|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 12 (June 15), 2000:
pp. 3804-3808
IMMUNOBIOLOGY
Synergistic induction of HLA class I expression by RelA and CIITA
John Girdlestone
From the Anatomy Department, MRC Centre for Immune Regulation, The
Medical School, University of Birmingham, Birmingham, UK.
 |
Abstract |
The major histocompatibility complex (MHC) class I genes are induced
synergistically by interferons (IFN) and tumor necrosis factor (TNF) , a response thought to involve the cooperative action of Rel/NF-kB and
interferon regulatory factor (IRF) transcription factors. The
IFN- -inducible class II transcriptional activator (CIITA) has
recently been shown to transactivate MHC class I as well as class II
genes, and this investigation shows that CIITA synergizes strongly with
RelA to stimulate HLA class I expression. The functional interaction of
CIITA and RelA requires both promoter elements and the upstream Rel
binding site and is not seen with a class II reporter. The promoter
elements necessary for CIITA action are also required for induction by
IFN- . HLA-A and HLA-B loci respond differentially to IFNs, and we
identify locus-specific differences in critical promoter elements in
addition to known polymorphisms in the Rel and IRF binding sites. The
HLA-A promoter is transactivated relatively poorly by CIITA and does
not interact detectably with CREB proteins implicated in
CIITA recruitment, but the synergism with RelA can compensate for this
weakness. The present findings illustrate that multiple transcription
factors cooperate to regulate class I expression and that their
relative importance differs according to the locus and cell type examined.
(Blood. 2000;95:3804-3808)
© 2000 by The American Society of Hematology.
| |
Introduction |
The major histocompatibility complex (MHC) cell surface
glycoproteins are essential for the development and function of the immune system by virtue of their presentation of antigenic peptides to
T cells. They are encoded by 2 main families of genes, class I and II,
each of which consists of several polymorphic loci. Class I loci are
expressed to varying degrees by most cell types, whereas constitutive
class II expression is restricted to cells with an immune response
function, but can be induced in other cell types by interferon-
(IFN-).1,2 Class I expression is up-regulated by IFN-
as well as by type I IFNs ( ,  )1 but, paradoxically,
type I IFNs can antagonize the induction of class II expression by
IFN-.3
The MHC class I and II gene families are believed to have originated
from a common precursor (Kaufman et al4) and the proteins retain very similar 3-dimensional structures,5 but their
distinct patterns of constitutive and inducible expression suggest that their upstream control regions are distinct or at least highly diverged. However, a striking functional relationship of class I and II
promoters has been demonstrated by recent reports that class II
transcriptional activator (CIITA), a transcription factor necessary for
constitutive and IFN--inducible class II expression,6-8 can also transactivate class I genes.9,10 CIITA does not
bind directly to DNA but appears to interact with proteins bound to the
X box region of the class II promoter.11,12 The X box
consists of several discrete motifs: X1 binds the factor
RFX13; X2 matches the consensus for a cyclic adenosine
monophosphate (cAMP) response element (CRE) and binds members of the
CRE binding protein (CREB)/activating transcription factor
(ATF) family13; and X3 binds a
helix-loop-helix (HLH) factor.14 Transactivation of the
class I promoter by CIITA requires a site within the ENH-B region
referred to as which, like the class II X2 box, has the sequence of
a CRE and has been shown to bind CREB/ATF family
members.15,16 A class I X1 box homologue is also necessary
for expression,17 and a putative X3 box has been noted in
HLA-B promoters.18 Both class I and II promoters also have
inverted CAAT boxes at identical distances from the X2/ motifs,
which contribute to their expression.13,19
The class I genes are distinguished by additional upstream control
elements, in particular the ENH-A region that is bound by Rel/NF- B
factors, and the adjacent interferon response element (IRE), which
interacts with members of the IRF family.20 ENH-A was
identified originally through its contribution to constitutive expression, but it is also needed for full induction via the IRE, which
has only weak enhancer activity on its own.1 TNF and IFNs
synergistically induce class I expression, a cooperativity thought to
result from their respective activation of NF-B and up-regulation of
IRF1.21,22 IRF1 has also been suggested to cooperate with
CIITA in class I induction by IFN-,10 although this
conclusion was drawn from upstream deletions that removed both the
ENH-A and IRE. We demonstrate in this report that CIITA synergizes
strongly with RelA, and to a lesser extent with IRF1, and that this
cooperativity can compensate for the relatively weak HLA-A promoter,
which differs from HLA-B loci in the critical ENH-B region.
| |
Materials and methods |
Cell lines, transfections, and chloramphenical acetyl transferase
(CAT) assays
MOLT4, YHHH,23 and HeLa cells were
maintained in RPMI 1640 Medium (Sigma, Poole, UK) supplemented with 4 mmol/L glutamine and 5% fetal calf serum (Gibco BRL, Paisley, UK) in a
humidified incubator with 5% CO2. Cells in midlog phase
were transfected by electroporation as described24 with 20 µg of reporter vector along with expression vectors or empty controls
at the levels indicated in figures. Due to the effects of IFN and
overexpression of transcription factors on the activity of standard
reference plasmids, such internal standards were not used. Instead,
multiple repeats of the transfections represented for each figure were performed in parallel and CAT expression for a given condition was
designated as 100, as indicated in the figure legends. Recombinant IFN- was a kind gift of M. Brunda (Hoffman-La Roche, Nutley, NJ) and
was added at 1000 U/mL immediately after transfection. Cultures were
grown 20 hours before preparation for CAT assays as
described.24 Quantitation was performed with a
PhosphorImager (Molecular Dynamics, Little Chalfont, UK).
Plasmids
Class I CAT reporters were based on the metallothionein
promoter construct pMCAT3.25 The ENH-A/IRE-metallothionein
construct has been described,24 and the class II DRA CAT
reporter was kindly provided by Dr G. Andersson.26 The
HLA-A and HLA-B upstream regions were generated by polymerase chain
reaction (PCR) amplification from genomic clones for
HLA-A127 and HLA-B5728 and cloned into pMCAT3
Hind III site in place of the metallothionein promoter. The primers for
the full-length HLA-B reporter were: GGCATCAAGCTTTCCGTGATCAGT; GCATCTAAGCTTCTGAGGAGATTC. The upstream primer for the truncated HLA-B reporter was: CCGAAAGCTTTGTCTGCATTGGGG. The primers for the HLA-A
reporter were: CCGAAAGCTTTGTATGGATTGGGGAG;
CAT- CCTAAGCTTCTGGGGAGAATCTGAG. Base changes were introduced by
dut-ung29 or PCR-mediated mutagenesis. The
IRF-1 expression vector was generated by transfer of the human complementary (cDNA) from a baculovirus expression vector30 into pCDNA3 (Invitrogen, Groningen, The Netherlands). Empty pCDNA3 was
used as the control vector for transfections. Expression vectors for
CIITA (in pCDNA3) and RelA (under a cytomegalovirus promoter) were
kindly provided by Drs K. Gustaffson and A. Baldwin, respectively.
Electrophoretic mobility shift assay (EMSA)
Preparation of nuclear extracts and EMSA protocols have been
described.31 The sense strand sequences for oligonucleotide probes are: HLA-B R1/ CCAGGATACTCGTGACGCGTCCCC; HLA-A R1/
CCTGGATACTCACGACGCGGACCC; H2-D R1/GGACACAGATGACGCGCTGGCAGG.
Super-shift assays were performed with affinity-purified antisera
(Santa Cruz) for ATF-1/CREB-1 (sc-270) and CREB-1 (sc-240).
| |
Results |
Sequence comparisons of HLA class I and II promoters
Alignment of HLA-A, HLA-B, and DRA upstream regions (Figure
1A) illustrates the strong homologies that
have been noted between the class I and class II
promoters.32,35 When read from the noncoding strand, the
site of most HLA-B alleles shows a 6 out of 7 bp match with the X2
box of the DRA gene, whereas some have a full
match.36 Overlapping the HLA-B site is the motif
CTCGTG, which has been referred to as the R1 site because its sequence is complementary to the R motif identified in the IRE region of HLA-B57.18 The R site binds the HLH/leucine zipper factor
USF, suggesting that R1 may be equivalent to the class II X3 box, which binds the HLH protein E47.14 The R1/X3 box in turn overlaps the X1 box, which is recognized by RFX and required along with the
X2/ sequence for transactivation of class I and II genes by
CIITA.13,17 Although HLA class I loci exhibit high homology over much of the X1 box, HLA-A promoters differ from the HLH and CRE
consensus sequences of the X3 and boxes, particularly in having a T
to C change at a position critical for both elements. The HLA-A loci
have an IRE that differs from other class I genes and interacts poorly
with IRF proteins,30,37 whereas its ENH-A is similar to H2
class I loci in that it has a second Rel binding site.30
View larger version (14K):
[in this window]
[in a new window]
| Fig 1.
Homologies between class I and II promoters.
(A) The upstream regions of DRA,2 HLA-B57,28
and HLA-A127 are aligned to illustrate similarities in
sequence and structure. The DRA S, X1, X2, X3, and Y
boxes2,13,14 and the class I ENH-A and ENH-B regions and
previously identified Rel, R, IRE, R1, X1, , and inverted CAAT (IC)
box control elements are indicated.15,18,24,32-34 Asterisks
indicate the residues of HLA-A loci that disrupt the consensus
sequences of the IRE, R1, and sites. (B) Lower-case letters
indicate base changes introduced into the HLA-B57 sequence for mutant
EMSA probes and HLA-B CAT reporters.
|
|
Control elements important for induction by CIITA and
IFN-
To identify the elements mediating class I induction by CIITA and to
compare their effects on the response to IFN-, a series of HLA-B
mutant reporters was constructed (Figure 1B) and tested with the YHHH
cell line, a variant of the MOLT4 human thymoma selected for its strong
class I response to type I IFN.23 Deletion of sequences
upstream of ENH-A led to increased induction by both IFN- and CIITA
(Figure 2A, B), similar to the
de-repression reported for the H-2Ld promoter.9
Mutation of the conserved Rel site in the truncated reporter led to a
25% decrease in CIITA transactivation and a much larger drop in the
IFN- response (Figure 2A, B). Mutation of the IRE eliminates the
response to IFN- as expected (Figure 2C), but only inhibits CIITA
transactivation by about 15% (Figure 2D). Therefore, both the Rel site
and IRE contribute to class I CIITA transactivation by CIITA, although
not as strongly as for induction by IFN-.
View larger version (16111011K):
[in this window]
[in a new window]
| Fig 2.
Identification of HLA-B upstream elements required for
induction by IFN- and by CIITA.
(A) YHHH cells were transfected with CAT reporter vectors and cultured
with (+) or without ( ) IFN- as described in "Materials and
methods." Transfections were performed in parallel and the CAT
activity of the HLA-B vector in the presence of IFN- was defined as
100 U. For this and subsequent figures, error bars represent SD on the
mean from at least 3 independent transfections. "C" is the
promoterless CAT vector control and "B" is the HLA-B reporter,
with 500 bp of sequence upstream of the start codon of
HLA-B57.28 Truncated (Tr) versions with 200 bp of HLA-B
upstream sequence include the conserved Rel site in ENH-A, which was
left intact, or mutated (Tr-mE). (B) Cotransfections with the HLA-B
reporters were performed with 1 µg of a control () or CIITA
(+) vector, and induced activity of the wild-type reporter was defined
as 100 U. (C) The IFN- inducibility of the full length HLA-BCAT
vector, "B," was compared with versions that had been mutated in
the IRE, X1, R1, , or IC elements (Figure 1B). (D) The HLA-B mutant
reporter series was tested with the CIITA vector as described in panel
B. (E) HeLa cells were transfected with the HLA-B reporter series
/+ CIITA as described for YHHH cells.
|
|
Previous CIITA studies used class I promoter mutations or deletions
that affected several potential control elements or their relative
spacings,9,10,17 so the HLA-B X1, R1, , and IC boxes
were mutated individually (Figure 1B). The X1 and sites were
critical for induction by IFN- (Figure 2C) as well as for transactivation by CIITA (Figure 2D). R1 and IC were also necessary for
the response to IFN- and their mutation reduced, but did not
eliminate, transactivation by CIITA. There is some cell-type specificity in the contribution of control elements, with the IC box
important for CIITA transactivation in YHHH cells (Figure 2D), while
having little effect in HeLa cells (Figure 2E). Therefore, although the
X1 and sites are critical for activity, as reported,17 the Rel, IRE, R1, and IC sites also affect transactivation by CIITA.
Furthermore, these same elements are necessary for class I induction by
IFN-.
Synergistic action of RelA, CIITA, and IRF-1
To investigate the influence of Rel and IRE sites on CIITA action,
expression vectors for RelA and IRF1 were titrated with the CIITA
vector (Figure 3A). At the levels used,
CIITA transactivated the HLA-B reporter more strongly than RelA; IRF1
had no effect. CIITA demonstrated a striking synergy with RelA and to a
lesser extent with IRF1. RelA and IRF1 have been shown previously to interact in class I induction,22,38 but under these
conditions their combined action was relatively weak. Inclusion of all
3 factors leads to a slight increase over the level of
expression achieved with RelA plus CIITA. Therefore, although CIITA can
transactivate through the HLA-B promoter alone, under limiting
conditions its activity is strongly enhanced by interaction with
factors binding to the ENH-A or IRE or both.
View larger version (14K):
[in this window]
[in a new window]
| Fig 3.
Synergistic activity of CIITA with RelA and IRF1.
(A) MOLT4 cells were transfected with the HLA-B CAT reporter along with
0.1 or 0.5 µg of expression vectors for CIITA, RelA, or IRF1. The
activity with all 3 expression vectors was defined as 100 U. (B) RelA
(0.5 µg) and CIITA (0.1 µg) expression vectors were cotransfected
with reporter plasmids consisting of the HLA-BENH-A/IRE region placed
upstream of the basal metallothionein promoter24 (left
panel) or the DRA promoter (right panel).
|
|
To determine whether the interaction between CIITA and RelA
requires class I promoter elements, the 2 factors were tested with a
reporter that has the HLA-B ENH-A and IRE region upstream of a
metallothionein promoter. This construct is sufficient to mediate
strong induction by IFN-,39 demonstrating that the class
I promoter is not absolutely required for this response. As seen in
Figure 3B, CIITA had no significant effect on the ability of RelA to
transactivate the ENH-A/IRE-metallothionein construct, and RelA did not
potentiate the action of limiting amounts of CIITA on the DRA reporter.
Therefore, the class I ENH-A and promoter regions must both be present
for the synergy of RelA and CIITA.
Differential regulation of HLA-A and HLA-B
The HLA-A promoter has a poor match with the HLH (R1) and CRE ()
consensus sequences due to a conserved T to C change (Figure 1A), but
has been shown to be transactivated strongly by CIITA.10 The R1/ regions of HLA-B or H-2D generate complexes with nuclear extracts, but no significant binding was seen with the equivalent HLA-A
promoter sequence (Figure 4). The inability
of the HLA-A promoter to interact well with nuclear factors may be
analogous to the situation with many class II promoters where
cooperative binding of multiple proteins is required to overcome the
weakness of individual control elements,40 but this remains
to be investigated.
View larger version (96K):
[in this window]
[in a new window]
| Fig 4.
Interaction of nuclear factors with MHC promoter
elements.
Nuclear extracts from HeLa (He) and YHHH cells formed complexes with
DNA probes representing the R1/ region of HLA-B (B) and H-2D (D)
genes, but not the equivalent region from HLA-A (A). Super-shift
analysis indicated that the predominant nuclear factors were CREB1 and
USF1 (data not shown).
|
|
The HLA-A loci have an IRE sequence with relatively low affinity for
IRF proteins,30 and the promoter region implicated in the
recruitment of CIITA has now been shown to interact poorly with nuclear
factors. However, we demonstrated previously that the ENH-A region of
HLA-A loci mediates stronger transactivation by RelA by virtue of
having 2 Rel binding sites, whereas HLA-B has only 1.30
Given the strong interaction between RelA and CIITA demonstrated with
the HLA-B reporter, we tested the possibility that the stronger ENH-A
of HLA-A could help compensate for its weaker promoter. The hypothesis
was first tested by comparing the relative induction by CIITA of
reporters in YHHH and HeLa cells, which have different levels of basal
class I expression mediated by ENH-A.24 The HeLa cell
experiment of Gobin et al10 using HLA-A2 and HLA-B7
reporters was repeated using saturating levels of the CIITA expression
vector with DRA, HLA-A1, and HLA-B57 reporters (Figure
5A). The class I reporters both gave a
level of transactivation roughly equal to that found with DRA. This is
similar to the earlier report, although Gobin et al10 found that the HLA-B reporter activity was about a third lower than the other
2. Allelic differences between B7 and B57 might account for this
discrepancy, but the strong induction of HLA-A is confirmed. The
experiment was repeated in YHHH cells, which have a very low basal
activity mediated by ENH-A and no detectable nuclear factors that bind
specifically to the Rel site.39 In contrast to the similar
activities seen in HeLa cells, the reporters showed substantially different levels of transactivation (Figure 5B). The HLA-A reporter was
induced weakly in comparison with HLA-B, which in turn was lower
than DRA. Therefore, there is a strong cell type dependence on the
relative transactivation of class I promoters by CIITA.
View larger version (11K):
[in this window]
[in a new window]
| Fig 5.
Differential induction of HLA-A and -B reporters by
CIITA.
HeLa cells (A) and YHHH cells (B) were transfected in parallel with
HLA-A, HLA-B, and DRA CAT reporter vectors with (+) or without
() 1 µg of CIITA expression vector. Induced activity of the
HLA-B reporter for each cell type was defined as 100 U. (C) YHHH cells
were transfected with HLA-A or HLA-B reporter vectors on their own
() or with 0.5 µg of expression vectors for RelA (A), CIITA
(CII), or both (++). Activity of the HLA-B reporter in the presence of
both RelA and CIITA vectors was defined as 100 U.
|
|
To determine if Rel factor expression could overcome the cell type
differences in HLA-A and HLA-B transactivation by CIITA, cotransfection
experiments similar to those shown in Figure 3 were performed in YHHH
cells. Again, CIITA and RelA act synergistically with the HLA-B
reporter, and their interaction is even more striking with HLA-A
(Figure 5C). At levels of CIITA that induce HLA-B expression significantly there is no effect on the HLA-A reporter, but RelA acts
similarly on the 2. However, in the presence of both transcription factors, expression from the HLA-A reporter rises to about 80% of that
seen with coinduction of HLA-B. This slightly lower activity is similar
to that seen with these reporters in HeLa cells. Therefore, the
differential induction of HLA-A and HLA-B by CIITA can be compensated
for by interactions with Rel factors acting through ENH-A.
| |
Discussion |
The MHC class I loci are expressed constitutively by many cell
types, but levels vary widely and the genes are subject to a number of
developmental controls and cytokine signals that are mediated by
multiple elements contained within a relatively short upstream region.
Although more distal sequences have been implicated in developmental
and viral controls on expression,41,42 transgenic studies
indicate that a 150 bp region encompassing the ENH-A, IRE, and
ENH-B is sufficient to mediate relatively normal
patterns of transcription and may constitute a locus control region
(LCR) for HLA class I genes.43 The data presented here
confirm the importance of individual control elements, and also
demonstrate that interactions between the primary regions of the LCR
are crucial for class I regulation by the
IFN--induced factor CIITA and by IFN-.
Cooperativity between the ENH-A and IRE is known to be important for
class I regulation by IFNs,1 and synergistic induction by
TNF and IFNs involves functional and physical interactions between
NF-B and IRF proteins that bind to these sites.21,22,29 It is now evident that CIITA is also an important contributor to
IFN--induced class I expression.9,10 Although promoter elements alone can mediate transactivation by overexpressed CIITA, upstream sequences are required for stimulation by
IFN-.10 The IRE was suggested to be the upstream element
involved in the IFN- response,10 but our demonstration
of potent synergy between RelA and CIITA indicates that factors bound
to the ENH-A contribute strongly to induction. The level of class I
expression will depend therefore on the presence of factors bound to
ENH-A, which will vary according to cell type or cytokine stimulation.
The ability of RelA to compensate for the relatively weak
transactivation of the HLA-A promoter by CIITA illustrates the
importance of functional interaction between these factors and also the
locus-specific differences that exist between class I genes. HLA-A loci
are induced poorly by IFNs in comparison with HLA-B, a deficit due at
least in part to their atypical IRE, which has a lower affinity for IRF
proteins.30,37 On the other hand, the ENH-A of HLA-A loci mediates stronger induction by Rel/NF-B factors, which are typically activated by inflammatory cytokines such as TNF and
interleukin-1.30 Therefore, the HLA loci have diverged such
that they are regulated differentially by cytokine-responsive
transcription factors. We have shown here that they also differ in the
critical ENH-B region, with the HLA-A sequence unable to interact with
nuclear factors, as detected by EMSA. CREB factors are important for
CIITA activation of class II loci,44 and a dominant
negative CREB145 inhibits CIITA induction of both HLA-A and
HLA-B reporters (data not shown), suggesting that CREB1, or a highly
related factor, is required for expression of both loci. The ability of
HLA-A to be induced by CIITA despite a poor promoter is analogous to
the situation described for some class II loci, where individual
transcription factors do not interact with the promoter, but will bind
cooperatively to the S-X-Y promoter region.40 Therefore, it
seems likely that protein-protein interactions will also be important
for assembly of appropriate factors on the HLA-A promoter that will
allow CIITA to bind. In addition, the strong ENH-A of HLA-A loci serves
to recruit NF-B factors that can cooperate with CIITA, but it
remains to be determined whether this involves direct physical interaction.
No synergy is seen between RelA and CIITA when they are coexpressed
with a class II reporter, which lacks a Rel binding site, or when the
class I Rel site is placed upstream of the metallothionein promoter,
which lacks sequences equivalent to the ENH-B region. Therefore, if
there is a physical interaction between RelA and CIITA it is of
insufficient affinity to affect transcriptional activity, and it
appears that they must be bound to their respective sites for
functional cooperation to occur. RelA and CIITA have both been shown to
interact with CBP/p300 proteins,46,47 so it is possible
that they cooperatively recruit the transcriptional machinery through
these coactivators. Transcription factors binding to the S-X-Y elements
of class II genes and to the equivalent ENH-B class I region have been
suggested to form an "enhanceosome,"17,40 but it is
interesting to note that the 70-bp spacing between ENH-A and ENH-B
places the Rel and CRE sites adjacent to each other if the class I LCR
adopts a nucleosomal arrangement.48 With such a spatial
organization, CIITA would be placed in close proximity to Rel dimers
and conceivably able to bind the same coactivators.
It is now apparent that the regulated expression of class I genes
involves the integrated action of multiple transcription factors. It
will be important to determine which proteins can assemble into the
ENH-B "enhanceosome," and whether the composition differs
according to cell type, cytokine signaling, and the HLA locus examined.
The data presented here show that ENH-B elements are required for
induction by IFN- as well as for the action of CIITA, and it remains
to be examined whether the same ENH-B components are involved
in both responses. The relatively large number of transcriptional
elements involved in basal and induced class I expression provides an
array of control points for regulation according to cell type,
differentiation stage, cell cycle, confluence, neural activity, and
exposure to cytokines.1,18,49-51 However, the existence of
several elements critical for expression also provides a number of
targets through which class I loci can be silenced in virally infected
or transformed cells, thereby promoting escape from immune
surveillance.52-54 The regulation of class I genes involves
a surprising degree of complexity, and further characterization of
their transcriptional control will be important for understanding
normal expression patterns and possible means of manipulation for
clinical purposes.
| |
Acknowledgments |
I would like to thank Dean Gentle for technical support, and
Drs G. Andersson, A. Baldwin, M. Brunda, K. Gustaffson, B. Mach, and C. Vinson for supplying reagents.
| |
Footnotes |
Submitted October 8, 1999; accepted February 4, 2000.
Supported by an MRC Senior Fellowship to J.G.
Reprints: John Girdlestone, Anatomy Dept, MRC Centre
for Immune Regulation, The Medical School, University of Birmingham, Birmingham UK B15 2TT; e-mail: girdlesj{at}bham.ac.uk.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
David-Watine B, Israel A, Kourilsky P.
The regulation and expression of MHC class I genes.
Immunol Today.
1990;11:286-292[Medline]
[Order article via Infotrieve].
2.
Glimcher LH, Kara CJ.
Sequences and factors: a guide to MHC class-II transcription.
Ann Rev Immunol.
1992;10:13-49[Medline]
[Order article via Infotrieve].
3.
Ling PD, Warren MK, Vogel SN.
Antagonistic effect of interferon- on the interferon- induced expression of Ia antigen in murine macrophages.
J Immunol.
1985;135:1857-1863[Abstract].
4.
Kaufman J, Skjoedt K, Salomonsen J.
The MHC molecules of nonmammalian vertebrates.
Immunol Rev.
1990;113:83-117[Medline]
[Order article via Infotrieve].
5.
Brown JH, Jardetzky TS, Gorga JC, et al.
Three-dimensional structure of the human class II histocompatibility antigen HLA-DR1.
Nature.
1993;364:33-39[Medline]
[Order article via Infotrieve].
6.
Steimle V, Otten LA, Zufferey M, Mach B.
Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency.
Cell.
1993;75:135-146[Medline]
[Order article via Infotrieve].
7.
Steimle V, Siegrist C-A, Mottet A, et al.
Regulation of MHC Class II expression by interferon- mediated by the transactivator gene CIITA.
Science.
1994;265:106-109[Abstract/Free Full Text].
8.
Chang CH, Guerder S, Hong SC, et al.
Mice lacking the MHC class II transactivator (CIITA) show tissue-specific impairment of MHC class II expression.
Immunity.
1996;4:167-178[Medline]
[Order article via Infotrieve].
9.
Martin BK, Chin K-C, Olsen JC, et al.
Induction of MHC class I expression by the MHC class II transactivator CIITA.
Immunity.
1997;6:591-600[Medline]
[Order article via Infotrieve].
10.
Gobin SJP, Peijnenburg A, Keijsers V, van den Elsen PJ.
Site is crucial for two routes of IFN-induced MHC class I transactivation: the ISRE-mediated route and a novel pathway involving CIITA.
Immunity.
1997;6:601-611[Medline]
[Order article via Infotrieve].
11.
Riley JL, Westerheide SD, Price JA, et al.
Activation of class II MHC genes requires both the X box region and the class II transactivator (CIITA).
Immunity.
1995;2:533-543[Medline]
[Order article via Infotrieve].
12.
Scholl T, Mahanta SK, Strominger JL.
Specific complex formation between the type II bare lymphocyte syndrome-associated transactivators CIITA and RFX5.
Proc Natl Acad Sci U S A.
1997;94:6330-6334[Abstract/Free Full Text].
13.
Mach B, Steimle V, Martinez-Soria E, Reith W.
Regulation of MHC class II genes: lessons from a disease.
Annu Rev Immunol.
1996;14:301-331[Medline]
[Order article via Infotrieve].
14.
Voliva CF, Aronheim A, Walker MD, Peterlin BM.
B-cell factor 1 is required for optimal expression of the DRA promoter in B cells.
Mol Cell Biol.
1992;12:2383-2390[Abstract/Free Full Text].
15.
Dey A, Thornton AM, Lonergan M, et al.
Occupancy of upstream regulatory sites in vivo coincides with major histocompatibility complex class I gene expression in mouse tissues.
Mol Cell Biol.
1992;12:3590-3599[Abstract/Free Full Text].
16.
Ishiguro N, Brown GD, Ishuzu A, Meruelo D.
The regulation of murineH-2Dd expression by activation transcription factor 1 and cAMP response element binding protein.
J Immunol.
1998;160:5907-5914[Abstract/Free Full Text].
17.
Gobin SJP, Peijnenburg A, van Eggermond M, et al.
The RFX complex is crucial for the constitutive and CIITA-mediated transactivation of MHC class I and 2-microglobulin genes.
Immunity.
1998;9:531-541[Medline]
[Order article via Infotrieve].
18.
Girdlestone J.
Transcriptional regulation of MHC class I genes.
Eur J Immunogenet.
1996;23:395-413[Medline]
[Order article via Infotrieve].
19.
Schoneich J, Lee JL, Mansky P, et al.
The pentanucleotide ATTGG, the "inverted CCAAT," is an essential element for HLA class I gene transcription.
J Immunol.
1997;158:4788-4796[Abstract].
20.
Harada H, Fujita T, Miyamoto M, et al.
Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes.
Cell.
1989;58:729-739[Medline]
[Order article via Infotrieve].
21.
Johnson DR, Pober JS.
Tumor necrosis factor and immune interferon synergistically increase transcription of HLA class I heavy- and light-chain genes in vascular endothelium.
Proc Natl Acad Sci U S A.
1990;87:5183-5187[Abstract/Free Full Text].
22.
Drew PD, Franzoso G, Becker KG, et al.
NF-kB and interferon regulatory factor-1 physically interact and synergistically induce MHC class I gene expression.
J Interferon Cytokine Res.
1995;15:1037-1045[Medline]
[Order article via Infotrieve].
23.
Burrone OR, Kefford RF, Gilmore D, Milstein C.
Stimulation of HLA-A, B, C by IFN-alpha. The derivation of Molt4 variants and the differential expression of HLA-A, B, C subsets.
EMBO J.
1985;4:2855-2860[Medline]
[Order article via Infotrieve].
24.
Girdlestone J.
An HLA-B regulatory element binds a factor immunologically related to the upstream stimulation factor.
Immunogenetics.
1993;38:430-436[Medline]
[Order article via Infotrieve].
25.
Luscher B, Mitchell PJ, Williams T, Tjian R.
Regulation of transcriptional factor AP-2 by the morphogen retinoic acid and by second messengers.
Genes Dev.
1989;3:1507-1517[Abstract/Free Full Text].
26.
Setterblad N, Peterlin BM, Andersson G.
Role of the X2 box inactivated transcription from the DRA promoter.
Immunogenetics.
1997;46:318-325[Medline]
[Order article via Infotrieve].
27.
Girdlestone J.
Nucleotide sequence of an HLA-A1 gene.
Nucleic Acids Res.
1990;18:6701[Free Full Text].
28.
Isamat M, Girdlestone J, Milstein C.
Nucleotide sequence of an HLA-Bw57 gene.
Nucleic Acids Res.
1990;18:6702[Free Full Text].
29.
Kunkel TA, Roberts JD, Zakour RA.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Methods Enzymol.
1987;155:166[Medline]
[Order article via Infotrieve].
30.
Girdlestone J, Isamat M, Gewert D, Milstein C.
Transcriptional regulation of HLA-A and -B: differential binding of Rel and IRF family members.
Proc Natl Acad Sci U S A.
1993;90:11568-11572[Abstract/Free Full Text].
31.
Girdlestone J, Wing M.
Autocrine activation by interferon- of STAT factors following T cell activation.
Eur J Immunol.
1996;26:704-709[Medline]
[Order article via Infotrieve].
32.
van den Elsen PJ, Peijnenburg A, van Eggermond MCJA, Gobin SJP.
Shared regulatory elements in the promoters of MHC class I and Class II genes.
Immunol Today.
1998;19:308-312[Medline]
[Order article via Infotrieve].
33.
Friedman RL, Stark GR.
Alpha interferon induces transcription of HLA and metallothionein genes which have homologous upstream sequences.
Nature.
1985;314:637-639[Medline]
[Order article via Infotrieve].
34.
Kimura A, Israël A, Le Bail O, Kourilsky P.
Detailed analysis of the mouse H-2Kb promoter: enhancer-like sequences and their role in the regulation of class I gene expression.
Cell.
1986;44:261-272[Medline]
[Order article via Infotrieve].
35.
Riegert P, Anderson R, Bumstead N, et al.
The chicken 2-microglobulin gene is located on a non-major histocompatibility complex microchromosome: a small, G+C-rich gene with X and Y boxes in the promoter.
Proc Natl Acad Sci U S A.
1996;93:1243-1248[Abstract/Free Full Text].
36.
Yao Z, Volgger A, Scholz S, Albert ED.
Sequence polymorphism in the HLA-B promoter.
Immunogenetics.
1995;41:343-353[Medline]
[Order article via Infotrieve].
37.
Hakem R, le Bouteiller P, Jezo-Bremond A, et al.
Differential regulation of HLA-A3 and HLA-B7 class I genes by IFN is due to two nucleotide differences in their IFN response sequences.
J Immunol.
1991;147:2384-2390[Abstract].
38.
Johnson DR, Pober JS.
HLA class I heavy-chain gene promoter elements mediating synergy between tumor necrosis factor and interferons.
Mol Cell Biol.
1994;14:1322-1332[Abstract/Free Full Text].
39.
Travers H, Girdlestone J.
IFN super-induction of HLA class I expression by a variant thymoma cell line involves nuclear translocation of Rel complexes.
Eur J Immunol.
1998;28:3792-3799[Medline]
[Order article via Infotrieve].
40.
Boss JM.
Regulation of transcription of MHC class II genes.
Curr Opin Immunol.
1997;9:107-113[Medline]
[Order article via Infotrieve].
41.
Tang X, Li H, Sakatsume O, et al.
Cooperativity between an upstream TATA-like sequence and a CAA repeated element mediates E1A-dependent negative repression of the H-2Kb class I gene.
J Biol Chem.
1995;270:2327-2336[Abstract/Free Full Text].
42.
Drezen JM, Cohentannoudji M, Pournin S, et al.
Developmental expression of H-2K MHC class I transgene requires the presence of proximal introns.
Dev Dyn.
1995;204:98-105[Medline]
[Order article via Infotrieve].
43.
Kushida MM, Dey A, Zhang X, et al.
A 150-base pair region of the MHC class I HLA-B7 gene is sufficient to direct tissue-specific expression and locus control region activity.
J Immunol.
1997;159:4013-4929.
44.
Moreno CS, Beresford GW, Louis-Plence P, et al.
CREB regulates MHC class II expression in a CIITA-dependent manner.
Immunity.
1999;10:143-151[Medline]
[Order article via Infotrieve].
45.
Ahn S, Olive M, Aggarwal S, et al.
A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos.
Mol Cell Biol.
1998;18:967-977[Abstract/Free Full Text].
46.
Perkins ND, Felzien LK, Betts JC, et al.
Regulation of NF-kappaB by cyclin-dependent kinases associated with the p300 coactivator.
Science.
1997;275:523-527[Abstract/Free Full Text].
47.
Kretsovali A, Agalioti T, Spilianakis C, et al.
Involvement of CREB binding protein in expression of major histocompatibility complex class II genes via interaction with class II transactivator.
Mol Cell Biol.
1998;18:6777-6783[Abstract/Free Full Text].
48.
Luger K, Mader AW, Richmond RK, et al.
Crystal structure of the nucleosome core particle at 2.8 A resolution.
Nature.
1997;389:251-260[Medline]
[Order article via Infotrieve].
49.
Erusalimsky JD, Gilmore D, Milstein C.
The induction of class I HLA by IFN-a is independent of the cell cycle, but the expression is enhanced by a G1/S block.
Eur J Immunol.
1987;17:623-628[Medline]
[Order article via Infotrieve].
50.
Friedman RL, Manly SP, McMahon M, et al.
Transcriptional and posttranscriptional regulation of interferon-induced gene expression in human cells.
Cell.
1984;38:745-755[Medline]
[Order article via Infotrieve].
51.
Corriveau RA, Huh GS, Shatz CJ.
Regulation of class I MHC gene expression in the developing and mature CNS by neural activity.
Neuron.
1998;21:505-520[Medline]
[Order article via Infotrieve].
52.
Maudsley DJ, Pound JD.
Modulation of MHC antigen expression by viruses and oncogenes.
Immunol Today.
1991;12:429-431[Medline]
[Order article via Infotrieve].
53.
Browning MJ, Bodmer WF.
MHC antigens and cancer: implications for T-cell surveillance.
Curr Opin Immunol.
1992;4:613-618[Medline]
[Order article via Infotrieve].
54.
Peltenberg LTC, Schrier PI.
Transcriptional suppression of HLA-B expression by c-Myc is mediated through the core promoter elements.
Immunogenetics.
1994;40:54-61[Medline]
[Order article via Infotrieve].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
Related Letter in Blood Online:
-
Locus-specific regulation of HLA-A and HLA-B expression is not determined by nucleotide variation in the X2 box promoter element
- Sam J. P. Gobin, Peter J. van den Elsen, and John Girdlestone
Blood 2001 97: 1518-1521.
[Full Text]
[PDF]
This article has been cited by other articles:
|
|
|
|
 
T. K. Howcroft, J. D. Weissman, A. Gegonne, and D. S. Singer
A T Lymphocyte-Specific Transcription Complex Containing RUNX1 Activates MHC Class I Expression
J. Immunol.,
February 15, 2005;
174(4):
2106 - 2115.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Dressel, C. Grzeszik, M. Kreiss, D. Lindemann, T. Herrmann, L. Walter, and E. Gunther
Differential Effect of Acute and Permanent Heat Shock Protein 70 Overexpression in Tumor Cells on Lysability by Cytotoxic T Lymphocytes
Cancer Res.,
December 1, 2003;
63(23):
8212 - 8220.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Liu, R. C. McEachin, and D. J. States
Computationally Identifying Novel NF-kappa B-Regulated Immune Genes in the Human Genome
Genome Res.,
April 1, 2003;
13(4):
654 - 661.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. R. Johnson
Locus-Specific Constitutive and Cytokine-Induced HLA Class I Gene Expression
J. Immunol.,
February 15, 2003;
170(4):
1894 - 1902.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Urosevic, J. Willers, B. Mueller, W. Kempf, G. Burg, and R. Dummer
HLA-G protein up-regulation in primary cutaneous lymphomas is associated with interleukin-10 expression in large cell T-cell lymphomas and indolent B-cell lymphomas
Blood,
January 15, 2002;
99(2):
609 - 617.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. P. Gobin, P. J. van den Elsen, and J. Girdlestone
Locus-specific regulation of HLA-A and HLA-B expression is not determined by nucleotide variation in the X2 box promoter element
Blood,
March 1, 2001;
97(5):
1518 - 1521.
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction