|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 12 (June 15), 2000:
pp. 3978-3985
RED CELLS
Mild spherocytic hereditary elliptocytosis and altered levels of
 - and  -adducins in  -adducin-deficient mice
Andrés F. Muro,
Martín L. Marro,
Sre ko Gajovi,
Fabiola Porro,
Lucio Luzzatto, and
Francisco E. Baralle
From the International Centre for Genetic Engineering and
Biotechnology, Trieste, Italy; Department of Histology and Embryology,
School of Medicine, University of Zagreb, Zagreb, Croatia; and the
Department of Human Genetics, Memorial Sloan-Kettering Cancer Center,
New York, New York.
 |
Abstract |
The membrane skeleton, a dynamic network of proteins associated with
the plasma membrane, determines the shape and mechanical properties of
erythrocytes. Deficiencies or defects in membrane skeletal proteins are
associated with inherited disorders of erythrocyte morphology and
function. Adducin is one of the proteins localized at the
spectrin-actin junction of the membrane skeleton. In this work we show
that deficiency of  -adducin produces an 80% decrease of
 -adducin and a fourfold up-regulation of  -adducin in
erythrocytes. -Adducin or any other isoform generated by translation
of abnormally spliced messenger RNAs could not be detected by our
antibodies either in ghosts or in cytoplasm of  / erythrocytes.
Actin levels were diminished in mutant mice, suggesting alterations in
the actin-spectrin junctional complexes due to the absence of adducin. Elliptocytes, ovalocytes, and occasionally spherocytes were found in
the blood film of / mice. Hematological values showed an increase
in reticulocyte counts and mean corpuscular hemoglobin concentration,
decreased mean corpuscular volume and hematocrit, and normal
erythrocyte counts that, associated to splenomegaly, indicate that the
mice suffer from mild anemia with compensated hemolysis.
These modifications are due to a loss of membrane surface and
dehydration that result in an increase in the osmotic fragility of red
blood cells. The marked alteration in osmotic fragility together with
the predominant presence of elliptocytes is reminiscent of the human
disorder called spherocytic hereditary elliptocytosis. Our results
suggest that the amount of adducin remaining in the mutant animals
(presumably adducin) could be functional and might account for
the mild phenotype.
(Blood. 2000;95:3978-3985)
© 2000 by The American Society of Hematology.
| |
Introduction |
The erythrocyte membrane skeleton, a dynamic network of
proteins associated with the plasma membrane, determines the shape and
mechanical properties of the red blood cells (RBCs). Spectrin, the most
abundant component of this two-dimensional lattice, is organized into a
polygonal network linked to short actin filaments. The spectrin-actin
junctions contain a group of proteins that promote and modulate
spectrin-actin interactions, form membrane associations, and regulate
the actin filament length.1
Erythrocyte adducin is one of the proteins localized at the
spectrin-actin junction. The adducin protein family is composed of 3 members encoded by closely related genes:  -, -, and
-adducin.2,3 Both - and -adducin primary
transcripts undergo alternative splicing, generating a wide variety of
messenger RNAs (mRNAs),4-8 although there is no evidence
that all generated isoforms are translated to proteins. The and subunits, but not the , are found in human erythrocytes as a mixture
of heterodimers and heterotetramers, whereas combinations of /
and / oligomers are found in other cells.3,9 Adducin
subunits have 3 distinct domains: a 39 kd NH2-terminal
globular protease-resistant head domain, a 9 kd neck domain, and a
protease-sensitive tail domain.10 They are phosphorylated
by protein kinases A (PKA) and C (PKC).11-13 -Adducin is
also phosphorylated by tyrosine kinase and Rho-kinase.13,14 The COOH termini of adducin monomers contain a basic stretch of 22 amino acids highly homologous to MARCKS proteins3,10 that bind to calmodulin and contain the major PKC phosphorylation
sites.12 The MARCKS domain, together with a recently
described oligomerization domain localized in the neck region, is
required to form a complex with the fast-growing ends of actin
filaments recruiting spectrin and preventing addition or loss of actin
subunits.15 Contrary to the tail and neck domains, in vitro
experiments with recombinant mutated -adducin showed that the head
domain is not necessary for spectrin-actin interactions, but it could
be important for tetramer formation.11
Erythrocyte adducin binds to the spectrin-actin complex promoting the
assembly of additional spectrin molecules onto actin filaments,16 bundles actin filaments,17 and
acts as capping protein of the barbed (fast growing) ends of actin
filaments.18 These functions are regulated by
phosphorylation and Ca++-calmodulin
interactions.9,12,17,19,20 In nonerythroid cells, it has
been shown that hts, a Drosophila adducin-related protein,
co-localizes with spectrin, and it is required for ring canal formation
(an actin-rich structure) during oogenesis.21,22 In
mammals, adducin is found at sites of cell-to-cell contact in a
Ca++-dependent localization, promoting the assembly of
spectrin (or fodrin) into a more stable structure.19
Our group identified - and -adducins as proteins carrying
mutations in the Milan hypertensive rat strain.4
Interestingly, the Milan hypertensive rat strain erythrocytes were
smaller and osmotically more fragile than those of the Milan
normotensive rat strain.23 To elucidate the in vivo role of
-adducin, we have used gene targeting in embryonic stem (ES) cells
to create a null mutation in mice. In this work, we analyzed the
hematological consequences of the deficiency of -adducin. The
absence of -adducin resulted in an 80% reduction in the -adducin
and 15% in actin levels, and in the fourfold up-regulation of the
-adducin subunit. We found that -adducin-mutant mice developed a
mild compensated hemolytic anemia characterized by increased osmotic
fragility (OF) and elliptocytosis.
| |
Materials and methods |
Targeted disruption of the -adducin gene
An 18.5-kilobase (kb) genomic clone for the murine -adducin gene
extending from intron 5 to intron 15 was isolated from a 129/Sv lambda
FixII library (a gift of G. Friedrich). The 8.0-kb BamHI fragment
(containing exons 6 to 8) and the 2-kb EcoRI-XbaI fragment (having exon
14) were cloned into the HindIII and BamHI sites of the pD350.1 vector
(carrying the neomycin phosphotransferase [NeoR] cassette),
respectively. The complete insert was cloned into a pBSKSII vector
already containing the thymidine kinase gene. Transfected MPI II ES
cells24 were cultured and selected with G418 and
gancyclovir. Genomic DNA of selected clones was analyzed by Southern
blot, using an 800 base pair (bp) 3' external probe fragment
(Figure 1A). Morula aggregation and embryo
transfer were performed using standard techniques. Male chimeras,
identified by coat color, were mated to C57BL/6 females to generate
heterozygous animals. They were crossed with C57BL/6 animals for 5 generations to obtain a homogeneous C57BL/6 inbred background, arriving
to 98.4% of C57 BL/6 genetic background. For Southern blot analysis, tail DNA was digested either with XbaI or with EcoRI and hybridized with an internal or external probe, respectively.
View larger version (74K):
[in this window]
[in a new window]
| Fig 1.
Comparison of mouse, rat, and human amino acid sequences.
Alignment of amino acid sequences of mouse, rat, and human -adducin
(-Add97 form). The putative  9-13 -adducin gene product
generated from -adducin / mice is indicated as "mouse
/." Filled triangles and numbering indicate the
represented exons according to Gilligan et al.7 White
triangles in exons 10 and 11 indicate the end of the -adducin head
domain (aa 1-338) and the beginning of the tail region (aa 419-726),
respectively. The neck region (aa 339-418) is located in between the
white triangles. The boxes indicate the different functional domains:
oligomerization domain (aa 335-436, 99% identity),15
calmodulin-binding domain (aa 425-461, 97.2% identity),27
PKA phosphorylation region (aa 523-534, 100% identity),13
and calmodulin-binding domain (MARCKS domain, aa 705-721, 100%
identity).2,12 Asterisks indicate identical residues,
whereas 2 dots indicate conservative substitutions. Aa sequences have
an overall 90.0% identity and 94.8% similarity.
|
|
Detection of gene products
Total RNA was isolated from brain and spleen from wild-type (+/+),
heterozygous (+/), and mutant (/) mice and loaded in 1.2%
agarose-formaldehyde gels (20 µg/lane), transferred to nylon membranes, and hybridized with an entire rat -adducin
complementary DNA (cDNA) probe.4
cDNA cloning of wild type and deleted -adducins
The cDNA from 1 µg of spleen total RNA from +/+ and / mice
was generated using a standard reverse transcription protocol. The cDNA
was PCR-amplified with primers based on the -Add97 rat sequence
(5' CTCTCAGGGGCAGCACTACTTTG 3' and 5'
AGGACCCACTGAGCCACTAATCAG 3', respectively). The PCR products were
cloned and fully sequenced (GeneBank Accession Numbers: AF189 769 and
AF189 770 for wild-type- and 9-13--Adducins, respectively). At
least 3 clones originated from independent RT-PCR reactions were
sequenced and compared to detect possible mutations introduced by the
RT-PCR procedure.
Light and scanning electron microscopy
Blood smears were air dried and viewed under a light microscope
either without staining by use of simple contrast enhancement obtained
by closure of iris and slight decentering of the condensator or with
staining by May-Gruenwald Giemsa and viewed in conventional bright
field. Scanning electron microscopy of RBCs was performed on the native
blood smears from peripheral blood with the use of the Variable
Pressure Scanning Electron Microscope SEM LEO 435VP or sputter coated
by gold and examined by JEOL JSM 5800 scanning electron microscope.
Protein analysis of RBCs
Erythrocyte ghosts were prepared from freshly drawn blood
anticoagulated in EDTA as described by Bennett25 with minor
modifications. Ghost membranes were extracted with a Triton X-100
containing solution (10 mmol/L Tris HCl, pH = 8.2; 100 mmol/L NaCl; 1 mmol/L EDTA; 2 mmol/L DTT; 0.5% Triton X-100; and protease
inhibitors). After centrifugation (18 000g for 40 minutes),
the pellets (cytoskeletons) were resuspended and re-extracted in the
same solution. Finally, they were washed twice with the same buffer
without Triton. For cytoplasm protein preparations, RBCs were
separated, washed, and lysed in 7.5 mmol/L sodium phosphate
(pH = 7.5), 1 mmol/L EDTA, and protease inhibitors as
described25 with minor modifications. The lysed RBCs were
ultracentrifuged, and the supernatant was used for further analysis.
The protein concentrations were measured by triplicate with the Bio-Rad
Protein Assay Kit. Membrane and cytoskeletal proteins were
electrophoresed on a 5%-17% (Laemmli system) gradient SDS-PAGE. The
gels were stained with Coomassie blue and analyzed by densitometry,
using the NIH Image 1.61 software.
For Western blot, cytoplasmatic and ghost proteins were electrophoresed
on an 8% Laemmli gel, blotted onto nitrocellulose membranes, and
probed with the rabbit anti--, -, and -adducin polyclonal
antibodies (1:500, 1:1000, and 1:1000 dilution, respectively). The
experiments were repeated with identical results with 3 independent protein preparations.
Antibodies
Anti-- and -adducin polyclonal antibodies were generated by
immunizing rabbits with recombinant full-length rat - and -Add97 adducin subunits, respectively. Anti-mouse 9-13 -adducin
antibodies were generated by expressing the full-length deleted cDNA
(that was cloned from / mice, see above) in a bacteria system,
and the SDS-PAGE purified protein was used as immunogen.
Anti--adducin antibodies were obtained by immunizing rabbits with
the recombinant C-terminal region of the mouse -subunit (GeneBank
Accession Number: AF189 772). The antibodies showed no
cross-reactivity in the conditions used in the experiments.
Hematological analysis
Blood from 4- to 5-month-old wild-type and -adducin / mice
was collected in EDTA-containing tubes. Routine hematologic parameters
were determined on a Technicon H-1 cell counter, using veterinary
software containing mouse parameters. Reticulocyte counts were
performed using the Reti-Count kit (Becton Dickinson) in a FACS
analyser (FACSCalibur, Becton Dickinson) and confirmed using the
standard methylene blue coloration of the same samples. Total bilirubin
levels were analyzed according to standard methods.
Osmotic fragility test
This test was performed from freshly drawn blood as indicated by
Try,26 except that the NaCl solutions used were [%
(wt/vol)] 0.300, 0.350, 0.400, 0.450, 0.475, 0.500, 0.525, 0.550, 0.575, 0.600, 0.625, and 0.650. Five 2- to 4-month-old and 5 8- to
10-month-old wild-type and / mice were analyzed. The experiment
was repeated 3 times with similar results.
| |
Results |
Targeted disruption of the -adducin gene
The human -adducin gene consists of 17 exons that span more than
at least 100 kb.7 Its primary transcript undergoes a complex pattern of alternative splicing,6-8 generating the
-Add97 and -Add63 mRNAs families.4 The -Add97 form
(also called 1 form7) contains all exons, except for a
novel 86 bp exon8 and is the most abundant
form.2 The -Add63 form, also called 2,7
is generated on utilization of a polyadenylation site found in the
unspliced intron that follows exon 13.4,6 Exons 9, 11, and
12 can function as acceptor splicing sites for alternatively spliced
mRNAs both from the -Add97 and -Add63 mRNA families previously
described.4,6-8 However, all possible -adducin isoforms
have not yet been detected.
We have cloned and sequenced the mouse -Add97 cDNA (GeneBank
Accession Number: AF189 769), and sequence comparison between human,
rat, and mouse -adducin mRNAs showed 86.3% homology between them
and 95.8% between rat and mouse cDNAs. Comparison of the amino acid
sequences showed 90.2% identity and 96.0% similarity between human,
rat, and mouse -adducin subunits (Figure 1). The identity was almost
complete for the functional domains, suggesting a total conservation of
adducin functions across species (Figure 1).
To analyze the in vivo function of -adducin, we carried out a
targeted disruption of the -adducin gene. We cloned an 18.5-kb genomic fragment containing exons 6 to 15 from a c129/Sv mouse library.
Then, we deleted exons 9 to 13 and replaced them with a NeoR cassette
in our targeting construct. This deletion ensured the elimination of
all -adducin mRNA isoforms6,7 (Figures 1 and
2A) and the exons that encompass the most
important functional domains, including the newly defined
oligomerization domain,15 the calmodulin-binding domain of
the neck region,27 PKA phosphorylation sites,13
the region containing the R529Q polymorphism associated with
hypertension in rats,13 and a major part of the tail domain responsible for modulating adducin activity15,17,18,20
(Figure 1). The deletion of exons 9 to 13 should then result in the
elimination of -adducin known functions.
View larger version (44K):
[in this window]
[in a new window]
| Fig 2.
Targeted disruption of the mouse -adducin gene.
(A) Partial restriction map of a portion of the mouse -adducin locus
with the targeting construct and the resulting targeted allele shown
below. Numbered boxes represent exons according to the numbering in
humans.7 Asterisks indicate exons containing acceptor
splicing sites used in -adducin alternative splicing. The -Add63
isoform is generated by unprocessing of the intron located downstream
of exon 13.4 The NeoR cassette (NEO) and the thymidine
kinase gene (TK) are marked. EcoRI (R) and EcoRV (V) restriction sites
are indicated. An 800-bp 3' flanking fragment (black bar over
exon 17) was used as the Southern blot hybridization probe. The
expected bands for EcoRI and EcoRV cuts are indicated. (B) DNA of G418
resistant clones was cut with EcoRI (lanes 1-4) or EcoRV (lanes 5-8)
and analyzed by Southern blot. Homologous recombination occurred in 2 clones (lanes 1 and 3; and 5 and 7) as indicated by the presence of
both wild-type and targeted alleles.
|
|
After ES cell electroporation and selection, we obtained 2 positive
clones from 350 G418 resistant clones (Figure 2B). Chimeras were
obtained by morula aggregation, and germ-line transmission of the
targeted allele was confirmed by Southern blot of agouti progeny. Mice
heterozygous for the -adducin mutation were fertile and showed no
obvious phenotypical alterations. The heterozygous animals were crossed
for 5 generations to obtain a homogeneous C57BL/6 background. After
intercrosses of heterozygous animals, we obtained homozygous mice. The
targeted allele segregated at the expected mendelian frequency,
revealing 26.2% of -adducin mutant mice, 47.6% of heterozygous
mice, and 26.2% of wild-type mice from 126 offspring born from 19 heterozygous +/ mating pairs. -Adducin / mice reached
adulthood without showing any obvious phenotypical abnormality, and
they reproduced at the same rate as their wild-type littermates. Also,
no difference by gross histological and pathological analysis of mouse
organs from / mice was detected, except for the observed
splenomegaly described below.
RNA and protein analysis of -adducin in mutant mice
Northern blot analysis showed the presence of smaller mRNA species
both in total RNA from brain and spleen of / animals (Figure
3A). Deletion of exons 9 to 13 corresponded
to a reduction of 744 bases of the -Add97 mRNA and the elimination
of all the 3' coding and noncoding end of -Add63. The
-adducin major transcript observed in / brain was clearly
smaller than the 8-kb mRNA found in the wild-type brain, and its size
(approximately 7.3 kb) corresponded to the deleted -adducin mRNA
lacking the 744 bases (compare bands a- and b-, Figure 3A). A similar
size reduction in brain transcripts of / mice was seen for the
minor -adducin expressed mRNAs in the 3-kb to 4-kb region (Figure
3A, region c-). The 2 mRNA species observed in / spleen (Figure
3A, bands e- and f-) were also smaller than the Add97 mRNAs seen in
wild-type animals (Figure 3A, band d-). Cloning and sequencing of band
e- mRNA confirmed the absence of exons 9 to 13 (Figure 1) from the
mutant mRNA (GeneBank Accession Number: AF189769). We have not
investigated the nature of band f-. The heterozygous animals presented
both the wild-type and deleted mRNA forms in brain and spleen. Very low
levels of the 7.3-kb transcript were seen in the brain of the /
mice (21% of the level of the 8-kb transcript in wild-type animals,
Figure 3A and C), and a minor decrease in mRNA levels was detected in the heterozygous brain (83% of the wild type, Figure 3A and C). On the
contrary, no differences in mRNA levels between wild-type and mutant
animals were observed in the spleen (Figure 3A and C).
View larger version (47K):
[in this window]
[in a new window]
| Fig 3.
RNA and protein analysis of the -adducin / mice.
(A) Northern blot analysis of brain and spleen -adducin mRNA from
adult wild-type (+/+), heterozygous (+/), and homozygous mutant
(/) mice. The arrows indicate the different -adducin mRNA
species detected. (B) Methylene blue staining of the membrane utilized
in A. (C) The signals obtained in A were normalized against the 18S RNA
content present in the membrane. RNA levels are expressed as a
percentage of the RNAs of wild-type mice for each tissue. (D) Western
blot analysis of brain (lanes 1-6) and spleen (lanes 7-9) protein
extracts (30 µg) from adult wild-type (+/+), heterozygous (+/),
and homozygous mutant (/) mice using a rabbit anti-mouse
-adducin 9-13 polyclonal antibody. Lanes 4-6 are a 15×
overexposure of the blot shown in lanes 1-3. The -adducin (-Add97
form) bands are marked by black arrows. (E) Western blot analysis of
ghost proteins (lanes 1-3, 0.7 µg; lane 4, 10 µg), bacteria
purified recombinant mouse -adducin 9-13 (lanes 8 and 9, containing 2 and 5 ng of purified protein, respectively), and RBC
cytoplasmic proteins (lanes 10-12, 100 µg) was revealed with the same
antibody utilized in panel D. Lanes 1 to 3 are a lower exposure of the
blot shown in lanes 5 to 7. The -adducin (-Add97 form) and the
recombinant -adducin 9-13 product (Rec.) are marked by a black
arrow and a black dot, respectively. The lower molecular weight bands
seen in lane 10 are marked by gray arrows.
|
|
Although a deleted mRNA form was present in the brain and spleen of
mutant mice, no protein (normal or deleted forms) was detected either
in these tissues or in RBC skeletons of -adducin / mice by
Western blot, using polyclonal antibodies against the deleted form
produced by translation of the cloned cDNA lacking exons 9 to 13 (Figure 3D and 3E), or against the full-length rat -adducin. This
finding was also observed in other tissues of mutant mice
(data not shown). The anti-mouse 9-13 -adducin antibody recognized efficiently the wild-type -adducin subunit
in brain, spleen, and RBC ghosts (Figure 3D, lanes 1, 4, and 7; Figure
3E, lane 1 and 5). The absence of -adducin or any deleted product was observed in / animals (Figure 3D, lanes 3 and 9; Figure 3E,
lane 3). This finding was further confirmed in a much
higher exposure of these lanes (Figure 3D, lane 6 and Figure 3E, lane 7) and by the absence of signal in an overloaded well of / ghost sample (15 times the amount loaded before; Figure 3E, lane
4). Brain and spleen from +/ animals had approximately
50% of -adducin levels found in +/+ mice (Figure 3D, lanes 2, 5, and 8). However, only a 15% reduction of the -adducin levels (± 6%, n = 3) was observed in -adducin levels of ghosts prepared
from heterozygous +/ mice (Figure 3E, lanes 2 and 6). Protein
extracts of RBC cytoplasm showed the absence of -adducin in
wild-type, heterozygous, or homozygous mutant mice (Figure 3E, lanes
10-12). However, 2 specific minor bands of lower molecular weight were
seen in the wild-type sample that might be degradation products of the
full-length -adducin not incorporated into the membrane skeleton of
the RBCs (Figure 3E, lane 10, gray arrows). Furthermore, we were unable
to detect the presence of any deleted isoform in the cytoplasmic
protein extracts from +/ and / mice (Figure 3E, lanes 11-12),
suggesting that putative translational products of the targeted allele,
if present, might be degraded in the RBC cytoplasm of these mice.
Hematological analysis of -adducin / mice
Hematological analysis showed evidence of mild anemia with
compensated hemolysis in the -adducin / mice. There was a
significant decrease in the hematocrit, mean corpuscular hemoglobin
(MCH), and hemoglobin values in these mice (Table
1); erythrocytes were significantly smaller
and had a significant increase in mean corpuscular hemoglobin
concentration (MCHC) values, suggesting a loss of membrane surface and
dehydration. Reticulocyte counts were increased in +/ and /
mice, having the +/ animals an intermediate value between +/+ and
/ mice. Spleen weight ranged from 0.3% in control mice to 1% of
the animal weight in / mice. These data indicate hemolysis of
mutant RBCs that are consistent with the observed splenomegaly.
Finally, bilirubin analysis showed slightly higher levels in mutant
mice. These data suggested the presence of a mild anemia with
compensated hemolysis in mutant mice.
Light and scanning electron microscopy of RBCs
Light and scanning electron microscopy of peripheral blood smears of
-adducin / mice showed heterogeneity of the erythrocyte shapes, including normal erythrocytes, elliptocytes, rounded
elliptocytes, and occasional spherocytes (Figure
4). Extreme elliptocytosis in the form of
rod-shaped elliptocytes was not found. The RBCs from mutant mice had
the degree of concavity much less pronounced than normal, indicating
that the cells are thicker.
View larger version (68K):
[in this window]
[in a new window]
| Fig 4.
Morphology of RBCs.
Native (A and E) and May-Gruenwald Giemsa stained (B and F) light
microscopy and scanning electron (C, D, G, and H) microscopy of
peripheral blood smears of wild-type (A, B, and C) and mutant (D, E,
and F) mice. The abnormal morphology and the decrease in the concavity
of erythrocytes of mutant mice is seen. Bar 10 µm (A, B, C, E, F, and
G), 5 µm (D and H).
|
|
OF analysis of RBCs
The OF test is the most sensitive test generally available to detect
cells that are less tolerant to osmotic stress than normal cells.28 The RBCs from -adducin / mice showed an
increase in their in vitro OF when exposed to hypotonic NaCl solutions. We found that the NaCl concentration that produced 50% hemolysis (C50) was sharply higher in the mutant mice (Figure
5), whereas heterozygous +/ animals
showed an intermediate OF phenotype. C50 values were
0.585% [wt/vol] NaCl for / RBCs, and 0.545% and 0.501% NaCl
for +/ and +/+ mice, respectively (Table
2). Younger (2- to 4-month-old) +/+ and
/ animals had similar C50 values as the 8- to
10-month-old mice but the +/ curve was similar to that of controls.
The C50 values for the younger mice were 0.569%, 0.510%,
and 0.517% for /, +/, and +/+ mice, respectively. The values
of the parameter, an estimation of the sharpness of the cellular
distribution,26 were lower in mutant mice, indicating that
their RBC distribution was more heterogeneous (not shown).
View larger version (22K):
[in this window]
[in a new window]
| Fig 5.
Osmotic fragility test of RBCs.
Erythrocytes from +/+ ( ), +/ ( ), and / ( ) mice
were subjected to an OF test as described in the "Materials and
methods" section. Results (mean ± standard error of 5 8- to
10-month-old animals/group) are expressed as percentage of lysis in
graded salt concentrations. C50 values were determined by
logarithmic linearization of the OF curve.26
|
|
These results indicate a marked increase in the OF of RBCs in the
-adducin / mice that together with mild elliptocytosis defines in humans a disorder called spherocytic hereditary
elliptocytosis (SphHE).29
Protein analysis of RBC ghosts and skeletons of -adducin
/ mice
To quantitate the relative amounts of skeletal proteins, RBC ghosts
and skeletal proteins from normal and mutant mice were run in SDS-PAGE
Laemmli gels. Coomassie stained gels were scanned and analyzed by
densitometry, and the protein concentration was normalized by
subtracting hemoglobin (Hb) from the total amount of proteins and on
the basis of band 3 content. This correction was done to eliminate
errors in protein loading and those introduced by the different Hb
concentrations between wild-type and mutant mice. We observed normal
levels of - and -spectrin, ankyrin, band 3, protein 4.2, and
protein 4.1 in -adducin /RBCs ghosts and skeletons (Figure
6A). However, there was a 15% reduction in
actin levels (± 5%, n = 3) and a threefold increase in Hb
retention in / RBCs skeleton. An unidentified 65 kd protein in
the region corresponding to band 4.5 was missing both in ghosts and
skeletons of -adducin / mice. Also, the levels of various
unknown proteins were slightly increased in the region of 25-40 kd.
Finally, the relative amount of an 18 kd protein was increased in the
/ skeletal preparation.
View larger version (59K):
[in this window]
[in a new window]
| Fig 6.
Analysis of ghost and skeletal proteins in -adducin
mutant mice.
(A) Coomassie blue stained gels (SDS-PAGE) of ghosts and membrane
skeletons (30 µg and 35 µg for ghost and skeleton, respectively)
from normal (+/+) and mutant (/) mice. The major proteins are
indicated. Variations between normal and mutant animals are indicated
by arrows. (B and C) Western blot analysis of ghost proteins (3 µg
and 8 µg, respectively) of adult wild-type (+/+), heterozygous
(+/), and homozygous mutant (/) mice using a rabbit anti-rat
-adducin polyclonal antibody (panel B) or a rabbit
anti-mouse--adducin antibody (panel C).
|
|
Western blot analysis revealed the absence of -subunit in /
ghosts as was shown in Figure 2E. Surprisingly, when the same preparation of proteins was analyzed with an anti--adducin antibody, we detected a sharp decrease in the amount of this subunit in /
mice but not in heterozygous animals. The levels of the -subunit in
mutant animals were reduced to about 20% of that of the wild-type mice
(Figure 6B). When we used an anti-mouse -adducin antibody, we
detected this subunit in RBCs from wild-type mice, contrary to that
observed in humans. Furthermore, we observed a fourfold up-regulation
of the -adducin levels both in +/ and / mice (Figure 6C).
These data suggest that -adducin is not able to form stable
homodimers or homotetramers capable of rescuing the absence of the
-subunit, and, as a consequence, it is not stably incorporated into
the RBC membrane skeleton. Some of the adducin found in mouse erythrocytes may be composed of / and/or / heteromers,
although we cannot rule out the presence of homomers. The increase in
the -subunit may partially rescue the total absence of the
-adducin in / animals.
Our results indicate that the absence of -adducin and consequent
altered levels of the - and -adducin subunits in the erythrocyte affect the normal structure of the membrane skeleton, producing a
marked increase in OF, altered hematological parameters, and erythrocyte dysmorphology. The -adducin-deficient mice develop a
mild hemolytic anemia, in many ways similar to human SphHE.
| |
Discussion |
The in vivo role of -adducin in erythrocytes was addressed by
creating a mouse model bearing a large deletion that eliminates most of
the known functional domains from the mature protein. Although a
shorter mRNA form was clearly visible in spleen Northern blots,
-adducin-related sequences could not be detected by Western blot
both in RBC ghosts and cytoplasm. The nonfunctional translated product,
if present, was probably degraded. In humans, erythrocyte adducin is
found exclusively associated to the red cell skeleton as a mixture of
and heteromers in a tightly controlled stoichiometry (1:1 ratio
of / adducin subunits9). However, in reticulocytes, the -adducin mRNA is present in at least 20-fold higher levels than
the -adducin mRNA.2 Thus, the -adducin subunit is
rate limiting for the assembly of the /-adducin oligomeric
molecule. Contrary to the previous findings,2,3 we detected
-adducin in RBCs of normal mice, suggesting that also some
proportions of / and/or / oligomers might be present. We
observed a fourfold increase in -adducin levels in mutant mice,
although this observation was not enough to completely rescue the
absence of the -subunit. The lack of the -subunit produced an
80% decrease of -adducin levels in mature erythrocytes, suggesting
that, whenever it is not stably incorporated into the membrane skeleton
as part of the adducin molecule, the -subunit is degraded. This
finding also indicates that the / oligomers are a
minor species in normal RBCs. Considering that we still detect
approximately 20% of the amount of -adducin normally found in
wild-type animals and that the -subunit levels are fourfold
increased in the mutant mice, we can hypothesize that the amount of
/ heteromers in normal red mouse cells might not be higher than
5% of the total adducin. We infer that the observed changes in
erythrocyte phenotype reflect the complete absence of -adducin and
the presence of only 20% of the -subunit in the mutant mice. The
up-regulation of the -subunit (by mean of heteromers) may
compensate for the absence of the -subunit and might account for the
mild phenotype. However, although our antibodies do not detect deleted
-adducin isoforms generated by translation of an abnormally spliced
mRNA, we cannot completely rule out their existence and their potential
effect on the phenotype.
We found that the -adducin mutant mice suffer from a mild hemolytic
anemia characterized by a marked increase in the OF of RBCs, a
significant decrease in mean corpuscular volume (MCV) and hematocrit,
an increase in MCHC and reticulocyte counts, along with abnormalities
in the shape of the red cells. These data indicate the presence of
dehydrated RBCs and the loss of membrane surface responsible for the
observed increase in OF.
SphHE is a phenotypical hybrid of mild hereditary elliptocytosis (HE)
and hereditary spherocytosis (HS), and its molecular basis is poorly
understood.28,29 For example, in some patients with SphHE,
mutations in -spectrin30 and protein 4.1 deficiency31,32 were detected. In SphHE, red cells are
osmotically fragile in the range found in HS. Elliptocytes are less
pronounced and somewhat rounded, but no poikilocytes or fragmented
forms are present.33 The peripheral blood smear of our
mutant mice showed the presence of mild elliptocytosis with subtle
morphological changes, a feature already observed in human spherocytic
HE.34 Also, as already observed in human SphHE, only a few
spherocytes are present, although an increased OF in erythrocytes
characteristic of this phenotype was clearly detected. However, the
morphological changes in the mouse RBCs are overall less marked than
those observed in human spherocytic HE.
Because adducin participates in the early events of skeletal
connections formation,2 it is possible that the increased OF, altered hematological parameters, and the observed elliptocytosis in RBCs are produced by the assembly of an anomalous skeleton due to
the absence of -adducin in the mutant mice. One of the adducin
functions in RBCs is recruiting additional spectrin molecules to the
spectrin-actin junctional complexes.16 Furthermore, the defect of adducin as an actin barbed-end capping protein18
may affect actin filament length. Indeed, actin content in RBC mutant skeletons was slightly but significantly reduced (15% less than wild
type). Consequently, the absence of -adducin in the mutant erythrocytes may produce defective junctional complexes.
In parallel to the submission of our manuscript, Gilligan et
al.35 submitted and then published similar data to that
presented here. However, minor differences between both models were
observed. Regarding the RBC morphology description and interpretation,
we see predominance of elliptocytes, whereas their predominant feature is spherocytosis.35 Erythrocytes from both animal models
were osmotically fragile and had smaller MCV. Also, all the other
hematological parameters were similar. It is important to note that our
mouse mutants were backcrossed for 5 generations, being at least 98% identical to the C57Bl/6 genetic background, whereas Gilligan et
al.35 studied the -adducin mutation phenotype within a
mixed 50% SvC129 and 50% C57Bl/6 genetic background. It has been
previously reported for other gene knockout mice that the phenotype may
vary with different genetic backgrounds.36-38 This
observation could be the cause of the differences seen
between our mutant animals and those of Gilligan et al. We have not
observed the presence of a deleted -adducin isoform either in ghosts
or in erythrocyte cytoplasm of mutant mice. However, a deleted isoform
containing a portion of the antisense strand of the NeoR gene was found
by Gilligan et al.35 Our targeting construct differs from
theirs in the orientation of the NeoR and the absence of any deleted isoform may derive from this fact. We have used 2 sets of polyclonal antibodies, 1 set raised against the full-length -adducin (-Add97 or -1 adducin) and the other set raised against the translation product of the deleted mRNA found in spleen (9-13 -adducin; Figures 1 and 3). However, we cannot rule out a marked epitope preference in both sets of antibodies that hinder the detection of
deleted forms.
The association between adducin variants or adducin deficiency with RBC
membrane disorders has not previously been firmly established. The
-adducin knockout mouse models have demonstrated the importance of
adducin in the maintenance of RBC shape and membrane stability. Our
work shows the RBC abnormalities derive from the absence of -adducin
in the erythrocyte membrane skeleton and its consequences such as the
80% decrease and fourfold up-regulation of the - and -adducins,
respectively. The observed phenotype is reminiscent of the human
disorder called SphHE.
| |
Acknowledgments |
We wish to thank J. Flo for critical discussion of the experiments and
statistical analysis; G. Devescovi for help with cDNA cloning and
Northern blot analysis; G.C. Lunazzi and M. Sturnega for animal care;
G. Dal Negro and his group, Glaxo Wellcome, Verona, for the assistance
with the Technicon H-1 cell analyzer and reticulocyte count; Reiber
Electronics and Leo and M. Tudja and Pliva for using the electron
microscope; D. Lohnes for the pD350.1 plasmid; P. Gruss and A. Voss for
the MPI II ES cells; G. Stanta and I. Kardum-Skelin for technical help
in histology and cytology; R. Kemler for the NeoR mice; and M. Lemeur
and P. Chambon for help in the initial stages of KO production.
| |
Footnotes |
Submitted May 6, 1999; accepted February 14, 2000.
Supported by ICGEB grant CRP/CRO 96-01 (S. Gajovi).
Reprints: Francisco E. Baralle, ICGEB, Padriciano 99, I-34012,
Trieste, Italy; e-mail: baralle{at}icgeb.trieste.it.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Bennett V, Gilligan DM.
The spectrin-based membrane skeleton and micron-scale organization of the plasma membrane.
Annu Rev Cell Biol.
1993;9:27-66.
2.
Joshi R, Gilligan DM, Otto E, McLaughlin T, Bennett V.
Primary structure and domain organization of human alpha and beta adducin.
J Cell Biol.
1991;115:665-675[Abstract/Free Full Text].
3.
Dong L, Chapline C, Mousseau B, et al.
35H, a sequence isolated as a protein kinase C binding protein, is a novel member of the adducin family.
J Biol Chem.
1995;270:25534-25540[Abstract/Free Full Text].
4.
Tripodi G, Piscone A, Borsani G, et al.
Molecular cloning of an adducin-like protein: evidence of a polymorphism in the normotensive and hypertensive rats of the Milan strain.
Biochem Biophys Res Commun.
1991;177:939-947[Medline]
[Order article via Infotrieve].
5.
Tripodi G, Casari G, Tisminetzky S, et al.
Characterisation and chromosomal localisation of the rat alpha- and beta-adducin-encoding genes.
Gene.
1995;166:307-311[Medline]
[Order article via Infotrieve].
6.
Tisminetzky S, Devescovi G, Tripodi G, et al.
Genomic organisation and chromosomal localisation of the gene encoding human beta adducin.
Gene.
1995;167:313-316[Medline]
[Order article via Infotrieve].
7.
Gilligan DM, Lozovatsky L, Silberfein A.
Organization of the human beta-adducin gene (ADD2).
Genomics.
1997;43:141-148[Medline]
[Order article via Infotrieve].
8.
Sinard JH, Stewart GW, Stabach PR, Argent AC, Gilligan DM, Morrow JS.
Utilization of an 86 bp exon generates a novel adducin isoform (beta 4) lacking the MARCKS homology domain.
Biochem Biophys Acta.
1998;1396:57-66[Medline]
[Order article via Infotrieve].
9.
Gardner K, Bennett V.
A new erythrocyte membrane-associated protein with calmodulin binding activity. Identification and purification.
J Biol Chem.
1986;261:1339-1348[Abstract/Free Full Text].
10.
Joshi R, Bennett V.
Mapping the domain structure of human erythrocyte adducin.
J Biol Chem.
1990;265:13130-13136[Abstract/Free Full Text].
11.
Ling E, Gardner K, Bennett V.
Protein kinase C phosphorylates a recently identified membrane skeleton-associated calmodulin-binding protein in human erythrocytes.
J Biol Chem.
1986;261:13875-13878[Abstract/Free Full Text].
12.
Matsuoka Y, Hughes CA, Bennett V.
Adducin regulation. Definition of the calmodulin-binding domain and sites of phosphorylation by protein kinases A and C.
J Biol Chem.
1996;271:25157-25166[Abstract/Free Full Text].
13.
Bianchi G, Tripodi G, Casari G, et al.
Two point mutations within the adducin genes are involved in blood pressure variation.
Proc Natl Acad Sci U S A.
1994;91:3999-4003[Abstract/Free Full Text].
14.
Kimura K, Fukata Y, Matsuoka Y, et al.
Regulation of the association of adducin with actin filaments by Rho-associated kinase (Rho-kinase) and myosin phosphatase.
J Biol Chem.
1998;273:5542-5548[Abstract/Free Full Text].
15.
Li X, Matsuoka Y, Bennett V.
Adducin preferentially recruits spectrin to the fast growing ends of actin filaments in a complex requiring the MARCKS-related domain and a newly defined oligomerization domain.
J Biol Chem.
1998;273:19329-19338[Abstract/Free Full Text].
16.
Gardner K, Bennett V.
Modulation of spectrin-actin assembly by erythrocyte adducin.
Nature.
1987;328:359-362[Medline]
[Order article via Infotrieve].
17.
Mische SM, Mooseker MS, Morrow JS.
Erythrocyte adducin: a calmodulin-regulated actin-bundling protein that stimulates spectrin-actin binding.
J Cell Biol.
1987;105:2837-2845[Abstract/Free Full Text].
18.
Kuhlman PA, Hughes CA, Bennett V, Fowler VM.
A new function for adducin. Calcium/calmodulin-regulated capping of the barbed ends of actin filaments.
J Biol Chem.
1996;271:7986-7991[Abstract/Free Full Text].
19.
Kaiser HW, O'Keefe E, Bennett V.
Adducin: Ca++-dependent association with sites of cell-cell contact.
J Cell Biol.
1989;109:557-569[Abstract/Free Full Text].
20.
Matsuoka Y, Li X, Bennett V.
Adducin is an in vivo substrate for protein kinase C: phosphorylation in the MARCKS-related domain inhibits activity in promoting spectrin-actin complexes and occurs in many cells, including dendritic spines of neurons.
J Cell Biol.
1998;142:485-497[Abstract/Free Full Text].
21.
Zaccai M, Lipshitz HD.
Role of adducin-like (hu-li tai shao) mRNA and protein localization in regulating cytoskeletal structure and function during Drosophila oogenesis and early embryogenesis.
Dev Genet.
1996;19:249-257[Medline]
[Order article via Infotrieve].
22.
Yue L, Spradling AC.
Hu-li tai shao, a gene required for ring canal formation during Drosophila oogenesis, encodes a homolog of adducin.
Genes Dev.
1992;6:2443-2454[Abstract/Free Full Text].
23.
Ferrari P, Ferrandi M, Torielli L, Canessa M, Bianchi G.
Relationship between erythrocyte volume and sodium transport in the Milan hypertensive rat and age-dependent changes.
J Hypertens.
1987;5:199-206[Medline]
[Order article via Infotrieve].
24.
Voss AK, Thomas T, Gruss P.
Germ line chimeras from female ES cells.
Exp Cell Res.
1997;230:45-49[Medline]
[Order article via Infotrieve].
25.
Bennett V.
Proteins involved in membrane-cytoskeleton association in human erythrocytes: spectrin, ankyrin, and band 3.
Methods Enzymol.
1983;96:313-324[Medline]
[Order article via Infotrieve].
26.
Try K.
Lineation of the osmotic fragility curve of erythrocytes.
Scand J Haematol.
1980;24:157-161[Medline]
[Order article via Infotrieve].
27.
Scaramuzzino DA, Morrow JS.
Calmodulin-binding domain of recombinant erythrocyte beta-adducin [published erratum appears in Proc Natl Acad Sci U S A. 1993;90:7908].
Proc Natl Acad Sci U S A.
1993;90:3398-3402[Abstract/Free Full Text].
28.
Becker PS, Lux SE.
Hereditary spherocytosis and hereditary elliptocytosis. In:
Scriver CR,Beaudet AL, eds.
The Metabolic Basis of Inherited Disease. New York, NY: McGraw-Hill; 1995:3513-3560.
29.
Palek J.
Red cell membrane disorders. In:
Hoffman R,Benz EJ Jr,Furie B,Shattil S,Cohen H, eds.
Hematology: Basic Principles and Practice. New York, NY: Churchill Livingstone; 1991:472-504.
30.
Jarolim P, Wichterle H, Hanspal M, Murray J, Rubin HL, Palek J.
Beta spectrin PRAGUE: a truncated beta spectrin producing spectrin deficiency, defective spectrin heterodimer self-association and a phenotype of spherocytic elliptocytosis.
Br J Haematol.
1995;91:502-510[Medline]
[Order article via Infotrieve].
31.
Tchernia G, Mohandas N, Shohet SB.
Deficiency of skeletal membrane protein band 4.1 in homozygous hereditary elliptocytosis. Implications for erythrocyte membrane stability.
J Clin Invest.
1981;68:454-460.
32.
Feo CJ, Fischer S, Piau JP, Grange MJ, Tchernia G.
First instance of the absence of an erythrocyte membrane protein (band 4(1)) in a case of familial elliptocytic anemia [in French].
Nouv Rev Fr Hematol.
1980;22:315-325.
33.
Benz EJ.
The erythrocyte membrane and cytoskeleton: structure, function, and disorders. In Stamatoyannopoulos G, Nienhuis AW, Majerus P, Varmus H, eds. The Molecular Basis of Blood Diseases. Philadelphia, Pa: WB Saunders Company; 1994:257-292.
34.
Cutting H, McHugh I, Conrad F, Marlow A.
Autosomal dominant hemolytic anemia characterized by ovalocytosis. A family study of seven involved members.
Am J Med.
1965;39:21.
35.
Gilligan DM, Lozovatsky L, Gwynn B, Brugnara C, Mohandas N, Peters LL.
Targeted disruption of the beta adducin gene (Add2) causes red blood cell spherocytosis in mice.
Proc Natl Acad Sci U S A.
1999;96:10717-10722[Abstract/Free Full Text].
36.
George EL, Baldwin HS, Hynes RO.
Fibronectins are essential for heart and blood vessel morphogenesis but are dispensable for initial specification of precursor cells.
Blood.
1997;90:3073-3081[Abstract/Free Full Text].
37.
Threadgill DW, Dlugosz AA, Hansen LA, et al.
Targeted disruption of mouse EGF receptor: effect of genetic background on mutant phenotype.
Science.
1995;269:230-234[Abstract/Free Full Text].
38.
Sibilia M, Wagner EF.
Strain-dependent epithelial defects in mice lacking the EGF receptor.
Science.
1995;269:234-238[Abstract/Free Full Text].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
R. F. Robledo, S. L. Ciciotte, B. Gwynn, K. E. Sahr, D. M. Gilligan, N. Mohandas, and L. L. Peters
Targeted deletion of {alpha}-adducin results in absent {beta}- and {gamma}-adducin, compensated hemolytic anemia, and lethal hydrocephalus in mice
Blood,
November 15, 2008;
112(10):
4298 - 4307.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. M. Pasini, M. Kirkegaard, D. Salerno, P. Mortensen, M. Mann, and A. W. Thomas
Deep Coverage Mouse Red Blood Cell Proteome: A First Comparison with the Human Red Blood Cell
Mol. Cell. Proteomics,
July 1, 2008;
7(7):
1317 - 1330.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. A. Khan, T. Hanada, M. Mohseni, J.-J. Jeong, L. Zeng, M. Gaetani, D. Li, B. C. Reed, D. W. Speicher, and A. H. Chishti
Dematin and Adducin Provide a Novel Link between the Spectrin Cytoskeleton and Human Erythrocyte Membrane by Directly Interacting with Glucose Transporter-1
J. Biol. Chem.,
May 23, 2008;
283(21):
14600 - 14609.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Kato, T. Miyata, Y. Tabara, T. Katsuya, K. Yanai, H. Hanada, K. Kamide, J. Nakura, K. Kohara, F. Takeuchi, et al.
High-density association study and nomination of susceptibility genes for hypertension in the Japanese National Project
Hum. Mol. Genet.,
February 14, 2008;
17(4):
617 - 627.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Chen, A. A. Khan, F. Liu, D. M. Gilligan, L. L. Peters, J. Messick, W. M. Haschek-Hock, X. Li, A. E. Ostafin, and A. H. Chishti
Combined Deletion of Mouse Dematin-Headpiece and beta-Adducin Exerts a Novel Effect on the Spectrin-Actin Junctions Leading to Erythrocyte Fragility and Hemolytic Anemia
J. Biol. Chem.,
February 9, 2007;
282(6):
4124 - 4135.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Costessi, G. Devescovi, F. E. Baralle, and A. F. Muro
Brain-specific promoter and polyadenylation sites of the {beta}-adducin pre-mRNA generate an unusually long 3'-UTR
Nucleic Acids Res.,
January 9, 2006;
34(1):
243 - 253.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Nakano, K. Ohneda, H. Yamamoto-Mukai, R. Shimizu, O. Ohneda, S. Ohmura, M. Suzuki, S. Tsukamoto, T. Yanagawa, H. Yoshida, et al.
Transgenic over-expression of GATA-1 mutant lacking N-finger domain causes hemolytic syndrome in mouse erythroid cells
Genes Cells,
January 1, 2005;
10(1):
47 - 62.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Yang, P. Y. Reaves, M. J. Katovich, and M. K. Raizada
Decrease in Hypothalamic Gamma Adducin in Rat Models of Hypertension
Hypertension,
February 1, 2004;
43(2):
324 - 328.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Yang, S. C. Francis, K. Sellers, M. DeBarros, C. Sun, C. Sumners, C. M. Ferrario, M. J. Katovich, A. F. Muro, and M. K. Raizada
Hypertension-Linked Decrease in the Expression of Brain {gamma}-Adducin
Circ. Res.,
October 4, 2002;
91(7):
633 - 639.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Khanna, S. H. Chang, S. Andrabi, M. Azam, A. Kim, A. Rivera, C. Brugnara, P. S. Low, S.-C. Liu, and A. H. Chishti
Headpiece domain of dematin is required for the stability of the erythrocyte membrane
PNAS,
May 14, 2002;
99(10):
6637 - 6642.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. L. Marro, O. U. Scremin, M. C. Jordan, L. Huynh, F. Porro, K. P. Roos, S. Gajovic, F. E. Baralle, and A. F. Muro
Hypertension in {beta}-Adducin-Deficient Mice
Hypertension,
September 1, 2000;
36(3):
449 - 453.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction