|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 12 (June 15), 2000:
pp. 3734-3741
HEMATOPOIESIS
Sp1 and C/EBP are necessary to activate the lactoferrin gene
promoter during myeloid differentiation
Arati Khanna-Gupta,
Theresa Zibello,
Carl Simkevich,
Alan G. Rosmarin, and
Nancy Berliner
From the Section of Hematology, Yale University School of Medicine,
New Haven, CT; the Division of Hematology, Brown University and the
Department of Medicine and the Division of Hematology/Oncology, The
Miriam Hospital, Providence, RI.
 |
Abstract |
In this study, we sought to identify factors responsible for the
positive modulation of lactoferrin (LF), a neutrophil-specific, secondary-granule protein gene. Initial reporter gene transfection assays indicated that the first 89 base pairs of the LF promoter are
capable of directing myeloid-specific LF gene expression. The presence
of a C/EBP site flanked by 2 Sp1 sites within this segment of the LF
promoter prompted us to investigate the possible role of these sites in
LF expression. Cotransfection studies of LF-89luc plasmid with
increasing concentrations of a C/EBP expression vector in myeloid
cells resulted in a linear transactivation of luciferase reporter
activity. Electrophoretic mobility shift assays found that the C/EBP
site is recognized by C/EBP and that both LF Sp1 binding sites bind
the Sp1 transcription factor specifically in myeloid cells. Mutation of
either Sp1 site markedly reduced activity of the LF-89luc plasmid in
myeloid cells, and neither Sp1 mutant plasmid was transactivated by a
C/EBP expression plasmid to the same extent as wild-type LF-89luc.
We also transfected LF-89luc into Drosophila Schneider cells,
which do not express endogenous Sp1, and demonstrated up-regulation of
luciferase activity in response to a cotransfected Sp1 expression
plasmid, as well as to a C/EBP expression plasmid. Furthermore,
cotransfection of LF-89luc plasmid simultaneously with C/EBP and
Sp1 expression plasmids resulted in an increase in luciferase activity
greater than that induced by either factor alone. Taken together, these observations indicate a functional interaction between C/EBP and Sp1 in
mediating LF expression.
(Blood. 2000;95:3734-3741)
© 2000 by The American Society of Hematology.
| |
Introduction |
During granulopoiesis, the developing neutrophil
undergoes a series of commitment steps that limit its proliferative
capacity while increasing its morphologic and biochemical
maturity.1 The acquisition of primary (azurophilic) and
secondary (specific) granules marks progressive stages of neutrophil
differentiation. Acute myeloid leukemias are characterized by the lack
of secondary granules and their content proteins. Hence, an
understanding of the molecular mechanisms underlying neutrophil
development is crucial to defining defects associated with leukemia.
Lactoferrin (LF) is one of the secondary-granule protein (SGP) genes, a
group of genomically unlinked and functionally diverse genes expressed
late in neutrophil maturation. We previously demonstrated that SGP gene
expression is coordinately regulated at the transcriptional level
during neutrophil maturation.2-5 Additionally, we showed that CCAAT displacement protein (CDP/cut), a highly conserved silencing factor that binds the LF promoter, coordinately represses expression of all SGP genes.6,7 In this study, we sought to
identify factors responsible for the up-regulation of LF in order to
describe possible shared positive regulators of SGP gene expression. We
identified a C/EBP binding site flanked by 2 Sp1 binding sites within
the first 89 base pairs (bps) of the LF promoter and investigated the
possible importance of these sites in regulating LF expression during
granulocytic maturation.
The role of transcription factors in hematopoietic proliferation,
differentiation, and survival is becoming increasingly
clear.8,9 Maturation of the multipotent progenitor stem
cell into specialized blood cells (eg, lymphocytes, erythrocytes,
neutrophils, monocytes, eosinophils, and others) is thought to be
partly regulated by a well-orchestrated interplay of transcription
factors capable of instructing expression of a specific set of
lineage-specific genes.9 Current evidence suggests that a
combination of transcription factors, both lineage restricted and
ubiquitous, is required to achieve differentiation within a given
hematopoietic lineage. In the myeloid compartment, several
granulocyte-macrophage-specific genes are regulated by combinations of
the transcription factors C/EBP, PU.1, c-Myb, AML-1, and
Sp1,9 and target genes have been found to have multiple
cis-acting elements for these transcription factors in their
promoters. Gene-disruption experiments showed that PU.1 and C/EBP
transcription factors are indispensable for normal progression of the
myeloid development program.10-12
CCAAT-enhancer binding proteins belong to a family of the basic
region-leucine zipper (bZip) class of transcription factors that
recognize the consensus DNA-binding sequence 5' ATTGCGCAAT 3' in the regulatory regions of target genes. C/EBP family
proteins bind as either homodimers or heterodimers. This family of
transcription factors currently includes C/EBP C/EBP , C/EBP
C/EBP , C/EBP , and CHOP-GADD 153, all of which contain highly
homologous C-terminal dimerization (leucine-zipper) domains and
DNA-binding (basic-region) motifs but differ in their N-terminal
transactivation domains (except for CHOP-GADD 153, which lacks this
domain).13 With the exception of C/EBP, which is
expressed at high levels mainly in the late stages of granulopoiesis,
C/EBP family members are expressed in a wide variety of cells,
including liver, adipocyte, lung, intestine, adrenal gland, placenta,
and peripheral blood mononuclear cells.13 Profound
hematopoietic abnormalities have been reported in mice nullizygous for
C/EBP, C/EBP, and C/EBP. C/EBP family members are known to
exert pleiotropic effects in the tissues in which they are expressed.
This may be because of their tissue- and stage-specific expression,
their ability to dimerize both with members of their own family and
with the Fos/Jun and ATF/CREB families of transcription factors, their
ability to interact with other transcription factors, such as NF- B
and Sp1, or a combination of these factors.9
Sp1 is a ubiquitous DNA-binding transcriptional activator that
recognizes GC-rich sequences in the promoters of several TATA-less genes.14,15 Although Sp1 is considered to be a constitutive activator of gene expression, several studies indicated that
Sp1-dependent transactivation is mediated through a variety of signals,
including transforming growth factor- induction on the p15
gene16 and cyclic adenosine monophosphate activation of the
CYP11A gene.17 Sp1 is abundantly expressed in myeloid
cells,18 and several studies have implicated this
transcription factor in mediating myeloid-specific gene expression. For
example, in cooperation with the ets factor GABP, Sp1 achieved
high levels of myeloid-specific expression of the CD18
promoter.19 Additionally, the C/EBP family of proteins was
found to interact functionally with Sp1 to regulate the activity of the
CD11c integrin gene promoter.20 The aim of this study was
to identify the role of Sp1 and C/EBP in mediating expression of the LF
gene in myeloid cells.
| |
Materials and methods |
Plasmid construction
5'-end deletions of the LF promoter were obtained from a
previously described LF genomic clone containing 950 bps 5' of
the transcription start site.2 Subcloning of the LF649
fragment into a pGL3basic promoter-less vector upstream of the
luciferase reporter gene (Promega Biotech, Madison, WI) was described
previously.6 This clone was used to prepare shorter LF
promoter constructs, which were then subcloned into pGL3basic. The
LF649-pGL3basic plasmid was digested with Spe1 (which cuts at
position  237 in the LF promoter) and BglII. The
resultant 240-bp fragment was subcloned into the pGL3basic vector
previously digested with NheI and BglII enzymes to
yield the LF237-pGL3basic plasmid. Next, 5 µg of this plasmid was
linearized with SpeI and treated with 0.5 U Bal 31 (NEB, Beverly, MA) at 37°C for up to 5 minutes to generate a series
of 5'-end deletions in the LF promoter. At 1-minute intervals,
aliquots of the reaction were removed and added to 20 mmol/L
ethyleneglycotetraacetic acid (EGTA) to stop the Bal 31 reaction. Bal 31-digested DNA fragments were digested
with BglII enzyme and subsequently subcloned into
SmaI/BglII-digested pGL3basic vector. The resulting
series of LF 5'-deleted clones were sequenced. Clones LF167 and
LF89 were picked for further analysis. A mutant C/EBP site was created
in the LF89-pGL3basic clone as follows. Sense and antisense oligomers
containing the first 89 bps of the LF promoter with an NheI
site at the 5' end and an XhoI site at the 3' end
were synthesized with a mutation in the C/EBP site: 5' TTGGGCAAC
3' (wild type) was changed to 5' CCTTTAGGC 3' (mutant
C/EBP).
Complementary oligomers were annealed and ligated into the pGL3basic
vector, which had been previously digested with
NheI/XhoI. Six subclones containing inserts were
sequenced to confirm the presence of the mutation in the C/EBP site in
the LF promoter. A similar strategy was used to construct mutations in
the 2 Sp1 sites in the LF89-pGL3 clone. The distal Sp1 site was mutated from 5' AGTGGGGA 3' (wild type) to 5' AGTAAAAA
3' (mutant Sp1A), and the pGL3basic plasmid was referred to as
mutant LFSp1A. Similarly, the proximal Sp1 site was mutated from
5' GGGCGGGG 3' (wild type) to 5' TTATATAT 3'
(mutant Sp1B), and the pGL3basic plasmid was referred to as mutant
LF89Sp1B. Large-scale plasmid preparations (Qiagen, Valencia,
CA) of all LF promoter-pGL3basic plasmids were made,
divided into aliquots, and stored at 20°C. The mutations introduced into the C/EPB, Sp1A, Sp1B sites did not give rise to or
overlap with the binding site for any known transcription factor, as
judged by a comparison with transcription factors in 2 data bases.
Tissue culture, transient transfections, and luciferase assay
Mouse erythroleukemic (MEL) cells were obtained from the American
Type Culture Collection (ATCC) and were maintained and grown in
Dulbecco modified Eagle medium (Gibco, Grand Island, NY) supplemented with 10% heat-inactivated fetal-calf serum (FCS; Gemini Bioproducts, Calabasas, CA), 0.2 mmol/L glutamate, 50 units/mL penicillin, and 50 µg/mL streptomycin. 32Dwt18 cells, a gift from Dr Daniel Link
(University of Washington, St Louis, MO), were grown in Iscove modified
Dulbecco medium supplemented with 10% FCS and 10% WEHI-conditioned medium, as a source of interleukin 3 (IL-3).21
U937-C/EBP cells, which were described previously,22
were a gift from Dr Daniel G. Tenen (Harvard Medical School, Boston,
MA). These cells were maintained in RPMI 1640 medium (Gibco)
supplemented with 10% FCS (Gemini Bioproducts) and 850 µg/mL G418
(Gibco). All cells were maintained at 37°C in a humidified 5%
carbon dioxide (CO2) incubator. U937-C/EBP cells were
induced to express the C/EBP gene, under the control of the
metallothionein promoter, by the addition of 100 µmol/L zinc sulfate.
Maturation of all inductions was monitored with use of Wright-Giemsa staining.
For transient transfection experiments, approximately
1 × 107 cells were gently pelleted, washed twice
with phosphate-buffered saline (PBS), and resuspended in 180 µL
N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES)-buffered saline in electroporation cuvettes. Then, 10 to
20 µg of each reporter plasmid construct and 2 µg of pCMVgal (Clontech, Palo Alto, CA), an internal control plasmid used to monitor
transfection efficiency, were added to each aliquot of cells. After a
5-minute incubation at room temperature, the DNA-cell samples were
electroporated by using a Bio-Rad Gene Pulser (Hercules, CA). MEL and
U937-C/EBP cells were electroporated at 200 mV with 960-µF
capacitance. 32Dwt18 cells were electroporated at 400 mV with a
capacitance of 250 µF. Transiently transfected cells were incubated
in growth medium at 37°C in 5% CO2 for 16 to 20 hours. Luciferase activity was then determined with an assay kit (Promega Biotech), according to the manufacturer's instructions. Luciferase expression levels were normalized to the levels of -galactosidase expression or as per microgram of total protein, as described previously.6
Schneider cells (ATCC CRL-1963; Drosophila melanogaster embryo
line 2) were grown in Shang M3 medium (Difco Labs, Detroit, MI)
supplemented with 10% FCS and Bactopeptone (12.5 g/L; Difco Labs) and
5 g/L technetium Yeastolate (Difco Labs) and incubated at 25°C.
These cells were transfected by using 30 µL Lipofectamine (Gibco), 10 µg of LF89-pGL3basic plasmids, and 5 µg of effector plasmids
pPac-Sp1 (containing full-length Sp1 complementary DNA [cDNA] in the
pPAC expression vector [a gift from Robert Tjian, Berkeley, CA]) or
pPac-C/EBP (or both), which was constructed by isolating the
full-length rat C/EBP cDNA from pMSVC/EBP plasmid (a gift from Dr
Alan Friedman, Johns Hopkins University, Baltimore, MD) with
BamHI and subcloning it into the BamHI site of the pPac expression vector. The correct orientation of the C/EBP cDNA was
determined by sequence analysis of the resultant clones. Salmon-sperm DNA (Sigma, St Louis, MO) was used to normalize the total amount of DNA
in each transfected sample. Luciferase activity was measured 48 hours
after transfection.
Preparation of nuclear extracts
Nuclear extracts were prepared essentially as described
previously.6 Briefly, 1 × 107 cells
were washed twice in ice-cold PBS and once in buffer A containing 10 mmol/L HEPES-potassium hydroxide (KOH) (pH 7.9), 1.5 mmol/L magnesium
chloride (MgCl2), 10 mmol/L potassium chloride (KCl), 0.5 mmol/L dithiothreitol (DTT), and 0.5 mmol/L phenylmethylsulfonyl fluoride (PMSF). Cells were lysed after 5 minutes of incubation on ice
in buffer A with 0.1% NP-40. Nuclei were recovered by centrifugation at 4°C for 15 minutes. The nuclei were then lysed in high-salt buffer C (20 mmol/L HEPES-KOH [pH 7.9], 10% glycerol, 420 mmol/L sodium chloride, 10 mmol/L KCl, 0.2 mmol/L EDTA, and 0.5 mmol/L DTT),
and nuclear extracts were recovered by centrifugation at 4°C for 15 minutes. The salt concentration in the nuclear extracts was adjusted by
adding buffer D (20 mmol/L HEPES-KOH [pH 7.9], 20% glycerol, 0.05 mmol/L KCl, 0.2 mmol/L EDTA, 0.5 mmol/L DTT, and 0.5 mmol/L PMSF). All
buffers used included the following mixture of protease inhibitors at a
final concentration of : pepstatin A (10 µg/mL),
leupeptin (10 µg/mL), aprotinin (1 µg/mL), and perfabloc (1 mg/mL)
(Boehringer Mannheim, Indianapolis, IN). Total protein concentration in
the nuclear-extract preparations was assayed by using a Bio-Rad kit
according to the manufacturer's instructions. Most preparations
yielded 1.5 to 2 µg/µL protein. Aliquots of nuclear-protein
extracts were frozen immediately and stored at 70°C until used.
Oligonucleotides and electrophoretic mobility shift assays
(EMSAs)
Complementary oligonucleotides were annealed and labeled at their
5' ends by using -phosphorus 32 adenosine triphosphate (222 × 1012 Bq/mmol; Amersham,
Buckinghamshire, United Kingdom) and T4 polynucleotide kinase (NEB).
Radiolabeled double-stranded oligonucleotides were separated from
unincorporated nucleotide by passage through a Sephadex G-25 spin
column (Boehringer Mannheim). Probes were stored at 20°C.
EMSAs were performed by incubating 15-µg nuclear extracts or 1 foot-printing unit of affinity-purified Sp1 protein (Promega Biotech)
with 20 000 cpm of double-stranded oligonucleotide in a 20-µL
reaction mixture containing 10 mmol/L HEPES-KOH buffer (pH 7.9), 50 mmol/L KCl, 2.5 mmol/L MgCl2, 1 mmol/L DTT, 10% glycerol, 1 µg acetylated bovine serum albumin (NEB), and 0.5 µg poly(dI-dC) at 25°C for 20 minutes. For competition analysis, a 100-fold molar excess of unlabeled oligonucleotides was added to the nuclear extracts
before addition of the labeled probe. For the supershift assay,
polyclonal C/EBP and Sp1 antibodies (Santa Cruz Biotech, Santa Cruz,
CA) were incubated with nuclear extracts for 15 minutes after the
addition of radiolabeled probe. Binding reactions were resolved on a
4% nondenaturing polyacrylamide gel containing 1 × TBE (0.089 mol/L Tris-borate, 0.089 mol/L boric acid, and 0.002 mol/L EDTA) and
electrophoresed at 150 V for 3 hours at 4°C. Gels were exposed to
x-ray film with an intensifying screen overnight at 80°C.
The oligonucleotide used in the EMSA analysis had the following
sequence (the C/EBP and Sp1 sites are underlined):
5' GGGAGGGAAGGGTGTCT AGG 3' LF-C/EBP, 5'
GC -  GGGAA
3' LF Sp1A oligomer; 5' CAAC -  AAAGC
3' LF Sp1B oligomer; and 5'
ATTCGAT-  AGC 3'
consensus Sp1 site. The CD18 probe that includes the proximal CD18 Sp1
binding site corresponding to CD18-85/3719 was
5' AACCCACCACTTCCTCCAAGGAGGAGCTGAGA- GGAACAGGAAGTGTCAG
3'. The irrelevant (nonspecific) probe that lacks an Sp1 binding
site (corresponding to CD18-903/88319 was 5'
GCGAAGCTTGCAGTGAGCTGAGATCACGGATCCGCG 3'.
| |
Results |
Transient transfection of LF promoter plasmids in myeloid and
nonmyeloid cells
In an attempt to identify factors responsible for the up-regulation
of LF during myeloid maturation, LF promoter fragments (LF89, LF167,
LF237, and LF 649) cloned into the promoterless pGL3basic vector
harboring the luciferase reporter gene were transiently transfected
into myeloid (32Dwt18) and nonmyeloid (MEL) cells. 32Dwt18 is an
IL-3-dependent subline of 32Dcl3 cells. Transfected cells were
harvested 24 hours after transfection and luciferase reporter gene
activity was measured. As shown in Figure
1A, all LF promoter plasmids expressed high
levels of luciferase activity in 32Dwt18 cells but not in MEL cells.
LF89 conferred the highest level of luciferase activity in 32Dwt18
cells (56-fold above that of pGL3basic alone). Similarly high levels of
luciferase activity for the LF89 plasmid were detected in other myeloid
cell lines, such as NB4 and EPRO (data not shown). LF89-luc
activity in the nonmyeloid Cos-7 cell line, on the other hand, was
similar to that observed in MEL cells (data not shown). A 4-fold
decline in luciferase activity between LF89 and LF167 suggested the
presence of a negative regulatory element or elements between these
coordinates. Differences in reporter gene activity between LF237 and
LF649 suggested the presence of additional regulatory elements within those coordinates of the LF promoter. Notable sequences in this portion
of the promoter are an overlapping estrogen receptor and retinoic acid
response element, which is thought to mediate LF expression in mammary
gland and hematopoietic cells,23 and a mitogen response
unit capable of binding AP-1 and CREB in mammary epithelial
cells.24
View larger version (29K):
[in this window]
[in a new window]
| Fig 1.
Lactoferrin (LF) promoter transfection and nucleotide
sequence.
(A) Transient transfection of LF promoter plasmids in 32Dwt18 (myeloid)
and MEL (nonmyeloid) cells. LF promoter fragments (LF89, LF167, LF237,
and LF 649) were cloned into the promoterless pGL3B vector and
transiently transfected into 32Dwt18 and MEL cells, along with
pCMVgal plasmid. Cells were harvested 24 hours after transfection
and luciferase reporter gene activity was measured. The figure
represents the mean ± SE value from 3 independent experiments, each
performed in duplicate. Normalized luciferase values are represented as
a ratio of luciferase activity to pGL3B luciferase activity. (B)
Nucleotide sequence of the human LF promoter and its 5' flanking
sequence. The position of the LF89 (89 base pairs [bps]) is
indicated. Putative binding sites for Sp1, Ets, C/EBP, and Myb
transcription factors are indicated.
|
|
Because the first 89-bp region of the LF promoter is capable
of directing myeloid-specific expression, we examined more closely the
sequence of this region of the human LF promoter, the sequence of which
we described previously.2 Figure 1B illustrates the sequence of the first 170 bps of the LF promoter. Putative binding sites for C/EBP, Sp1, ETS, and c-Myb were recognized within the first
89 bps of the LF promoter. Using supershift EMSA analysis, we
demonstrated that the ETS site in the LF promoter does not bind PU.1,
Ets-1, Ets-2, or GABP but may bind another unidentified member of the
Ets family of transcription factors (data not shown). Additionally,
transient cotransfection analysis in 32Dwt18 cells and in NIH-3T3 cells
using expression plasmids for PU.1 or c-Myb did not appear to
transactivate the LF89-luc plasmid markedly (data not shown). Because
preliminary analysis of the ETS and Myb sites in the LF promoter
suggested that they did not play an important role in regulating LF
gene expression, we did not further investigate these sites in the
current study.
Binding of Sp1 and C/EBP to their respective binding sites in the
LF89 promoter fragment indicated by EMSA analysis
To demonstrate binding of the Sp1 and C/EBP transcription factors to
the putative binding sites within the first 89 bps of the LF promoter,
we performed an EMSA using fragments of the LF89 promoter fragment
containing the 2 Sp1 sites (Sp1A and Sp1B) and the C/EBP site. Nuclear
extracts from the U937 cell line were used as a source of nuclear
proteins. U937 is a human myelomonocytic cell line that can be made to
undergo partial granulocytic maturation on induction with
all-trans retinoic acid (ATRA).22 ATRA-induced U937
cells, however, do not express LF (Khanna-Gupta A, Berliner N,
unpublished data). In a study by Radomska et al,22 U937
cells were stably transfected with a plasmid harboring rat C/EBP
cDNA under the influence of a zinc-inducible human metallothionein promoter. Conditional expression of C/EBP in these
U937-C/EBP cells induced a granulocytic maturation program,
complete with the expected morphologic and biochemical changes,
including expression of LF at the messenger RNA level.22
Using a probe spanning coordinates 89 bp to 66 bp (Sp1A
probe) of the LF promoter, an EMSA using U937 nuclear extracts was performed. As shown in Figure 2A, several
DNA-protein complexes were formed as a result of the interaction of
probe Sp1A and U937 nuclear extracts (lane 2); however, only one of the
complexes appeared to be specifically eliminated competitively
by the addition of a 100-fold molar excess of unlabeled
Sp1A probe (lane 3). The same complex was eliminated competitively
by the addition of a 100-fold molar excess of either a
probe containing a consensus Sp1 binding site (Figure 2A, lane 4) or a
probe harboring an Sp1 site from the CD18 promoter19 (lane
5) but not by the addition of a nonspecific probe (lane 6).
Preincubation of this complex with an anti-Sp1 antibody but not with
preimmune serum (data not shown) resulted in the appearance of a
supershifted complex (Figure 2A, lane 7, arrow marked
"supershift"). Furthermore, the complex in question (Figure 2A,
arrow marked "Sp1") in fact migrated to the same extent in the
nondenaturing gel as did a complex formed by using purified Sp1
protein. Taken together, these observations suggest that the Sp1
protein specifically binds to the LF promoter between the 89-bp
and 66-bp coordinates.
View larger version (59K):
[in this window]
[in a new window]
| Fig 2.
Electrophoretic mobility shift assays (EMSAs) of
fragments within the first 89 bps of the LF promoter.
(A) An EMSA was performed by using double-stranded phosphorus
32-labeled LF 89 bp to 66 bp (SP1A) as a probe with
nuclear extracts from U937 cells. Binding of Sp1 (lower arrow) was
subjected to competition with a 100-fold molar excess of self cold
competitor (CC) (lane 3), Sp1 consensus probe (lane 4), and a CD18 Sp1
cold competitor (lane 5) but not a 100-fold molar excess of a
nonspecific (n.s.) probe (lane 6). Preincubation of Sp1A probe and U937
nuclear extracts with antiserum to Sp1 resulted in a band shift (lane
7, upper arrow [supershift]). Purified Sp1 protein also bound to the
Sp1A probe (lane 8). (B) Results of EMSA analysis using nuclear
extracts from uninduced (U937/U) and zinc-induced (U937/I)
U937-C/EBP cells and LF 53 bp to 35 bp (SP1B) as a
probe. In both uninduced and induced extracts, Sp1 was eliminated
competitively by the addition of a 100-fold molar excess of Sp1B probe
(self CC, lanes 3 and 7) and an Sp1 consensus probe (lanes 4 and 8) but
not by a nonspecific probe (n.s., lanes 5 and 9, lower arrow).
Preincubation of protein-DNA complexes with anti-Sp1 antiserum resulted
in a supershifted band (upper arrow) in both uninduced (lane 9) and
induced (lane 10) nuclear extracts. (C) EMSA supershift analysis was
performed on the radiolabeled LF-C/EBP binding site (LF 74 bp to
51 bp) by using nuclear extracts from uninduced U937-C/EBP
cells and from U937-C/EBP cells induced with zinc. C/EBP bound to
the LF-C/EBP site from both uninduced (lane 2) and induced (lane 5)
U937-C/EBP extracts (lower arrow). The protein-DNA complex was
supershifted (upper arrow) by anti-C/EBP antiserum (lanes 3 and 6)
but not by anti-C/EBP antiserum (lanes 4 and 7).
|
|
Binding of Sp1 to the Sp1B probe (LF promoter 53 bp to 35
bp) was also determined by EMSA analysis. Sp1B probe was incubated with
nuclear extracts prepared from both U937-C/EBP cells (uninduced myeloid cells; Figure 2B, lane 2) and U937-C/EBP cells induced with
zinc for 3 days (induced myeloid cells; lane 6). The similar protein-DNA-complex pattern observed with the 2 cell types (Figure 2B,
lanes 2 and 6) was eliminated competitively by the
addition of a 100-fold molar excess of unlabeled Sp1B or a probe
harboring a consensus Sp1 site (lanes 3, 4, 7, and 8) but not with a
nonspecific probe (lanes 5 and 9). Preincubation of Sp1B-U937
protein-DNA complexes with an Sp1 antibody resulted in a supershifted
band (Figure 2B, lanes 10 and 11, arrow). On the other hand,
preincubation of the Sp1B-U937 protein-DNA complexes with preimmune
serum did not result in a supershifted band (data not shown). These
data confirm that Sp1 also recognizes and binds to the LF promoter between the 53-bp and 35-bp coordinates.
To confirm binding of C/EBP to the C/EBP site in the LF promoter, an
EMSA was performed using an LF89 fragment containing the C/EBP site
(74 bp to 51 bp of LF promoter) and nuclear extracts from
uninduced U937-C/EBP cells and from U937-C/EBP cells induced with
zinc for 3 days. Although C/EBP bound to the LF-C/EBP probe in
uninduced U937-C/EBP extracts (because of either endogenous C/EBP
binding activity or the leakiness of the metallothionein promoter)
(Figure 2C, lane 2), its binding was sharply increased in zinc-induced
extracts (Figure 2C, lane 5). Supershift analysis confirmed that
C/EBP (Figure 2C, lanes 3 and 6, arrow) and not C/EBP (lanes 4 and 7) bound to the LF-C/EBP probe in this cell line.
Activation of the LF promoter by C/EBP in myeloid
32Dwt18 cells
Having established the ability of Sp1 and C/EBP to bind to their
respective sites in the LF89 fragment of the lactoferrin promoter, we
next assessed the functional contribution of C/EBP in LF gene
expression in a myeloid cell line, 32Dwt18. This 32Dcl3 subline is
dependent on IL-3 and constitutively expresses a stably transfected
chimeric form of the granulocyte colony-stimulating factor (G-CSF)
receptor that contains the extracellular domain of the erythropoietin
receptor and the intracellular signaling domain of the G-CSF receptor.
We previously showed that 32Dwt18 cells differentiate in response to
erythropoietin induction in the absence of IL-3 and express the LF gene
at levels comparable to those of the 32Dcl3-G-CSF system, without the
80% cell death associated with induction of 32Dcl3 with
G-CSF.6
The 32Dwt18 cells were transiently cotransfected with LF89 or a C/EBP
mutant of the LF89 plasmid and increasing concentrations (0, 1, 5, 7, and 10 µg) of an expression plasmid for C/EBP (pMSVC/EBP). Increasing concentrations of the C/EBP expression plasmid correlated with an increase in luciferase activity of the LF89 (pGL3B-LF89) plasmid (Figure 3). However, 10 µg of
C/EBP expression vector was unable to transactivate the mutant LF89
plasmid to the same extent as wild-type LF89 (Figure 3). This
experiment indicated that C/EBP transactivates the LF promoter in
32Dwt18 cells and that its effect is mediated through the C/EBP binding
site.
View larger version (11K):
[in this window]
[in a new window]
| Fig 3.
Cotransfection of LF89, mutant LF89, and an expression
C/EBP plasmid (pMSVC/EBP) in 32Dwt18 cells.
32Dwt18 cells were transiently cotransfected with 10 µg of LF89 or a
C/EBP mutant of the LF89 plasmid and increasing amounts (0-10 µg) of
an expression plasmid for C/EBP (pMSVC/EBP). Two micrograms of
pCMVgal plasmid was included in each transfection. Cells were
harvested 24 hours after transfection and reporter gene activity was
measured. Normalized luciferase values are represented as a ratio of
enzyme activity of LF89 plus pMSVC/EBP to that of LF89 without
pMSVC/EBP. The mean ± SE value for 3 experiments performed in
duplicate is represented.
|
|
Role of Sp1 binding sites in the LF promoter in 32Dwt18
cells
Because Sp1 is a ubiquitous transcription factor that is expressed
abundantly in myeloid cells, a transient cotransfection experiment with
increasing concentrations of an Sp1 expression vector and LF89 plasmid
would not have been informative. Instead, 32Dwt18 cells were
transiently transfected with LF89 or Sp1A and Sp1B mutant forms of the
LF89 plasmid, with and without 10 µg of an expression plasmid for
C/EBP (pMSVC/EBP). As shown in Figure
4, wild-type LF89 plasmid was
transactivated (4.8-fold) by C/EBP as expected. However, both Sp1
mutants of the LF89 plasmid were unable to be transactivated by
C/EBP to the same extent as the wild-type LF89 plasmid, even though
the C/EBP binding site in the Sp1 mutants A and B was intact. In fact,
the level of wild-type LF89 transactivation was 5.7-fold greater than
mutant Sp1 LF89 transactivation in the presence of exogenously
expressed C/EBP. This observation suggests that both Sp1 binding
sites in the LF89 promoter fragment must be functional for efficient
transactivation of the LF89 promoter fragment by C/EBP.
View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
Transient cotransfection of mutant LF Sp1 plasmids with a
C/EBP expression plasmid in 32Dwt18 cells.
32Dwt18 cells were transiently cotransfected with 10 µg of LF89,
SP1A, and SP1B mutant forms of the LF89 plasmid, with and without 10 µg of an expression plasmid for C/EBP (pMSVC/EBP); 2 µg of
pCMVgal plasmid was included in each transfection. Cells were
harvested 24 hours after transfection and reporter gene activity was
measured. Normalized luciferase values from 1 of 3 experiments
performed in duplicate are represented.
|
|
Interestingly, a 5- to 12-fold increase in luciferase activity was
observed in the presence of exogenous C/EBP for LF89 and for the Sp1
mutant LF89 plasmids A and B; however, the overall reporter gene
activity for the mutant Sp1 LF89 plasmids was clearly diminished
compared with the results for wild-type LF89. Furthermore, the
basal-level reporter gene activity of both Sp1 mutant plasmids was
11-fold lower than that of the wild-type LF89 plasmid. This may be because Sp1 may play a role in mediating basal-level
transcription of the LF promoter in myeloid cells.
These observations were confirmed by using the U937-C/EBP cell line,
which can be made to undergo neutrophil maturation on induction with
zinc ions.22 As shown in Figure
5, induction of wild-type LF89 plasmid in
the presence of zinc ions resulted in a 7.7-fold induction of reporter
gene activity. A mutation in the C/EBP site in the LF89 promoter
fragment resulted in a 5.3-fold reduction in luciferase activity
compared with wild-type LF89 transactivation with C/EBP. A mutation
in the Sp1A site in the LF89 promoter fragment resulted in a reduction
in reporter gene activity (6-fold) similar to that observed for the
mutant C/EBP-LF89 plasmid. Mutant Sp1B showed a similar pattern of
expression in this cell line (data not shown). Thus, it is evident that
C/EBP is incapable of transactivating LF89 promoter plasmids with
mutations in either of the 2 Sp1 sites (A or B) or in the C/EBP site
within the first 89 bps of the LF promoter to the same extent as the wild-type LF89 plasmid.
View larger version (13K):
[in this window]
[in a new window]
| Fig 5.
Transient transfection of wild-type and mutant LF89
plasmids in U937-C/EBP cells.
The C/EBP gene under the control of a zinc-inducible metallothionein
promoter was stably transfected into U937 cells. These cells can be
made to undergo maturation along the granulocytic lineage after zinc
induction, which results in high levels of C/EBP expression.
U937-C/EBP cells were transiently transfected with LF89, a C/EBP
mutant of LF89 (mLFC/EBP), or an SP1 (A) mutant of LF89 (mLFSP-1A)
plasmids. One-half of the cells were induced with zinc for 48 hours
after transfection (Zn induced), whereas the other one-half were
incubated in medium without zinc (Uninduced); 2 µg of pCMVgal
plasmid was included in each transfection. Normalized luciferase values
are represented as a ratio of luciferase activity with zinc to
luciferase activity without zinc. The mean ± SE value for 3 experiments performed in duplicate are illustrated.
|
|
Activation of the LF promoter by Sp1 in Drosophila
Schneider cells
To further assess the role of Sp1 in activating the LF
promoter, we transfected the LF89 promoter plasmids into
Drosophila Schneider cells, which lack endogenous Sp1.
Wild-type, mutant Sp1A, mutant Sp1B, and mutant C/EBP-LF89 plasmids
linked to the luciferase reporter gene were cotransfected into
Drosophila Schneider cells with an Sp1 expression plasmid
(pPac-Sp1). The results shown in Figure 6
indicate that cotransfection of wild-type LF89 (which contains the Sp1A
site, the Sp1B site, and the C/EBP site) with pPac-Sp1 in
Drosophila cells resulted in an increase in luciferase activity
to 12-fold above that of LF89 alone. This observation demonstrates that
Sp1 activates the LF promoter in cells that otherwise lack Sp1
activity. A decrease in reporter gene activity was observed when mutant
Sp1A (one-fifth of wild-type LF89 levels) and mutant Sp1B LF89
(one-third of wild-type LF89 levels) plasmids were cotransfected with
pPac-Sp1. Thus, disruption of either Sp1 site in the LF promoter
significantly impaired the ability of pPac-Sp1 to activate the
promoter. Of note, mutations in each of the Sp1 sites of the LF
promoter (mutant Sp1A and mutant Sp1B LF89) did not completely abolish
pPac-Sp1-mediated transactivation, presumably because Sp1 bound to the
unmutated Sp1 site in each case. Interestingly, a mutated C/EBP site in
the LF89 promoter fragment also interfered with the ability of pPac-Sp1
to activate the LF promoter in the Drosophila cell line.
In this situation, reporter gene activity was decreased to
one-fourth of wild-type LF89 levels. Thus we surmise that both Sp1
sites, as well as the C/EBP site, contribute to the activation of LF
expression via Sp1.
View larger version (19K):
[in this window]
[in a new window]
| Fig 6.
Transient cotransfection analysis of LF promoter plasmids
with an SP1 expression plasmid in Drosophila S2 cells.
Drosophila S2 cells (Sp1 negative) were transiently
cotransfected with LF89 and Sp1A, Sp1B, and C/EBP mutant forms of the
LF89 plasmid, with and without 5 µg of an expression plasmid for Sp1
(pPACSp1). Cells were harvested 48 hours after transfection and
reporter gene activity was assessed. Luciferase values were normalized
as per microgram of total protein. One representative experiment of 3 performed in duplicate is shown.
|
|
Sp1 and C/EBP cooperate to activate the LF promoter
On the basis of the observations shown in Figure 5 and Figure 6,
which suggested that both Sp1 and C/EBP are necessary for LF
expression, we hypothesized that Sp1 and C/EBP must cooperate to
activate the LF promoter at the transcriptional level. To test this
hypothesis, we cotransfected the wild-type LF89 promoter plasmid with
an Sp1 expression plasmid (pPac-Sp1), a C/EBP expression plasmid
(pPac-C/EBP), or both expression plasmids simultaneously in
Drosophila Schneider cells (Figure
7). Under these conditions, Sp1
transactivated the LF89 plasmid to a level 17-fold above that observed
with LF89 alone. C/EBP also up-regulated LF89 luciferase activity
but to a relatively lesser extent (10.3-fold above the level with LF89
alone). However, transfection with both Sp1 and C/EBP activated the
LF promoter 38-fold, an effect higher than the sum of the levels
observed for the 2 individual transactivations. We therefore conclude
that Sp1 and C/EBP work cooperatively to activate the LF
promoter.
View larger version (8K):
[in this window]
[in a new window]
| Fig 7.
Sp1 and C/EBP cotransfection with LF89 in
Drosophila S2 cells.
Drosophila S2 cells were cotransfected with 10 µg of
wild-type LF89 plasmid and 5 µg of an Sp1 expression plasmid
(pPAC-Sp1), 5 µg of a C/EBP expression plasmid (pPAC-C/EBP), or
5 µg of each expression plasmid. Salmon-sperm DNA was used to
normalize the total amount of DNA used in each transfection.
Transfected cells were harvested 48 hours after transfection.
Normalized luciferase values (per microgram of protein) are represented
as a ratio of enzyme activity of LF89 plus expression plasmid to enzyme
activity of LF89 without expression plasmid. The mean ± SE value for 3 experiments performed in duplicate is represented.
|
|
| |
Discussion |
In this study, we demonstrated that a region spanning the first 89 bps of the LF promoter is sufficient to confer high-level reporter gene
expression in myeloid cells (32Dwt18, U937, NB4 and EPRO cells) but not
in nonmyeloid cells (MEL and Cos-7 cells). We also showed, by using
transient transactivation analysis and site-directed mutagenesis, that
a C/EBP site (located between 60 and 51 bp in the LF
promoter) is essential for LF promoter activity. In addition, EMSA
analysis demonstrated that C/EBP specifically recognizes and binds
to this region of the LF promoter. LF is thus among a growing number of
myeloid-specific genes regulated by C/EBP.
C/EBP has been postulated to be a master regulator of the
granulopoietic developmental program. It is expressed at high levels throughout myeloid differentiation and has been shown to bind to
multiple myeloid-specific gene promoters thereby regulating gene
expression at many different stages of myeloid maturation. C/EBP /-mice die perinatally due to defects
in gluconeogenesis that result in fatal hypoglycemia25;
however, they also present a selective early block in the
differentiation of granulocytes.26 Newborn C/EBP
knockout mice do not produce any mature neutrophils, although immature
myeloid cells with an increased myeloid colony-forming unit potential
are found in the peripheral blood.26 It should be noted,
however, that since all members of the C/EBP family of transcription
factors recognize the 5' ATTGCACAAT 3' consensus motif in
the regulatory domains of target genes, other C/EBP family members may
also contribute to myeloid-specific LF expression by means of the C/EBP
site described. In this regard, we have demonstrated the ability of
C/EBP to transactivate the LF89 plasmid in 32Dwt18 cells
(Khanna-Gupta A, Berliner N, unpublished data). The ability of
C/EBP to recognize and bind to the C/EBP site in the LF promoter in
Cos cells overexpressing C/EBP has been reported.27
Additionally, since the C/EBP transcription factors are members of a
bZip family of transcription factors capable of homodimerizing and
heterodimerizing not only with other C/EBP family members but also with
members of other bZip families (such as ATF/CREB and Fos/Jun), the
possibility that such other bZip transcription factors contribute to LF
expression by means of the C/EBP site cannot be ruled out.
Our data also demonstrate the importance of the 2 Sp1 binding sites,
which flank the C/EBP site in the LF promoter, in mediating high-level
LF expression. Mutations in either of the 2 Sp1 sites interfered with
C/EBP-mediated transactivation of the LF89 plasmid in myeloid cells.
The converse was also true: a mutation in the C/EBP site in the LF
promoter interfered with the Sp1-mediated up-regulation of the LF89
plasmid in Drosophila Schneider cells, which normally lack Sp1
activity. Taken together, these findings suggest that a functional
interaction between C/EBP and Sp1 is essential for maximal LF
expression. In further analysis, a cooperative interaction between Sp1
and C/EBP in mediating high-level LF expression was found.
None of the sites appear to be absolutely essential for LF expression,
since all the mutants (Sp1 and C/EBP) had reporter gene activity that
exceeded basal luciferase activity. However, all of the sites
contribute markedly to maximal LF expression.
The role of the ubiquitous transcription factor Sp1 in
regulating myeloid lineage-specific gene expression is well documented for a host of myeloid-specific genes, including CD11b,28
CD11c,20 CD14,29 CD18,19 neutrophil
elastase,30 myeloperoxidase,31 c-fes,32 myeloid cell nuclear differentiation
antigen,33 and human hematopoietic cell kinase
genes.34 Sp1 is a differentially phosphorylated and
gylcosylated35,36 zinc finger-containing transcription
factor that binds to GC or GT boxes.15 The mechanism by
which Sp1 aids in effecting tissue- and stage-specific expression is
still unknown. However, several explanations for the participation of
this transcription factor in lineage-restricted gene expression have
been proposed. Modulation of the levels of Sp1 is one such explanation.
In this context, it is worth noting that Sp1 is abundant in
hematopoietic cells.18 Differential glycosylation,
phosphorylation, or both are modifications that may also contribute to
the tissue-specific effects of Sp1. Additionally,
protein-protein interactions between a ubiquitous transcription factor
such as Sp1 and lineage-restricted factors such as C/EBP may produce
a tissue-specific effect. In this context, it is worth noting that Sp1
interacts both physically and functionally with several transcription
factors. These include GATA-1,37,38 NFB,39
Erg-1,40 and C/EBP,41 among others.
Transcriptional synergy between Sp1 and C/EBP transcription factors was
observed for the rat liver CYP2D5 P-450 gene. In that case, occupancy
by Sp1 at its cognate site in the CYP2D5 promoter was a prerequisite to
C/EBP binding.42 Although functional synergy between
C/EBP and Sp1 was demonstrated in the context of the CD11c integrin
gene promoter, no such prerequisite for Sp1-site occupancy was observed
for C/EBP transactivation of the CD11c promoter in myeloid
cells.20 In the case of the LF promoter, we showed that
occupancy of both the 2 Sp1 sites seems to be necessary for
C/EBP-mediated transactivation. It is therefore likely that the
mechanism underlying a functional interaction between Sp1 and members
of the C/EBP family is unique to the gene promoter in question.
Although we demonstrated functional cooperation between Sp1
and C/EBP in the context of the LF promoter in myeloid cells, we
have not been able to show a direct physical interaction between the 2 transcription factors by using EMSA analysis (Khanna-Gupta A, Berliner
N, unpublished data). The mechanism whereby C/EBP and Sp1 cooperate
to increase LF expression in myeloid cells remains undefined. However,
it is tempting to speculate that the cooperative effect of the 2 transcription factors may be explained on the basis of the ability of
Sp1 to directly contact components of the basal transcriptional
machinery, including TBP43 an effect that may be
facilitated in the presence of C/EBP binding to the LF promoter at
its cognate site. It is worth noting here that Sp1 is capable of
forming homodimers when bound to distant sites in cis, thereby
looping out the intervening DNA sequences and altering chromatin
structure, which may in turn facilitate changes in DNA binding of other
transcription factors.44 In this regard, it was found
that Sp1 can be a target of histone deacetylase 1 (HDAC)
1-mediated transcriptional repression, and the HDAC inhibitor trichostatin A can activate the chromosomally integrated murine thymidine kinase promoter in an Sp1-dependent manner.45
Alternatively, the binding of C/EBP to the LF promoter may enhance
the binding of Sp1 to the LF promoter, an effect that would lead to
increased LF expression. Additionally, the binding of an unidentified
accessory factor or factors to Sp1 and/or C/EBP may contribute to
their cooperative effect on LF expression. We believe that Sp1 may play a wider role than was previously thought in modulating the levels of
C/EBP-regulated genes during myeloid differentiation.
| |
Acknowledgments |
We thank Dr Dan Tenen, Harvard Medical School, Boston, MA, for the
U937-C/EBP cells and helpful discussions, and Dr Robert Tjian,
Berkeley, CA, for the pPAC and pPACSp1 plasmids.
| |
Footnotes |
Submitted December 13, 1999; accepted February 3, 2000.
Supported by National Institutes of Health grant R01DK53471 (N.B.) and
a Swebilius Cancer Research Award (A.K.-G.).
Reprints: Nancy Berliner, Section of Hematology, WWW 428, Yale University School of Medicine, 333 Cedar Street, New Haven, CT
06510; e-mail: nancy.berliner{at}yale.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
|
Top
Abstract
Introduction