSC relative to coinjected wild-type HSC. The recapitulation of this effect in secondary transplants, along with the maintenance of normal hematopoiesis in aged transgene animals (transplanted and nontransplanted), further showed that the presence of the transgene did not adversely affect overall HSC function several months after both primary and secondary transplants. In addition, serial transplants using repeated stimulation with pharmacologic doses of epo led neither to accelerated HSC exhaustion nor to uncontrollable proliferation from the transgene compared to wild-type donors. Furthermore, none of the transplanted animals, nor any of the untreated or epo-treated transgene animals, developed any malignant process or abnormal proliferation and differentiation of any hematopoietic lineage. The mechanisms of the tEpoR-induced repopulation advantage via HSC expansion, prevention of apoptosis, and interactions with facilitating cells remain to be determined.

Much needs to be done to optimize the constructs based on tEpoR and to determine whether the effect can be obtained (and remain benign) when the transgene is introduced into the genome at other sites than the current one, or by other means of gene transfer. For example, it is feasible that with the current system the transduced HSC or their progeny (or both) could abnormally proliferate in special clinical settings with prolonged exogenous epo supplementation, such as that seen with renal failure. There have been a number of recent reports of EpoR tgs introduced by retroviral vectors affecting multipotent or committed progenitors, but none of the transfected cells has been shown to yield any advantage during long-term repopulation.26-30 The work we have presented here proves that a cytokine receptor transgene can confer on BM cells, including HSC, a benign and controllable advantage over unmodified cells during transplantation.


    Acknowledgments

We thank Chad Cecil for technical assistance in this work and Jon Serody, Chris Walsh, and Beverly Mitchell for valuable comments regarding our manuscript.


    Footnotes

Submitted July 22, 1999; accepted February 4, 2000.

Supported in part by National Institutes of Health grant number HL37001 (O.S.) S.K. was supported by the Leukemia Society of America Special Fellow Award and the Burroughs-Wellcome Fund Career Development Award.

Reprints: Suzanne Kirby, Division of Hematology/Oncology, CB #7295, LCCC, University of North Carolina, Chapel Hill, NC 27599-7295; e-mail: skirb{at}med.unc.edu.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Corey CA, DeSilva AD, Holland CA, Williams DA. Serial transplantation of methotrexate-resistant bone marrow: protection of murine recipients from drug toxicity by progeny of transduced stem cells. Blood. 1990;75:337-343[Abstract/Free Full Text].

2. Sorrentino BP, Brandt SJ, Bodine D, et al. Selection of drug-resistant bone marrow cells in vivo after retroviral transfer of human MDR1. Science. 1992;257:99-103[Abstract/Free Full Text].

3. Koc ON, Allay JA, Lee K, et al. Transfer of drug resistance genes into hematopoietic progenitors to improve chemotherapy tolerance. Semin Oncol. 1996;23:46-65[Medline] [Order article via Infotrieve].

4. Allay JA, Persons DA, Galipeau J, et al. In vivo selection of retrovirally transduced hematopoietic stem cells. Nat Med. 1998;4:1136-1143[Medline] [Order article via Infotrieve].

5. Einerhand MP, Bakx TA, Kukler A, Valerio D. Factors affecting the transduction of pluripotent hematopoietic stem cells: long-term expression of a human adenosine deaminase gene in mice. Blood. 1993;81:254-263[Abstract/Free Full Text].

6. Rebel VI, Dragowska W, Eaves CJ, et al. Amplification of Sca-1+ Lin-WGA+ cells in serum-free cultures containing steel factor, interleukin-6, and erythropoietin with maintenance of cells with long-term in vivo reconstituting potential. Blood. 1994;83:128-136[Abstract/Free Full Text].

7. Traycoff CM, Cornetta K, Yoder MC, et al. Ex vivo expansion of murine hematopoietic progenitor cells generates classes of expanded cells possessing different levels of bone marrow repopulating potential. Exp Hematol. 1996;24:299-306[Medline] [Order article via Infotrieve].

8. Petzer AL, Hogge DE, Lansdorp PM, et al. Self-renewal of primitive human hematopoietic cells (long-term culture-initiating cells) in vitro and their expansion in defined medium. Proc Natl Acad Sci U S A. 1996;93:1470-1474[Abstract/Free Full Text].

9. Bhatia M, Bonnet D, Kapp U, et al. Quantitative analysis reveals expansion of human hematopoietic repopulating cells after short-term ex vivo culture. J Exp Med. 1997;186:619-624[Abstract/Free Full Text].

10. Kittler EL, Peters SO, Crittendon RB, et al. Cytokine-facilitated transduction leads to low-level engraftment in nonablated hosts. Blood. 1997;90:865-872[Abstract/Free Full Text].

11. Peters SO, Kittler EL, Ramshaw HS, Quesenberry PJ. Ex vivo expansion of murine marrow cells with interleukin-3 (IL-3), IL-6, IL-11, and stem cell factor leads to impaired engraftment in irradiated hosts. Blood. 1996;87:30-37[Abstract/Free Full Text].

12. Rebel VI, Lansdorp PM. Culture of purified stem cells from fetal liver results in loss of in vivo repopulating potential. J Hematother. 1996;5:25-37[Medline] [Order article via Infotrieve].

13. Kirby SL, Cook D, Walton W, Smithies O. Proliferation of multipotent hematopoietic cells controlled by a truncated erythropoietin receptor transgene. Proc Natl Acad Sci U S A. 1996;93:9402-9407[Abstract/Free Full Text].

14. Osvaldo CA. Effects of radiation and hypoxia on the metabolic fate of erythropoietin. Acta Radiol. 1971;10:497-503.

15. Naets JP, Wittek M. Compared effects of irradiation and cyclophosphamide induced erythroid aplasia on the catabolism of exogenous erythropoietin. Br J Haematol. 1977;37:93-99[Medline] [Order article via Infotrieve].

16. Mirand AE, Ambrus JL, Hoffman JG, Murphy GP. Effect of whole body radiation and hypoxia on erythropoietin production in the subhuman primate Amarinus nigricollis. Res Commun Chem Pathol Pharmol. 1973;5:515-528.

17. McDonald TP, Lange RD, Congdon CC, Toya RE. Effect of hypoxia, irradiation, and bone marrow transplantation on erythropoietin levels in mice. Radiat Res. 1970;42:151-163[Medline] [Order article via Infotrieve].

18. Averill LE, Wolf NS. The decline of murine splenic PHA and LPS responsiveness following serial transplantation of young and old bone marrow cells. Mech Age Devel. 1985;32:235-247.

19. Grossmann A, Maggio-Price L, Jinneman JC, Rabinovitch PS. Influence of aging on intracellular free calcium and proliferation of mouse T-cell subsets from various lymphoid organs. Cell Immunol. 1991;135:118-131[Medline] [Order article via Infotrieve].

20. Rolink A, Haasner D, Nishikawa S, Melchers F. Changes in the frequencies of clonable pre-B cells during life in different lymphoid organs of mice. Blood. 1993;81:2290-2300[Abstract/Free Full Text].

21. Kobari L, Dubart A, Le Pesteur F, et al. Hematopoietic-promoting activity of the murine stromal cell line MS-5 is not related to the expression of the major hematopoietic cytokines. J Cell Physiol. 1995;163:295-304[Medline] [Order article via Infotrieve].

22. Moore KA, Ema H, Lemischka IR. In vitro maintenance of highly purified, transplantable hematopoietic stem cells. Blood. 1997;89:4337-4347[Abstract/Free Full Text].

23. Thiemann FT, Moore KA, Smorgorzewska EM, et al. The murine stromal cell line AFT024 acts specifically on human CD34+CD38- progenitors to maintain primitive function and immunophenotype in vitro. Exp Hematol. 1998;26:612-619[Medline] [Order article via Infotrieve].

24. Aiuti A, Fiedrich C, Sieff CA, Guiterrez-Ramos JC. Identification of distinct elements of the stromal microenvironment that control human hematopoietic stem/progenitor cell growth and differentiation. Exp Hematol. 1998;26:143-157[Medline] [Order article via Infotrieve].

25. Breems DA, Blokland EAW, Siebel KE, et al. Stroma-contact prevents loss of hematopoietic stem cell quality during ex vivo expansion of CD34+ mobilized peripheral blood stem cells. Blood. 1998;91:111-117[Abstract/Free Full Text].

26. Dubart A, Feger F, Goncalves LF, et al. Murine pluripotent hematopoietic progenitors constitutively expressing a normal erythropoietin receptor proliferate in response to erythropoietin without preferential erythroid cell differentiation. Mol Cell Biol. 1994;14:4834-4842[Abstract/Free Full Text].

27. McArthur GA, Longmore GD, Klingler K, Johnson GR. Lineage-restricted recruitment of immature hematopoietic progenitor cells in response to epo after normal hematopoietic cell transfection with EpoR. Exp Hematol. 1995;23:645-654[Medline] [Order article via Infotrieve].

28. Lu L, Ge Y, Li ZH, et al. Retroviral transfer of the recombinant human erythropoietin receptor gene into single hematopoietic stem/progenitor cells from human cord blood increases the number of erythropoietin-dependent erythroid colonies. Blood. 1996;87:525-534[Abstract/Free Full Text].

29. Lacout C, Dubart A, Vainchenker W, Dumenil D. Pluripotent stem cells constitutively expressing a normal erythropoietin receptor give rise to normal hematopoiesis in lethally irradiated recipient mice. Exp Hematol. 1996;24:18-25[Medline] [Order article via Infotrieve].

30. Lu L, Ge Y, Li ZH, et al. Influence of retroviral-mediated gene transduction for both the recombinant human erythropoietin receptor and interleukin-9 receptor genes into single CD34++CD33- or low cord blood cells on cytokine-stimulated erythroid colony formation. Exp Hematol. 1996;24:347-351[Medline] [Order article via Infotrieve].


© 2000 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
FASEB J.Home page
Y. Jia, R. Warin, X. Yu, R. Epstein, and C. T. Noguchi
Erythropoietin signaling promotes transplanted progenitor cell survival
FASEB J, September 1, 2009; 23(9): 3089 - 3099.
[Abstract] [Full Text] [PDF]


Home page
ASH ANNUAL MEETING ABSTRACTSHome page
G. L. Chen, K. Chang, X. Huang, G. J. Spangrude, and J. T. Prchal
Erythropoietin Signaling Inhibits Long Term Marrow Reconstitution.
Blood (ASH Annual Meeting Abstracts), November 16, 2006; 108(11): 3194 - 3194.
[Abstract] [PDF]


Home page
ASH ANNUAL MEETING ABSTRACTSHome page
K.-T. Chang, Y. D. Pastore, R. H. Nussenzveig, and J. T. Prchal
Erythropoietin Signaling Inhibits the Short-Term Marrow Reconstitution.
Blood (ASH Annual Meeting Abstracts), November 16, 2005; 106(11): 3028 - 3028.
[Abstract]


Home page
BloodHome page
T. Neff and C. A. Blau
Pharmacologically regulated cell therapy
Blood, May 1, 2001; 97(9): 2535 - 2540.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Hatada, K. Nikkuni, S. A. Bentley, S. Kirby, and O. Smithies
Gene correction in hematopoietic progenitor cells by homologous recombination
PNAS, November 16, 2000; (2000) 240462897.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Hatada, K. Nikkuni, S. A. Bentley, S. Kirby, and O. Smithies
Gene correction in hematopoietic progenitor cells by homologous recombination
PNAS, December 5, 2000; 97(25): 13807 - 13811.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirby, S.
Right arrow Articles by Smithies, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirby, S.
Right arrow Articles by Smithies, O.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Transplantation
Right arrow Gene Therapy
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2000 by American Society of Hematology         Online ISSN: 1528-0020