|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 12 (June 15), 2000:
pp. 3845-3852
IMMUNOBIOLOGY
Lineage-specific regulation of the murine RAG-2 promoter:
GATA-3 in T cells and Pax-5 in B cells
Hiroyuki Kishi,
Xing-Cheng Wei,
Zhe-Xiong Jin,
Yoshiyuki Fujishiro,
Takuya Nagata,
Tadashi Matsuda, and
Atsushi Muraguchi
From the Department of Immunology, Faculty of Medicine, Toyama
Medical and Pharmaceutical University, Toyama, Japan.
 |
Abstract |
Recombination activating gene-1 (RAG-1) and
RAG-2 are expressed in lymphoid cells undergoing the antigen
receptor gene rearrangement. A study of the regulation of the mouse
RAG-2 promoter showed that the lymphocyte-specific promoter activity is
conferred 80 nucleotide (nt) upstream of RAG-2. Using an
electrophoretic mobility shift assay, it was shown that a
B-cell-specific transcription protein, Pax-5, and a T-cell-specific
transcription protein, GATA-3, bind to the  80 to 17 nt
region in B cells and T cells, respectively. Mutation of the RAG-2
promoter for Pax-5- and GATA-3-binding sites results in the reduction
of promoter activity in B cells and T cells. These results indicate
that distinct DNA binding proteins, Pax-5 and GATA-3, may regulate the
murine RAG-2 promoter in B and T lineage cells, respectively.
(Blood. 2000;95:3845-3852)
© 2000 by The American Society of Hematology.
| |
Introduction |
Recombination activating gene-1
(RAG-1)1 and RAG-2 are the essential and
tissue-specific components of the V(D)J
recombination.1,2 It has been demonstrated that these genes
are sufficient for the recognition and initial cleavage of DNA
containing recombination signal sequences.3-6 Disruption of
either RAG-1 or RAG-2 in the germline of a mouse
completely prevented the rearrangement of immunoglobulin (Ig)
and T cell receptor (TCR) genes and blocked the
development of mature B and T lymphocytes.7,8 It has also
been shown that the mutation of human RAG-1 or RAG-2
caused severe combined immunodeficiency without B
lymphocytes9 and Omenn syndrome with a few
antigen repertoires of lymphocytes.10
RAG-1 and RAG-2 expressions are lymphoid-specific and
are regulated developmentally.11,12 RAG-1 and
RAG-2 are expressed in pro-B cells or pro-T cells in a
concordant manner when rearrangement of the IgH or TCR
chain gene occurs. Secondary expression of RAG-1 and
RAG-2 occurs when the IgL or TCR chain loci
undergo VJ rearrangement to produce mature B or T cells. Recently it
has been demonstrated that antigen stimulation induces reexpression of
RAG-1 and RAG-2 in mature lymphocytes in peripheral
lymphoid organs,13-15 which indicates that RAG-1
and RAG-2 play a role in editing the lymphocyte repertoire in
the periphery.16
We and others have been studying the transcriptional regulation
of the RAG gene.17-19 It has been shown that the
5' flanking region of the human RAG-1 gene functions as a
minimal promoter, but it does not confer lymphocyte-specific expression
of RAG-1. Concerning the lymphocyte-specificity and
differentiation stage-specificity of the RAG-1 expression, it
has been demonstrated that alteration of the chromatin structure
detected by deoxyribonucelase I (DNase I) hypersensitivity takes place
in accordance with the RAG-1 expression.19,20 In
this report we describe the lymphocyte-specific promoter activity of
the mouse RAG-2 5' flanking region and demonstrate that
distinct lymphoid-specific transcriptional factors are required for
activation of the murine RAG-2 promoter in B and T lymphocytes.
| |
Materials and methods |
Isolation of mouse RAG-2 genomic clones
Mouse RAG-2 genomic clones were isolated from a  FIX II library
(Stratagene, La Jolla, CA) and screened by using a radio-labeled full-length mouse RAG-2 complementary DNA (cDNA)1 as
described previously.17 Several clones were isolated, and 2 of them (mRAG-2-4 and mRAG-2-6) were analyzed by restriction enzyme
mapping and DNA sequencing (Dye Terminator Cycle Sequencing FS Ready
Reaction Kit; Perkin-Elmer, Foster City, CA).
5' rapid amplification of cDNA ends
(RACE)
5' RACE was performed (5' RACE System; Life
Technologies, Gaithersburg, MD) according to the manufacturer's
instruction. Briefly, poly-A+ RNA was prepared from
thymocytes and reverse transcribed with Superscript II
reverse transcriptase (RT) for 50 minutes at 42°C with 2.5 pmoles
of gene-specific primer 1 (GSP1) located at 392-412 base pair (bp) of
mouse RAG-2 cDNA1 (5'-GAG TCT ATG CTG CCT TTG
TA-3'). After ribonuclease (RNase) H digestion, cDNA was purified with GLASSMAX spin cartridge and tailed with deoxycytidine
5'-triphosphate (dCTP) using terminal
deoxynucleotidyltransferase. The cDNA was subsequently amplified in a
polymerase chain reaction (PCR) using an anchor primer and GSP2, which
is located at 165-184 bp of mouse RAG-2 cDNA (5'-CAU CAU CAU CAU
TGA CCC ACT GTT ACC ATC TG-3'). PCR conditions included 1 cycle
of 2 minutes at 94°C followed by 35 cycles of 0.5 minutes at
94°C, 0.5 minutes at 55°C, 2 minutes at 72°C, and finally
an extension for 7 minutes at 72°C. The amplified products were
subcloned into pT7Blue-T vector (Novagen, Madison, WI) and subjected to
DNA sequencing analysis as described above.
