|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 95 No. 12 (June 15), 2000:
pp. 3750-3757
HEMATOPOIESIS
From the Laboratoire de Cancérologie expérimentale,
Marseille, France.
We have developed a gene trap approach to select specific cytokine
receptor/ligand responsive genes in the cell line TF-1. This cell line
exhibits a dependency on granulocyte-macrophage colony-stimulating
factor (GM-CSF) or interleukin-3 (IL-3) and responds to interleukin-5
(IL-5). In an attempt to detect genes modulated by one of these
factors, cells were infected with the Rosa
The role of cytokines in survival, proliferation, and
differentiation of hematopoietic cells has been extensively studied (reviewed in Metcalf1 and Ogawa2). However,
the molecular mechanisms that underlie a specific pattern of biologic
effects for 1 given cytokine remain unclear. It is likely that these
mechanisms involve sets of unidentified genes. One illustration is the
lack of correlation between intracellular events in known and shared pathways after the binding of granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-3 (IL-3), or interleukin-5 (IL-5) to their
respective receptors and the divergent spectrum of their biologic
functions.3 Sequentially or together, these cytokines are
required for a variety of hematopoietic functions such as proliferation
of hematopoietic progenitors4 or stimulation of formation
of multipotent colonies that contain granulocytes, erythroid cells,
monocytes, and megakaryocytes (reviewed in Clark and Kamen5
and Sato and Miajima6). In addition, complete maturation
within various lineages (ie, erythropoiesis, granulopoiesis, or
basophil/mast cell development) requires IL-3. IL-5, a more restrictive
factor,7 mainly controls eosinophil and basophil lineages,
but also acts on overlapping compartments. Identification of a common
In an attempt to isolate cytokine-responsive genes, we developed an in
vitro gene trap strategy. Similar strategies used to study different
systems such as embryogenesis23-30 or cell growth and
differentiation in other tissues31-35 have allowed
identification of novel genes. We took advantage of the
well-characterized gene trap retroviral vector
Rosa Because hematopoietic progenitor cells are difficult to manipulate in
vitro, we first evaluated the feasibility of the method in the human
premyeloid TF-1 cell line.36 TF-1 cells require GM-CSF or
IL-336 for growth and respond to IL-5,36,37
thus making this cell line a suitable in vitro model for the study of specific versusoverlapping genes involved in the proliferative activity of these cytokines. Here, we describe the specific
transcriptional modulation by GM-CSF of 2 trapped genes (NACA
and RBM3),38,39 not yet reported to be cytokine
regulated, but seemingly involved in the molecular mechanism of
differentiation in other tissues. Our study indicates the feasibility
of identifying new genes specifically involved in regulation of
hematopoiesis downstream of individual cytokines, despite overlapping
signal transduction machinery. The importance of yet unknown mechanisms
involved in the cytokine regulation of hematopoiesis is discussed.
Retrovirus production and gene trap vector
Cells and culture
Enrichment of peripheral blood CD34+ cells Apheresis samples were taken after informed consent was obtained from 2 adult patients with non-Hodgkin lymphoma, mobilized with chemotherapy and rhG-CSF. CD34+ cells were obtained by a combination of density separation, adherence, depletion, and immunoselection using the Magnetic Activating Cell Sorting device (MACS, Miltenyi Biotech GmbH, Bergish Gladbach, Germany), according to the manufacturer's recommendations.Retroviral infection and selection of G418-resistant TF-1 clones One day before infection, a confluent 100-mm plate of GP+EnvAm12 Rosa geo vector-producing cells was maintained in RPMI medium. The
next day the culture supernatant containing the retroviruses was used
to infect the human erythroleukemic cell line TF-1
(2 × 105 cells) maintained in GM-CSF, IL-3, or IL-5,
pretreated for 30 minutes with polybrene (5 µg/mL) (Sigma). After 16 hours, TF-1 cells were washed in phosphate buffered saline (PBS) and
seeded in 96-well plates (102 cells per well), in the
presence of G418 (1 mg/mL active powder) and GM-CSF (5 ng/mL), IL-3 (1 ng/mL, R&D Systems, Oxon, UK), or rhIL-5 (0.5 ng/mL, R&D
Systems). After 3 weeks, surviving clones (1 of 103 cells)
of an average size of 1000 cells were expanded and submitted to a cytokine-dependent proliferative assay.
Proliferative assay 1 × 105 cells per milliliter uninfected or infected TF-1 cells were washed and starved overnight in RPMI medium supplemented with 10% FCS, L-glutamine (2 mmol/L), penicillin (100 U/mL), and streptomycin (100 mg/mL). Cells were seeded in a 96-well plate (104 cells per well) and cultured in the presence or absence of G418 (1 mg/mL active powder) with either rhGM-CSF (5 ng/mL, Sandoz), rhIL-3 (1 ng/mL, R&D Systems), or rhIL-5 (0.5 ng/mL, R&D Systems) for 68 hours or 5 days. Cells were then pulsed with 37 Bq (1.78 Tbq/mmol [3H]-thymidine, Amersham Life Science, UK) for 4 hours, harvested on fiber paper, and the labeled cellular DNA was measured using a-counter Rackbeta Compact 1212-411 (LKB, Uppsala, Sweden). Triplicate samples were assayed for each set of conditions.
Isolation of 5' flanking sequences Complementary DNA (cDNA), corresponding to gene trapped-geo fusion transcripts, as isolated using a 5' RACE (rapid amplification of cDNA ends) kit (Life-Technologies SARL), according to the manufacturer's instructions. Reverse transcription using SuperScript II RTase (Promega France, Charbonnières, France) was performed using the oligonucleotide primer 5'ATGCGCTCAGGTCAAATTCAGACGG complementary to the lacZ sequence. After RNAse H treatment and cDNA purification, an anchor sequence was added to the 3' end of the cDNA using dCTP and TdT. Polymerase chain reaction (PCR)-amplification was performed on dCTP-tailed cDNA using a 3' oligonucleotide primer 5'CCGTGCATCTGCCAGTTTGAGGGGA complementary to the lacZ sequence and the described AP (anchor primer from Life-Technologies SARL). After 30 cycles (94°C/1 min; 55°C/1 min; 72°C/1 min), PCR products were agarose gel-sized (above 400 nucleotide [nt]) and excised. Agarose gel was melted and DNA was diluted 1:100; and reamplified under the same conditions with a different nested oligonucleotide primer 5'TACCGTCGATCCCCACTGGAAA complementary to the lacZ sequence and with the described 5' UAP (universal anchor primer from Life-Technologies SARL). PCR products were purified using the GlassMAX DNA Isolation Spin Cartridge System (Life-Technologies), cloned in the SmaI site of pUC18 and sequenced with the T7 polymerase Sequencing kit (Pharmacia, Uppsala, Sweden).GenBank database searches Sequences obtained were used as templates for database searches using BLASTN and BLASTX algorithm.41,56Probes The 5'RACE PCR isolated sequences (198 base pairs [bp] from clone 50, 47 bp from clone 134, and 44 bp from clone C) were extended by PCR amplification using oligonucleotide primers complementary to the EST sequences downstream from the 5'RACE PCR sequence, to generate products about 300 nt length. Amplification products were cloned in a pUC-18 plasmid (Pharmacia) for clones 50 and C, and into the pGEM-T vector using the pGEM-T vector systems (Promega France) for clone 134. Miniprep plasmid DNA was sequenced with the T7 polymerase Sequencing kit (Pharmacia).
Southern and Northern blot analyses Total RNA and genomic DNA were prepared by the guanidium/CsCl method.43 Southern and Northern blots were conducted as described.43 Fifteen micrograms genomic DNA was digested with EcoRI for Southern blot analysis and 20 µg total RNA of a subclone from the original TF-1 cell line was used for Northern blot studies. Membranes were scanned and analyzed with a PhosphorAnalyst (Phosphorimager, Biorad SA, Ivry-sur-Seine, France).Expression of transcripts 50 and 134 by reverse transcriptase-polymerase chain reaction in enriched CD34+ cells Messenger RNA (mRNA) from enriched CD34+ cells was extracted using the Quick prep Micro mRNA purification kit (Pharmacia Biotech Products, Saclay, France), was treated with DNAse I (Boehringer Mannheim, Roche Diagnostics, Meylan, France), and was reverse transcribed (RT) with the Superscript preamplification system (Life-Technologies SARL) according to the manufacturer's instructions, using a random primer. For PCR, 2 µL of cDNA was taken from each RT reaction volume and samples were submitted to either 22 and 26 (product of RBM3) or 26 and 28 (product of NACA) cycles of PCR in a Perkin-Elmer thermal cycler (Perkin-Elmer, Norwalk, CT) using 1 minute of denaturation at 94°C, 1 minute of annealing at either 55°C for RBM3 or 60°C for NACA, and 1 minute of polymerization at 72°C. A final polymerization step was performed for 5 minutes at 72°C. The primers used were 5'CCAGGACTTGAACTGCCATG (sense) and 5'CAGACTTCCTGCCATGATCC (antisense), amplifying a product of 445 bp in the RBM3 gene; and 5'GCTACAGAGCAGGAGTTGCCA (sense) and 5'TAACCACCCTGGTTTCTGCC (antisense), amplifying a product of 567 bp in the NACA gene. To monitor the amount of RNA per tube and the efficiency of the reactions,2 microglobulin transcript was assessed
using the sense primer: 5'CCAGCAGAGAATGGAAAGTC (contained in the first
exon of the gene) and the antisense primer: 5'GATGCTGCTTACATGTCTCG (contained in the second exon of the gene). The size of the amplified product was 268 bp.
Selection for cytokine-regulated integrations In an attempt to identify genes differentially regulated by the GM-CSF/IL-3/IL-5 group of cytokines, TF-1 cells were infected with the Rosageo retroviral vector24 (Figure
1) in the presence of GM-CSF, IL-3, or IL-5
to favor integration events respectively into GM-CSF, IL-3, or IL-5
transcriptionally active genes. This retrovirus contains a splice
acceptor 5' to a promoterless reporter gene, encoding a fusion protein
of -galactosidase and neomycin phosphotransferase. Clones with
retroviral integrations into expressed genes will therefore produce an
active Geo protein, conferring G418 resistance. After 3 weeks of
selection with G418 and GM-CSF, 173 clones grew out of 2 × 105 infected cells. The growth of clones from IL-3- or
IL-5-cultured and infected cells was delayed by 10 days. In addition,
the number of clones from IL-5-cultured and infected cells was roughly
a third of those recovered from IL-3- or GM-CSF-cultured and infected cells. These phenomena reflect differences in the long-term
proliferation efficiency of IL-3, IL-5, and GM-CSF with the clones of
the TF-1 cells used in our study. G418 resistance can be obtained by
expressed transcripts representing both cytokine-responsive genes and
noncytokine-regulated genes. To screen for integrations into
differentially cytokine-expressed genes, clones were submitted to a
proliferative assay in the presence of G418 and a panel of different
cytokines (GM-CSF, IL-3, or IL-5) as shown in Figure 1. Acquisition of
G418 resistance in the presence of a specific cytokine and G418
sensitivity to a different cytokine suggested an integration event into
a cytokine-regulated gene. This phenotype reflects the fact that the
copy number of the transcript varies with growth in a
cytokine-dependent manner. Figure 2 shows a
typical pattern of differential cytokine proliferation monitored by
[3H]-thymidine incorporation after at least 3 days of
cell culture. Results are represented as the relative ratio of
[3H]-thymidine incorporation for each cytokine-grown
condition compared with incorporation after exposure to the same
cytokine and G418 during culture. A threshold of significant difference
was set at 0.35, representing a 65% inhibition of G418 resistance for a given cytokine. The residual resistance probably reflects differences in cell cycle synchronization of the cells or leaky expression of the
vector product geo, or both. Figure 2 summarizes the outcome of
the screen. Uninfected TF-1 cells displayed complete G418 sensitivity after 3 days of growth, and the pattern of clone C is representative of
unregulated integration. From GM-CSF-cultured and infected cells, 7 of
80 clones showed a clear differential G418 behavior (resistance and
sensitivity within the same clone) in the presence of IL-5 and G418. In
addition, 2 of these clones showed a differential response with IL-3
and IL-5 when the proliferative assay was conducted after 5 days of
growth. In IL-3- or IL-5-cultured and infected cells, differential
responses were observed after 3 days of exposure of the cells to the
cytokines before [3H]thymidine incorporation assay
(Figure 2B). Five days of growth did not modify the G418 responses for
clones showing either incomplete (+/ ), or complete G418 resistance
to a cytokine other than the one used at the time of infection. This
suggests that modulation of the insertion site by several cytokines
occurred. Considering these results, we delineated cytokine-modulated
genes either by more than a single cytokine or by all 3 cytokines
tested. In addition, we obtained clones with single cytokine-modulated
loci.
Analysis of the retroviral integrations To associate the differential cytokine response with either 1 or several exon-trapped gene(s), we determined the number of integration events in 9 clones from GM-CSF-cultured and infected cells. Clones 122, 134, 165, 146, 192, and 50 presented differentially cytokine-regulated trapped genes, whereas clones 31, C, and G were defined by our screen as not being specifically modulated by the tested cytokines. After EcoRI digestion, which cut the retroviral vector DNA once, genomic DNA from 9 clones was analyzed by Southern blot with a lacZ probe. Eight clones had a single retroviral integration, as only 1 band was revealed (Figure 3), whereas 2 fragments were detected for clone 122. Different sized fragments were obtained, suggesting that 1 individual retroviral integration occurred per clone (except for clone 122).
Transcriptional studies
Rapid and transient expression of many genes is seen after
stimulation with either the same or subfamilies of cytokines,
suggesting that a specific intracellular response occurs further
downstream and involves modulation of a variety of other genes. To
identify such genes, we used a gene trap approach in the TF-1
premyeloid cell line and screened for genes regulated during
proliferation in GM-CSF, IL-3, or IL-5, a group of cytokines that
exhibit overlapping signal transduction intermediates.16
We thank Dr Soriano for the gift of the vector pRosa Submitted August 26, 1999; accepted February 11, 2000.
Supported in part by funds from INSERM (Institut National de la
Santé et de la Recherche Médicale), FEGEFLUC
(Féderation Nationale des Groupements des Entreprises
Françaises dans la Lutte contre le Cancer), and ARC (Association
de la Recherche contre le Cancer).
S.B. is a recipient of a predoctoral fellowship from the
Ministère de la Recherche et de l'Enseignement.
Reprints: Sophie Gomez, Laboratoire de Cancérologie
expérimentale, U119 INSERM, 27 Bld Leï Roure, 13009 Marseille, France; e-mail: gomez{at}marseille.inserm.fr.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
1.
Metcalf D.
Hematopoietic regulators: redundancy or subtlety?
Blood.
1993;82:3515-3523
2.
Ogawa M.
Differentiation and proliferation of hematopoietic stem cells.
Blood.
1993;81:2844-2853
3.
Miyajima A, Mui AL, Ogorochi T, Sakamaki K.
Receptors for granulocyte-macrophage colony-stimulating factor, interleukin-3, and interleukin-5.
Blood.
1993;82:1960-1974
4.
Sonoda Y, Yang YC, Wong GG, Clark SC, Ogawa M.
Analysis in serum-free culture of the targets of recombinant human hematopoietic growth factors: interleukin3 and granulocyte/macrophage-colony-stimulating factor are specific for early developmental stages.
Proc Natl Acad Sci U S A.
1988;85:4360-4364
5.
Clark SC, Kamen R.
The human hematopoietic colony-stimulating factors.
Science.
1987;236:1229-1237
6.
Sato N, Miajima A.
Multimeric cytokine receptors: common versus specific functions.
Curr Opin Cell Biol.
1994;6:174-179[Medline]
[Order article via Infotrieve].
7.
Sanderson CJ.
Interleukin-5, eosinophils, and disease.
Blood.
1992;79:3101-3109
8.
Tavernier J, Devos R, Cornelis S, et al.
A human affinity interleukin-5 receptor (IL5R) is composed of an IL5-specific a and a
9.
Sato N, Sakamaki K, Terada N, Arai K, Miyajima A.
Signal transduction by the high-affinity GM-CSF receptor: two distinct cytoplasmic regions of the common beta subunit responsible for different signaling.
EMBO J.
1993;12:4181-4189[Medline]
[Order article via Infotrieve].
10.
Quelle FW, Sato N, Witthuhn BA, et al.
JAK2 associates with the beta c chain of the receptor for granulocyte-macrophage colony-stimulating factor, and its activation requires the membrane-proximal region.
Mol Cell Biol.
1994;14:4335-4341
11.
Zhao Y, Wagner F, Frank SJ, Kraft AS.
The amino-terminal portion of the JAK2 protein kinase is necessary for binding and phosphorylation of the granulocyte-macrophage colony-stimulating factor receptor beta c chain.
J Biol Chem.
1995;270:13,814-13,898
12.
Mui AL, Wakao H, O'Farrell AM, Harada N, Miyajima A.
Interleukin-3, granulocyte-macrophage colony stimulating factor and interleukin-5 transduce signals through two STAT5 homologs.
EMBO J.
1995;14:1166-1175[Medline]
[Order article via Infotrieve].
13.
Rapp UR, Troppmair J, Carroll M, May S.
Role of raf-1 protein kinase in IL-3 and GM-CSF-mediated signal transduction.
Curr Top Microbiol Immunol.
1990;166:129-139[Medline]
[Order article via Infotrieve].
14.
Kanakura Y, Druker B, Cannistra SA, Furukawa Y, Torimoto Y, Griffin JD.
Signal transduction of the human granulocyte-macrophage colony-stimulating factor and interleukin-3 receptors involves tyrosine phosphorylation of a common set of cytoplasmic proteins.
Blood.
1990;76:706-715
15.
Carroll MP, Clark LI, Rapp UR, May WS.
Interleukin-3 and granulocyte-macrophage colony-stimulating factor mediate rapid phosphorylation and activation of cytosolic c-raf.
J Biol Chem.
1990;265:19,812-19,817
16.
Okuda K, Sanghera JS, Pelech SL, et al.
Granulocyte-macrophage colony-stimulating factor, interleukin-3, and steel factor induce rapid tyrosine phosphorylation of p42 and p44 MAP kinase.
Blood.
1992;79:2880-2887
17.
Welham MJ, Duronio V, Sanghera JS, Pelech SL, Schrader JW.
Multiple hemopoietic growth factors stimulate activation of mitogen-activated protein kinase family members.
J Immunol.
1992;149:1683-1693[Abstract].
18.
Polotskaya A, Zhao Y, Lilly MB, Kraft AS.
Mapping the intracytoplasmic regions of the alpha granulocyte-macrophage colony-stimulating factor receptor necessary for cell growth regulation.
J Biol Chem.
1994;269:14,607-14,613
19.
Takaki S, Kanazawa H, Shiiba M, Takatsu K.
A critical cytoplasmic domain of the interleukin-5 (IL-5) receptor alpha chain and its function in IL-5-mediated growth signal transduction.
Mol Cell Biol.
1994;14:7404-7413
20.
Kouro T, Kikuchi Y, Kanazawa H, et al.
Critical proline residues of the cytoplasmic domain of the IL-5 receptor alpha chain and its function in IL-5-mediated activation of JAK kinase and STAT5.
Int Immunol.
1996;8:237-245
21.
Mire-Sluis A, Page LA, Wadhwa M, Thorpe R.
Evidence for a signaling role for the alpha chains of granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-3 (IL-3), and IL-5 receptors: divergent signaling pathways between GM-CSF/IL-3 and IL-5.
Blood.
1995;86:2679-2688
22.
Matsuguchi T, Zhao Y, Lilly MB, Kraft AS.
The cytoplasmic domain of granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor alpha subunit is essential for both GM-CSF-mediated growth and differentiation.
J Biol Chem.
1997;272:17,450-17,459
23.
Skarnes WC, Auerbach BA, Joyner AL.
A gene trap approach in mouse embryonic stem cells: the lacZ reported is activated by splicing, reflects endogenous gene expression, and is mutagenic in mice.
Genes Dev.
1992;6:903-918
24.
Friedrich G, Soriano P.
Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice.
Genes Dev.
1991;5:1513-1523
25.
Skarnes WC, Moss JE, Hurtley SM, Beddington RS.
Capturing genes encoding membrane and secreted proteins important for mouse development.
Proc Natl Acad Sci U S A.
1995;92:6592-6596
26.
Wurst W, Rossant J, Prideaux V, et al.
A large-scale gene-trap screen for insertional mutations in developmentally regulated genes in mice.
Genetics.
1995;139:889-899[Abstract].
27.
Takeuchi T, Yamazaki Y, Katoh-Fukui Y, et al.
Gene trap capture of a novel mouse gene, jumonji, required for neural tube formation.
Genes Dev.
1995;9:1211-1222
28.
Forrester LM, Nagy A, Sam M, et al.
An induction gene trap screen in embryonic stem cells: identification of genes that respond to retinoic acid in vitro.
Proc Natl Acad Sci U S A.
1996;93:1677-1682
29.
Gossler A, Joyner AL, Rossant J, Skarnes WC.
Mouse embryonic stem cells and reporter constructs to detect developmentally regulated genes.
Science.
1989;244:463-465
30.
Stanford WL, Caruana G, Vallis KA, et al.
Expression trapping: identification of novel genes expressed in hematopoietic and endothelial lineages by gene trapping in ES cells.
Blood.
1998;92:4622-4631
31.
Gogos C, Thompson R, Lowry W, Sloane BL, Weintraub H, Horwitz M.
Gene trapping in differentiating cell lines: cathepsin B in skeletal myoblast growth and fusion.
J Cell Biol.
1996;134:837-847
32.
Jonsson JI, Wu Q, Nilsson K, Phillips RA.
Use of a promoter-trap retrovirus to identify and isolate genes involved in differentiation of a myeloid progenitor cell line in vitro.
Blood.
1996;87:1771-1779
33.
Russ AP, Friedel C, Ballas K, et al.
Identification of genes induced by factor deprivation in hematopoietic cel |
Top
Abstract
Introduction
32P-labeled with the T4 polynucleotide kinase (New
England Biolabs, Ozyme, Montigny, France).
cells that do not proliferate 
growing cells. Clones of
type X from GM-CSF-, IL-3-, or IL-5-cultured and infected cells and
selected for survival in the presence of G418, and the cytokine present
at the time of infection, exhibit a differential cytokine response, ie,
if cultured and selected in GM-CSF, it remains sensitive to G418 in the
presence of IL-5 and IL-3, whereas it is G418 resistant in the presence
of GM-CSF. This indicates that neither IL-3 nor IL-5 induces
transcription of a chimeric transcript, whereas GM-CSF does. Clones of
type Y do not present a differential cytokine response based on the
acquisition of G418 resistance. It acquires G418 resistance in the
presence of all the tested cytokines. It corresponds to integration
into either housekeeping genes or nonspecifically cytokine-modulated
genes in this assay. Clones of type Z correspond to cells that do not
proliferate in the presence of the tested cytokine, reflecting a
cytokine-response heterogeneity of the cell line. These clones were not
studied further.
) or presence (
after 3 days; 
Oligonucleotides used to amplify fragments from TF-1 total
RNA 
open reading frame for the production of the related
proteins.
) and common (