Cell lines and cell culture
The following cell lines were used for transfection or preparation
of nuclear extracts: 18.8.1 (pre-B cell,
RAG-2+),21 BAL17 (B cell, RAG-2+),
and WEHI279 (B cell, RAG-2 )22 (gift of K
Sakaguchi, Kumamoto University, Kumamoto, Japan); WEHI231 (B cell,
RAG-2)21 and M1 (myeloid,
RAG-2) (gift of Dr H. Kikutani, Osaka University,
Osaka, Japan); LSB11-1 (T cell, RAG-2+)21; EL4
(T cell, RAG-2)21; 110TC (T cell,
RAG-2)21; WEHI3 (myeloid,
RAG-2)22; L (fibroblast,
RAG-2); and NIH3T3 (fibroblast,
RAG-2). Expression of RAG-2 mRNA in the cell lines
was examined by RT-PCR as described by Chun et al.23 All
cells were grown in RPMI 1640 medium supplemented with 10% fetal calf
serum (FCS), 50 µmol/L 2-mercaptoethanol, 100 U/mL penicillin, and
0.1 mg/mL streptomycin at 37°C in 5% carbon dioxide
(CO2).
Construction of plasmids
RAG-2 promoter fragments were generated by PCR using the cloned
genomic DNA as a template; the oligonucleotide 1 as a common 3'
primer; and the oligonucleotides 2 (639 to +147 nt genomic DNA
fragment [639/+147]), 3 (430/+147), 4 (86/+147), and
5 (41/+147) as 5' primers. Amplified fragments were cloned
into the pT7Blue-T vector. The fragments were then cut out by digesting with NcoI and SalI restriction enzymes and
reinserted into the NcoI and XhoI restriction enzyme
sites of the PicaGene basic vector 2 or enhancer vector 2 (Nippon Gene,
Tokyo, Japan). To prepare the luciferase construct with either the
251/+147 or +44/+147 fragment, the luciferase construct with the
430/+147 fragment was digested with either restriction enzymes
NdeI and HindIII or NdeI and PstI and
then blunt-end ligated. Mouse TCR 3' enhancer24 was cloned into the SpeI and KpnI restriction enzyme
sites of the luciferase constructs in the PicaGene basic vector 2.
For preparation of the 86/+147 fragment with a mutation for a
Pax-5 binding site (M2 mutation), the 86/17 fragment with the M2 mutation was prepared by PCR using the cloned genomic DNA as a
template and primers 6 and 7, and the 33/+147 fragment with the
M2 mutation was prepared using primers 1 and 8. The 86/+147 fragment with the M2 mutation was amplified using both the
86/17 fragment with the M2 mutation and the
33/+147 fragment with the M2 mutation as templates and primers 1 and 4. The 86/+147 fragment with mutation for the GATA binding
site was prepared by PCR using the cloned genomic DNA as a template and
primers 1 and 9.
Transfection and luciferase assay
For transfection of luciferase constructs into cells other than
fibroblasts, the DEAE dextran method was used. Briefly,
5 × 106 cells were incubated in 1 mL 0.5 mg/mL
diethylaminoethyl (DEAE) dextran (Pharmacia, Uppsala, Sweden) in
Tris-buffered (tris[hydroxymethyl] aminomethane-buffered) saline
containing 5 µg luciferase reporter gene and 5 µg
pSR-lacZ gene17 for 10 minutes at room
temperature. Cells were washed and incubated in RPMI 1640 medium
containing 10% FCS and 100 µmol/L chloroquine (Sigma Chemical, St
Louis, MO) for 60 minutes at 37°C. Cells were then spun down and
reincubated in RPMI 1640 containing 10% FCS at 37°C. For
transfection into fibroblasts, the calcium phosphate method was used.
Briefly, DNA precipitation was prepared by adding 456 µL DNA solution
containing 15 µg luciferase reporter gene, 15 µg
pSR-lacZ gene, and 0.25 mol/L calcium
dichloride (CaCl2) into 456 µL 0.05 mol/L
HEPES (4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid) (pH 7.1), 0.28 mol/L sodium chloride (NaCl), 0.7 mmol/L sodium
dihydrogenphosphate (NaH2PO4), and 0.7 mmol/L
disodium hydrogenphosphate (Na2HPO4). After 30 minutes incubation at room temperature, the DNA precipitate was added
evenly over a 10-cm plate of cells in Dulbecco's Modified Eagle Medium
(D-MEM) containing 10% FCS. Cells were harvested 22-24 hours after
transfection, and luciferase activity and -galactosidase activity
was measured as described previously.17
The luciferase constructs used for the luciferase reporter gene assay
contained either the TCR enhancer or SV40 enhancer to augment the
transcriptional activity. This was done because a genomic DNA fragment
spanning from the 1.1 kb to +147 nt or its truncated fragments
linked upstream of the luciferase gene showed undetectable luciferase
activity in the absence of an enhancer region in any cell lines
including the RAG-2-expressing lymphocyte cell lines. The constructs
with the TCR enhancer were introduced into RAG-2-expressing
(LSB11-1, 18.8.1, or BAL17) cell lines or RAG-2-nonexpressing (EL4 or
110TC) lymphoid cell lines. The constructs with the SV40 enhancer were
introduced into nonlymphoid cell lines (L and NIH3T3) as well as
18.8.1, a pre-B cell line.
Electrophoretic mobility shift assay
Electrophoretic mobility shift assay (EMSA) was performed
according to the method described by Schreiber et al.25 The
following fragments were used as a probe DNA: 80/17
fragment, 85/56 fragment, or the fragment containing the
tandemly repeated GATA binding sequence. The probe DNA was labeled with
-32P-dATP by filling with the Klenow fragment. Nuclear
extracts (2 µL) were incubated with the 32P-labeled probe
DNA at room temperature for 20 minutes in 15 µL reaction mixture
containing 4% Ficoll 400 (Pharmacia), 20 mmol/L HEPES (pH 7.9), 50 mmol/L potassium chloride (KCl), 1 mmol/L ethylenediamine tetraacetic
acid (EDTA), 1 mmol/L dithiothreital (DTT), 0.25 mg/mL bovine serum
albumin (BSA), and 1-2 µg poly(dI-dC) (Pharmacia). After incubation
samples were loaded onto a 4% polyacrylamide gel, which was prerun for
1 hour at 4°C (100 V) in Tris-glycine buffer and electrophoresed at
4°C (100 V) for 2-3 hours. The gels were dried and exposed to X-ray
film (Fuji Film, Tokyo, Japan). For preparation of nuclear extracts
containing recombinant GATA-3, an expression vector for mouse GATA-3
cDNA (gift of Dr M. Yamamoto, Tsukuba University, Tsukuba, Japan) was
transfected into 293T cells by a calcium phosphate method, and nuclear
extracts were prepared 24 hours after transfection.
Where indicated, competitor DNA or antibodies to transcription factors
(Santa Cruz Biotechnology, Santa Cruz, CA) were added to the binding
reaction. Competitor DNA was prepared by PCR using the following primer
pairs (fragments): 6/10 (80/17), 6/11
(80/42), 6/12 (80/30), 13/12
(65/30), 13/10 (65/17), or 14/10
(51/17). For preparation of the mutated
80/17 fragment, the following primer pairs (fragments)
were used: 6/15 (80/17M1), 6/7 (80/17M2), 6/16 (80/17M3), or 6/17 (80/17M4).
Consensus binding sequences of c-Myb, Ikaros,26 GATA-3, or
Pax-5 or mutated binding sequences of Pax-527 were prepared
by annealing oligonucleotides of 18/19, 20/21, 22/23, 24/25, or 26/27
primer pairs, respectively. Fragments 85/56 or
85/56 with mutation for a GATA binding site were prepared
by annealing oligonucleotides of 28/29 or 9/30 primer pairs.
Oligonucleotides
The following oligonucleotides were used in this study: 1, 5'-GGGGTACCATGGCCAGAGGGGCTGCTTATC-3';
2, 5'-CCATCTAAGCTTTGTGGAAG-3'; 3, 5'-CCTGTATTCACAGGCATCAC-3'; 4, 5'-TTCTGTCTCCCTCAACCATC-3'; 5, 5'-AGGTCACAGTCAGTTACTCC-3'; 6, 5'-GCTCTAGATCTCCCTCAACCATCACAGG-3'; 7, 5'-TAACGTTCG- TAACTGACTGTGACCTC-3'; 8, 5'-GTCAGTTACGAACGTTACACCAGTACAC-3'; 9, 5'-TTCTGTCTCCCTCAACCAAGACAGGGGTGC-3'; 10, 5'-GCTCTAGATAACGGGAGTAACTGAC-3'; 11, 5'-GCCTTCCCCCTCCCTGCACCC-3'; 12, 5'-TGACTGTGACCTCCTTCCCC-3'; 13, 5'-ACAGGGGTGCAGGGAGGGGGAA-3'; 14, 5'-AGGGGGAAGGAGGTCACAGT-3'; 15, 5'-TACATGGAGTAACTGACTGTGAC-3'; 16, 5'-TAACGGGATGCACTGACTGTGACCTCCTT-3'; 17, 5'-TAACG-GGAGTACAGGACTGTGACCTCCTT-3'; 18, 5'-TACAGGCATAACGGTTCCGTAGT-GA-3'; 19, 5'-TCACTACGGAACCGTTATGCCTGTA-3'; 20, 5'-GTTTCCATGACATCATGATGGGGGT-3'; 21, 5'-ACCC- CCATCATGATGTCATGGAA-3'; 22, 5'-CACTTGATAACAGAAAGTGATAACTCT-3'; 23, 5'-AGAGTTATCACTTTCTGTTATCAAGTG-3'; 24, 5'-TACCCTTGATCAAAGCAGTGTGACGGTAGC-3'; 25, 5'-GCTACCGTCACACTGCTTTGATCAAG-3'; 26, 5'-GACCCTTGATCA- AAGCAGTATGATGGTAGC-3'; 27, 5'-GCTACCATCATACTGCTTTGATCAAG-3'; 28, 5'-TTCTGTCTCCCTCAACCATCACAGGGGTGC-3'; 29, 5'-TTGCACCCCTGTGATGGTTGAGGGAGACAG-3'; 30, 5'-TTGCACCCCTGTCTTGGTTGAGGGAGACAG-3'.
| |
Results |
Isolation of mouse RAG-2 genomic DNA clones and characterization
of its 5' flanking region
Mouse genomic clones mRAG-2-4 and mRAG-2-6, which contain the total
DNA region of the published mouse RAG-2 cDNA,1 were isolated by screening a mouse genomic DNA library. Restriction enzyme
mapping, Southern blot hybridization, DNA sequencing analysis of these
clones, and Southern blot hybridization analysis of mouse genomic DNA
revealed that the mouse RAG-2 genome consists of 3 exons (data not shown).
To determine the transcription start site of the mouse RAG-2
genome, 5' RACE was performed using mouse thymocyte
poly-A+ RNA. We sequenced 16 clones that contain
anticipated restriction enzyme sites. As shown in Figure
1, transcription initiated primarily from 2 adjacent nucleotides. No TATA box is present at the 5' upstream
region of the mouse RAG-2 genome. At the major transcription initiation
site, there is a sequence (CTCACTGG) similar to an initiator sequence (CTCANTCT), which directs the initiation
site of transcription.28 Comparison of nucleotide sequences
around the transcription initiation site of the mouse and the human
RAG-2 genome (Figure 1B) revealed that the promoter region is conserved between mice and humans. The reported transcription initiation site of
the human RAG-2 genome is about 30 bp downstream from that of the mouse
RAG-2 genome.29
View larger version (33K):
[in this window]
[in a new window]
| Fig 1.
Characterization of the mouse RAG-2 promoter region.
(A) Mapping of the transcription initiation site of mouse RAG-2
by 5' RACE. The darkened circle denotes the transcription
initiation sites of independent cDNA clones characterized by DNA
sequence analysis. The major transcription initiation site (+1) and the
first exon (boxed) are noted. An arrow indicates the 5' end of
the reported mouse RAG-2 cDNA.1 (B) Alignment of the mouse
RAG-2 promoter region with that of the human RAG-2 promoter region. The
major transcription initiation site (+1) is indicated by an arrow. The
asterisk denotes the identical nucleotide (indicated by a capital
letter). Some spaces (dotted lines) are inserted to produce maximal
matching. Initiator sequence-like sequence is underlined. Boxed
sequences indicate the 80/17 fragment used as a probe for
EMSA in Figures 4 and 5.
|
|
Lymphoid-specific promoter activity in mouse RAG-2
5' flanking region
The promoter activity of the 5' flanking region of the mouse
RAG-2 gene was examined by a transient expression assay using luciferase reporter gene constructs (Figures 2 and 3). Because the
luciferase activity of the mouse RAG-2 promoter constructs was too weak
to be detected, we inserted the TCR enhancer or SV40 enhancer to
augment the transcriptional activity (data not shown). Luciferase
constructs containing 1.1 kb to +147 nt genomic DNA fragment and
its truncated fragments with the TCR enhancer were transfected into
RAG-2-expressing lymphoid cell lines (LSB11-1, 18.8.1, or
BAL17) and RAG-2-nonexpressing lymphoid cell lines (EL4 or
110TC), and relative luciferase activity was determined. As shown in
Figure 2, a fragment containing 1.1
kb to +147 nt exhibited a significant promoter activity not only in
RAG-2-expressing lymphoid cell lines but also in
RAG-2-nonexpressing lymphoid cell lines. Successive deletion
of 5' flanking region from 1.1 kb to 86 nt did not
affect the promoter activity. A significant decrease in the RAG-2
promoter activity was seen when sequences between 86 and
41 nt were deleted. The promoter activity was completely lost by
the deletion of sequences between 41 and +44 nt.
View larger version (26K):
[in this window]
[in a new window]
| Fig 2.
Promoter activity of the 5' flanking region of the
mouse RAG-2 in lymphoid cells.
Schematic diagram of luciferase reporter constructs fused to RAG-2
promoter sequences is shown on the left, and the promoter activity in
various lymphoid cells is on the right. For the luciferase reporter
constructs and the pSR-LacZ reference plasmids, 5 µg of each were
transfected into 5 × 106 mouse lymphoid cell lines
(see "Materials and methods"), and their activities were assessed
22-24 hours later. Luciferase activity was normalized with
-galactosidase activity, and luciferase construct without a promoter
fragment was given a reference value of 1. Error bars indicate
deviation of 3-4 experiments.
|
|
To determine the cell specificity of the promoter region, luciferase
constructs containing 639/+147 nt genomic DNA fragment and its
truncated fragments with SV40 enhancer were transfected into a lymphoid
cell line (18.8.1) and nonlymphoid cell lines (L and NIH3T3), and the
relative promoter activity was assessed. As shown in Figure
3, the promoter activity was detected in
the 18.8.1 cell line but not in either the L or NIH3T3 cell lines. The
promoter activity was drastically reduced when DNA fragments were
truncated from 86 to 41 nt in 18.8.1 cells. These results indicate the presence of the positive lymphoid-specific regulatory element(s) between the 86 and +44 nt region.
View larger version (15K):
[in this window]
[in a new window]
| Fig 3.
Promoter activity of the 5' flanking region of
mouse RAG-2 in nonlymphoid cells.
Schematic diagram of luciferase reporter constructs fused to RAG-2
promoter sequences is shown on the left, and promoter activity in
lymphoid 18.8.1 or nonlymphoid cells (L and NIH3T3) is on the right.
Promoter activities were analyzed as in Figure 2. Error bars indicate
deviation of 3 experiments.
|
|
Mouse RAG-2 promoter binding protein expressed in B-cell lineage
Between 86 nt and +1 (a transcription initiation site), the
80/17 nt region was well conserved between the mouse and
human RAG-2 5' upstream region (Figure 1B), and this region
exhibited the full promoter activity (data not shown). Thus, DNA
binding proteins to the 80/17 promoter region were
searched by EMSA (Figure 4). By using the
80/17 DNA fragment as a probe, only 2 major DNA/protein
complexes were detected in the nuclear extract prepared from the 18.8.1 cells (Figure 4A, C1 and C2 complexes). The unlabeled
80/17 fragment completely inhibited the formation of the C1 and C2 complexes, which indicated that some nuclear proteins
specifically bound to the fragment to form the C1 and C2 complexes. The
C1 complex was detected not only in the nuclear extract of 18.8.1 pre-B cells but also in the NIH3T3 or L fibroblast cells. In contrast,
the C2 complex was detected only in the nuclear extract of the 18.8.1 cells (Figure 4A).
View larger version (47K):
[in this window]
[in a new window]
| Fig 4.
DNA binding proteins that bind to the 80/17
nt region of the RAG-2 promoter in B-lineage cells.
(A) Nuclear proteins binding to RAG-2 promoter. EMSA was performed as
described in "Materials and methods" by incubating nuclear
extracts prepared from 18.8.1 cells, L cells, or NIH3T3 cells and the
32P-labeled probe DNA (the 80/17 nt region of
the RAG-2 promoter in Figure 1B) in the absence or presence of 100-fold
the excess amount of cold probe DNA. C1 and C2 indicate complexes of
nuclear protein and probe DNA, and F indicates free probe DNA.
(B) Analysis of the R2BP binding region. EMSA was performed
using nuclear extracts prepared from 18.8.1 cells and the
32P-labeled probe DNA as mentioned above in the
presence of various competitor DNA (A-F), as depicted on the top. (C)
Mutation analysis of the binding region of R2BP. The RAG-2 promoter
fragment (80/17 nt region) containing altered nucleotides
was prepared (M1-M4, shown on the top). EMSA was performed as in panel
B in the presence of 50-fold and 200-fold molar excess of the
wild type 80/17 fragment and the M1, M2,
M3, or M4 fragment. Histograms indicate the relative density of the C2
complex shown on the bottom. The density of the C2 complex, in the
absence of a competitor, is denoted as 100%.
|
|
To determine the specificity of the expression of these DNA binding
proteins, nuclear extracts from various cell lines were prepared and
analyzed by EMSA. As shown in Table 1, the
nuclear protein forming C2 complex was found in the extracts of all
B-lineage cells but not in those of the other lineage cells
including the T-lineage cells. The C1 complex was detected in
extracts of all cell lines investigated (data not shown). We
referred the protein forming C2 complex as the RAG-2 promoter binding
protein (R2BP).
To determine the binding region of R2BP, a series of RAG-2 promoter
deletions were prepared and used as competitors for EMSA (Figure 4B).
DNA fragments of 80/17, 65/17, or
51/17 interfered in the formation of the C2 complex,
while DNA fragments lacking the 30 to 17 nt region
(80/42, 80/30, or 65/30)
could not inhibit the formation of the C2 complex, which shows that the
30 to 17 nt region was indispensable for the binding of R2BP. To identify the nucleotides responsible for the binding of R2BP,
the 80/17 DNA fragments with serial nucleotide
alterations between 30 and 17 nt (M1, M2, M3, or M4) were
generated, and their ability to inhibit the formation of the C2 complex
in EMSA was investigated. As shown in Figure 4C, the wild
type 80/17 fragment and either the M1, M3, or M4 fragment
completely inhibited the C2 complex formation, whereas the M2 fragment
failed to inhibit the C2 complex formation. The results clearly show
that the altered nucleotides in the M2 fragment are critical for the
binding of R2BP.
Figure 5A shows the putative transcription
factors that bind between the 40 and 17 nt region of the
mouse RAG-2 promoter. To clarify which transcription factor(s) is
responsible for the formation of the C2 complex, consensus binding
sequences of c-Myb, Ikaros, and Pax-5 were generated, and their ability
to inhibit the formation of the C2 complex was tested. As shown in
Figure 5B, c-Myb binding and Ikaros binding sequences did not inhibit the binding of R2BP, whereas Pax-5 binding sequences completely inhibited the binding of R2BP to the 80/17 DNA fragment.
The mutant Pax-5 binding DNA sequence, to which Pax-5 cannot
bind,27 did not inhibit the binding of R2BP. Furthermore,
anti-Pax-5 antibody, but not anti-c-Myb antibody, caused a supershift
of the C2 complex (Figure 5C). These results show that R2BP corresponds
to Pax-5.
View larger version (24K):
[in this window]
[in a new window]
| Fig 5.
Identification of R2BP as a Pax-5.
(A) Putative binding sites of transcription factors in the RAG-2
promoter. The asterisk denotes a nucleotide identical with consensus
binding sequences (c-Myb, 5'-GNCNGTT-3';
Ikaros,
5'-T/CGGGAA/T-3';
Pax-5,
5'-CTTGA/GTCAAA/TGCAGT/CGT/GG/AACG/CG/ATAGC-3'27),
and the minus sign shows a nucleotide nonidentical with consensus
binding sequences. (B) Competition of R2BP binding with the consensus
sequence of Pax-5. EMSA was performed as in Figure 4 using nuclear
extract prepared from 18.8.1 cells and the 80/17 nt RAG-2
promoter region as a probe. The consensus binding sequence for
the c-Myb, Ikaros, Pax-5, or Pax-5 binding sequence mutant
(Pax-5m) was used as a competitor. Histograms indicate the relative
density of the C2 complex shown on the bottom. The density of the C2
complex in the absence of the competitor is denoted as 100%. (C) The
effect of anti-Pax-5 antibody on EMSA. EMSA was performed as described
above in the absence or the presence of anti-Pax-5 or anti-c-Myb
antibody. The asterisk denotes the band shifted with the anti-Pax-5
antibody.
|
|
Mouse RAG-2 promoter binding protein expressed in T-cell lineage
Using the 80/17 RAG-2 promoter fragment, we could not
detect any DNA binding protein specifically expressed in the T-cell lineage. Search for putative binding sites of transcription factors revealed that a potential GATA binding sequence (CATC) exists in the
80/66 sequence (Figure 6A),
which is conserved between mice and humans (Figure 1B). Thus, we
prepared a DNA fragment containing a tandem repeat of the GATA binding
sequence (Figure 6, legend) and performed EMSA. As shown in Figure 6B,
the C3 and C4 complexes were formed by proteins in the EL4 extract, and
these complexes were inhibited by the GATA binding sequence as well as
the 85/56 sequence. Inhibition by the 85/56
fragment was specific because the 51/17 fragment did not
inhibit the formation of the C3 and C4 complexes (data not shown).
View larger version (45K):
[in this window]
[in a new window]
| Fig 6.
Identification of T-cell-specific binding protein as
GATA-3.
(A) Putative binding site for the GATA family in the RAG-2 promoter.
Possible GATA binding site present in the 85/56 RAG-2
promoter region is indicated by an arrow. The asterisk denotes a
nucleotide identical with the consensus GATA family binding sequences
5'-TATC-3'. The TC in the putative GATA binding site was
altered to AG (underlined) in the 85/56 Gm.
(B) Nuclear proteins binding to the RAG-2 promoter in T cells. EMSA was
performed by incubating nuclear extract prepared from EL4 cells and the
32P-labeled probe containing GATA binding sites
(5'-AAGCTTGATGCT- CTAGATAACGGGAGTAGCTCTAGATAACGGGGTCACAGTCAGTTACTCCCGT- TATCTAGAGCGTCACAGTCAGTTACTCCCGTTAGTCACAGTCAGTTACTCCC- GTTATCTAGAGCATCGAATTC-3')
in the presence of 4 mmol/L magnesium chloride (MgCl2). C3
or C4 indicates a nuclear protein complex with probe DNA, and F
indicates a free probe DNA. As a competitor, we used 100-fold or
400-fold molar excess of consensus binding sequences for GATA, the
85/56 fragment, or the 85/56
Gm. (C) The effect of anti-GATA-3 antibody on EMSA. EMSA
was performed as described above in the presence of anti-GATA-3 or
anti-c-Myb antibody. The asterisk denotes the band shifted with the
anti-GATA-3 antibody. (D) Binding of GATA-3 to the 85/56
region. EMSA was performed by incubating nuclear extracts prepared from
293T cell transfectants of GATA-3 and the 32P-labeled
85/56 fragment. C5 or C6 indicates a complex of a nuclear
protein and probe DNA, and F indicates a free probe DNA. A 200-fold
molar excess of the 85/56 fragment and consensus binding
sequences for GATA were used as competitors. We used 0.5 µg
anti-GATA-3 antibody or control mouse IgG for the supershift analysis.
The asterisk denotes the band shifted with the anti-GATA-3 antibody.
|
|
At the top of the gel, a high molecular weight complex was observed,
but the complex was not competed by the 85/56 fragment, indicating that the DNA binding protein(s) forming this complex does
not bind to the 85/56 promoter region. The
85/56 fragment with a mutation for the putative GATA
binding sequence (Figure 6A) did not inhibit the C3 and C4 complex
formation. The C3 and C4 complexes were detected in the nuclear
extracts from other T cell lines, but they were not detected in those
from B cell lines or nonlymphoid cell lines (Table
2). These results indicate that a GATA
binding protein may be responsible for the formation of the C3 and C4
complexes and that it binds to a possible GATA binding site located at
the 68/66 fragment of the mouse RAG-2 promoter. The C3
complex may correspond to the complex with 2 GATA proteins, and the C4
complex may correspond to one with a single GATA protein. Because
GATA-3 is a T-cell-specific GATA family, we examined whether or not
GATA-3 bound to the RAG-2 promoter. As shown in Figure 6C, anti-GATA-3
antibody, but not anti-c-Myb antibody, caused the supershift of the C3
and C4 complexes.
To further confirm the binding of GATA-3 to the 85/56
fragment, we used the 85/56 fragment as a probe and
performed EMSA. Nuclear extracts containing recombinant GATA-3 were
prepared from 293T cell transfectants and used for EMSA. As shown in
Figure 6D, 2 protein/DNA complexes, C5 and C6, were formed, and the
formation of these complexes were inhibited by the unlabeled
85/56 fragment. In those complexes, only the C5 complex
was specifically competed out by the consensus GATA binding sequence
and supershifted by the binding of the anti-GATA-3 antibody. These
results confirmed that GATA-3 binds to the 85/56 mouse
RAG-2 promoter fragment and forms the C5 complex. When EMSA was
performed using the DNA fragment containing the tandem repeat of the
GATA binding sequence and the nuclear extracts containing recombinant
GATA-3, the signal of the GATA-3 complex was more than 100-fold
stronger than that formed with the 85/56 fragment.
Furthermore, when EMSA was performed using the nuclear extracts
prepared from EL4 cells and the 85/56 fragment as a
probe, GATA-3 binding was not observed (data not shown). Taken
together, although the affinity of GATA-3 to the 85/56
fragment was not high, GATA-3 in T-cell nuclear extracts bound to the
mouse RAG-2 promoter region.
Possible involvement of Pax-5 or GATA-3 in RAG-2
promoter activity in B or T cells
To examine whether Pax-5 or GATA-3 is involved in mouse RAG-2
promoter activity, luciferase constructs with the 86/+147 mouse RAG-2 promoter fragment containing the mutation for a Pax-5 binding site (M2) (Figure 4C) or for a GATA binding site (Gm) (Figure 6A) were
transfected into a pre-B cell line, 18.8.1 cells, or an immature T
cell line, LSB11-1, and the relative luciferase activity was measured.
As shown in Figure 7, the M2 binding site exhibited a decreased promoter activity in the 18.8.1 cells but not in
the LSB11-1 cells. Contrary to this, the Gm showed significantly decreased promoter activity in the LSB-11 cells but not in the 18.8.1 cells. The result suggests that Pax-5 is involved in activation of
the RAG-2 promoter in B-lineage cells, and GATA-3 is involved in the
activation of the RAG-2 promoter in T-lineage cells.
View larger version (17K):
[in this window]
[in a new window]
| Fig 7.
Possible involvement of Pax-5 and GATA-3 in mouse RAG-2
promoter activity.
Luciferase constructs were transfected together with pSR-LacZ
reference plasmids into 5 × 106 B-lineage cells
(18.8.1) or T-lineage cells (LSB11-1) and analyzed for activity as
shown in Figure 2. Four luciferase constructs were used: without a
promoter, with the wild type 86/+147 RAG-2 promoter (WT), or
with the promoter containing a nucleotide alteration in either the
Pax-5 binding site (M2) (Figure 4C) or GATA binding site (Gm) (Figure
6A). Representative data of 3 independent experiments are shown.
|
|
| |
Discussion |
To understand the regulatory mechanism of the RAG gene
expression, we cloned the mouse RAG-2 genomic genes, determined
its transcription initiation site as well as the core promoter region, and demonstrated the involvement of separate transcription factors in
the regulation of RAG-2 promoter activity in B- and T-lineage cells. The transcription initiation site of mouse RAG-2,
approximately 30 bp upstream from that of human RAG-2, was
determined by 5' RACE (Figure 1). We found that the 5'
flanking regions of both mouse and human RAG-2 were highly
conserved, indicating that the fundamental transcriptional regulation
of RAG-2 may be conserved between mice and humans. As
demonstrated in the 5' flanking region of human RAG-1 and
RAG-2,17,18,29 no canonical TATA box is located
within anticipated distances from the transcription initiation site of
mouse RAG-2. However, a sequence (CTCACTGG) similar
to an initiator sequence (consensus, CTCANTCT) was found at
the major transcription initiation site. An initiator-like sequence
(CTCTCTTT) is also located at the
transcription initiation site of human RAG-2, as described by
Zarrin et al.29 An initiator sequence directs the
initiation site of transcription in some TATA-less promoter, such
as the terminal deoxynucleotidyltransferase gene,28 and may
play a role in localizing the transcriptional machinery to the RAG-2 promoter.
The 5' flanking region of the mouse RAG-2
conferred a significant level of luciferase activity when transfected
into RAG-2-expressing as well as RAG-2-nonexpressing
lymphoid cell lines (Figure 2). However, its promoter region did not
exhibit the luciferase activity when transfected into nonlymphoid cell
lines (Figure 3). This clearly indicates that the minimal promoter
region of the mouse RAG-2 contains a cis-element that confers
lymphoid-specific expression of RAG-2. It also indicates that
the differentiation stage-specific expression of RAG-2 may be
regulated by other mechanisms such as the enhancer or suppresser
cis-element or alteration of the chromatin structure. Concerning the
chromatin structure, we20 and Fuller et al19
demonstrated the appearance of DNase I hypersensitive sites surrounding
mouse or human RAG-1, which is located adjacent to
RAG-2 and expressed in concert with RAG-2, and that
their appearance accompanies lymphocyte development and RAG-1 expression.
To search the transcriptional factors regulating the
lymphoid-specific RAG-2 promoter activity, EMSA was performed with the core RAG-2 promoter fragment. We demonstrated that Pax-5 binds to the
core promoter region in B-lineage cells and that GATA-3 binds to the
region in the T-lineage cells (Figures 4-6). So far, there has been no
identification of common lymphoid-specific factors that bind to the
core RAG-2 promoter region. Furthermore, the alteration of nucleotides
that abolished the binding of Pax-5 resulted in a decrease of the
promoter activity in a B cell line but not in a T cell line. In
contrast, the change of nucleotides that abolished the binding of
GATA-3 exhibited a decrease of the promoter activity in a T cell line
but not in a B cell line (Figure 7). The results indicate that these
sites are important for the RAG-2 promoter activity when analyzed by
luciferase reporter gene assay. It should be necessary to
demonstrate the binding of Pax-5 or GATA-3 to these sites in
situ in order to prove the physiological importance of these
transcription factors in RAG-2 promoter activity.
It is noted that mutations in both Pax-5 binding and GATA-3 binding
sites did not reduce the promoter activity to the background level,
which indicates that other factor(s) may also be involved in the RAG-2
promoter activity. It is also noted that alteration of the Pax-5
binding site of the promoter region caused a significant enhancement of
the promoter activity in a T cell line (Figure 7B). The data pose a
possibility that repressing factor(s) bind to the Pax-5 binding site in
T-lineage cells. In this respect, Figure 4 indicates the presence of an
additional factor(s) other than Pax-5 or GATA-3 that binds to the
80/17 mouse RAG-2 promoter region. The DNA binding
protein forming the C1 complex existed in the extracts prepared from
all cell lineages, and the complex formation was inhibited by the
fragments 65/17 and 51/17, which
demonstrates that the protein binding site may overlap with that of
Pax-5. The database search revealed putative transcription factor
binding sites in the 51/17 fragment including the binding sites for CF-1, which interact with the c-myc and actin promoter as
well as the immunoglobulin enhancer30; CREB,
a cyclic adenosine monophosphate CcAMP response element binding
protein31; and AP-1, a fos/jun complex.32 These
factors are ubiquitously expressed and could repress the mouse RAG-2
promoter activity in T cells. This is merely a speculation and should
be investigated at the molecular level.
Pax-5 is specifically expressed in B cells in lymphoid
organs.33 It has been shown that B-cell differentiation was
completely blocked at an early precursor stage in mice lacking Pax-5,
although T-cell differentiation was not affected.34 On the
contrary, GATA-3 was specifically expressed in T-lineage
cells,35 and GATA-3/ES cells
failed to differentiate into T-lineage cells.36 Recently it
has also been indicated that GATA-3 is involved in Th2 cell development
from the Th0 precursor cells.37 In this study we showed
that these key transcription factors, which are involved in
the commitment of either B or T lineage, play an important role in the
promoter activity of mouse RAG-2. Concerning transcription factors regulating lymphocyte development, PU.1 and Ikaros are expressed in pluripotent stem cells, lymphoid progenitors, and immature or mature lymphocytes.38 During the commitment to
lymphocytes, E2A, early B cell factor (EBF), and Pax-5
are expressed in B-lineage cells, and GATA-3 is expressed in T-lineage
cells, which indicates that commitment to lymphocytes is regulated by
different factors rather than common factors in B- and T-lineage cells.
Recently, Nutt et al39 showed that Pax-5-deficient pro-B
cells, which had been expanded on stroma cells in the presence of
interleukin-7 (IL-7), expressed RAG-1 and RAG-2, and
the data indicated that Pax-5 is not necessarily required for
RAG expression. However, it should be noted that the data also
demonstrated that B-lymphoid progenitor cells could never be detected
in Pax-5-deficient fetal liver, which strongly suggests that the
function of Pax-5 can be compensated for by the other factors derived
from stroma cells and/or IL-7. As described above, E2A and EBF are
potential transcription factors during early B-cell development.
However, no putative binding sites for these factors were present up to 86 nt in the mouse RAG-2 promoter region. It should be clarified whether such B-cell-specific transcription factors bind to a
cis-element in the other region to regulate RAG-2 expression or
whether other novel transcription factors are induced by signals from
bone marrow stroma cells and IL-7.
During the preparation of our manuscript, a report40
indicating the involvement of Pax-5 in the regulation of the RAG-2 promoter in B cells was published. Lauring and Schlissel40
have characterized the promoter of the mouse RAG-2 gene and
determined the transcription initiation site. When compared to the data
in the present study, the transcription start site they determined was
29 nt downstream. They have also shown that deletion of the RAG-2
promoter region to 42 nt still possesses a full promoter activity in B-lineage cells. The authors concluded that the 3' downstream region from the 42 nt was essential for the promoter activity in B-lineage cells. However, in this study we demonstrated that deletion of the RAG-2 promoter sequences to 86 nt showed a
full promoter activity, but its deletion to 41 nt resulted in a
decrease, by half, of the promoter activity in B-lineage cells (Figure
2). This indicates that the 86/42 fragment is also
involved in the RAG-2 promoter activity in B-lineage cells. In the case
of T-lineage cells, they indicated that the 127/78 region
was indispensable for the promoter activity. However, we have shown
here that the deletion to 86 nt still exhibited the full
promoter activity in T-lineage cells, and we finally found that GATA-3
was bound to the 80/56 region with a core sequence of
5'-ATC-3' at 68 nt. Our data show that the
80/42 region plays an important role in T-cell-specific
regulation of the RAG-2 promoter activity. These contradictions between
our data and theirs may be derived from the differences of reporter
genes used. With this regard, we used luciferase reporter constructs
with TCR enhancer to augment the transcriptional promoter activity
of RAG-2 in this study.
Analysis of the mouse RAG-2 promoter has provided insight into the
basis of constitutive expression of RAG-2 in lymphocytes. Our
study shows that the 5' flanking region of mouse RAG-2
contains the promoter that confers lymphocyte-specific expression of
RAG-2 and that distinct DNA binding proteins may separately
regulate RAG-2 expression in B- and T-lineage cells. Lauring
and Schlissel40 have demonstrated that Pax-5 binds to the
RAG-2 promoter in vivo by in vivo footprint analysis. To demonstrate
the role of GATA-3 in RAG-2 promoter activity in vivo, we should
further analyze the binding of GATA-3 to the promoter region in T cells
by in vivo footprint analysis as well as the effect of dominant
negative GATA-3 on RAG-2 expression in T cells. It should also
be noted that factors which confer the regulatory mechanisms for
transcriptional activation as well as inactivation of the RAG-2
gene during lymphocyte development remain to be clarified.
| |
Acknowledgments |
We thank Dr K. Sakaguchi for providing 18.8.1, WEHI279, and BAL17
cell lines; Dr H. Kikutani for donating M1 and WEHI3 cell lines; and
Dr M. Yamamoto for the generous gift of GATA-3 cDNA.
| |
Footnotes |
Submitted October 8, 1999; accepted February 11, 2000.
Supported by a grant-in-aid from the Ministry of
Education, Science, Sports, and Culture of Japan (11470169), Tokyo, Japan.
Reprints: Atsushi Muraguchi, Department of Immunology, Faculty
of Medicine, Toyama Medical and Pharmaceutical University, 2630 Sugitani, Toyama, 930-0194 Japan; e-mail:
gucci{at}ms.toyama-mpu.ac.jp |
Top
Abstract
Introduction