| |
|
|
|
|
|
|
|||
|
Blood, Vol. 95 No. 3 (February 1), 2000:
pp. 1056-1065
NEOPLASIA
From the Departments of Oncology and Pathology, University of
Alberta, Edmonton, Alberta, Canada.
The myelomagenic capacity of clonotypic myeloma cells in G-CSF
mobilized blood was tested by xenotransplant. Intracardiac (IC)
injection of NOD SCID mice with peripheral cells from 5 patients who
had aggressive myeloma led to lytic bone lesions, human Ig in the
serum, human plasma cells, and a high frequency of clonotypic cells in
the murine bone marrow (BM). Human B and plasma cells were detected in
BM, spleen, and blood. Injection of ex vivo multiple myeloma cells
directly into the murine sternal BM (intraosseus injection [IO])
leads to lytic bone lesions, BM plasma cells, and a high frequency of
clonotypic cells in the femoral BM. This shows that myeloma has spread
from the primary injection site to distant BM locations. By using a
cellular limiting dilution PCR assay to quantify clonotypic B lineage
cells, we confirmed that peripheral myeloma cells homed to the murine
BM after IC and IO injection. The myeloma progenitor undergoes
self-renewal in murine BM, as demonstrated by the transfer of human
myeloma to a secondary recipient mouse. For 6 of 7 patients, G-CSF
mobilized cells from patients who have minimal disease, taken at the
time of mobilization or after cryopreservation, included myeloma
progenitors as identified by engraftment of clonotypic cells and/or
lytic bone disease in mice. This indicates that myeloma progenitors are
mobilized into the blood by cyclophosphamide/G-CSF. Their ability to
generate myeloma in a xenotransplant model implies that such
progenitors are also myelomagenic when reinfused into patients, and
suggests the need for an effective strategy to purge them before transplant.
(Blood. 2000;95:1056-1065)
Multiple myeloma (MM) is an incurable cancer of the
blood and bone marrow. Although the symptoms in myeloma result
primarily from the plasma cells that colonize the bone marrow (BM),
molecular analysis indicates the presence of circulating members of the malignant clone.1-9 With single cell and in situ RT-PCR
analysis, clonotypic B cells have been demonstrated to be present at
high frequency in the blood of myeloma patients.10-13 These
B cells persist after autologous transplantation but may be depleted by allogeneic transplant.11 Drug-resistant clonotypic MM B
cells12,14 are highly abnormal in their expression of the
stem cell marker CD34,10 and recent work suggests that
highly enriched hematopoietic progenitor populations include clonotypic
cells.15,16 However, there is as yet no direct evidence
identifying myeloma progenitor(s).
Many laboratories have shown that clonotypic cells are mobilized by
G-CSF, 15, 17-24 but their significance is unknown.
Reinfusion of MM progenitors mobilized by G-CSF is likely to contribute
to the reemergence of MM. After transplant, clonotypic cells persist in
circulation11;25 suggesting that they are a clinically
significant component of the malignant clone and may participate in the
relapse that ultimately befalls nearly all autologous transplant
patients.26-28 Even purification of hematopoietic
progenitor cell fractions may not eradicate all malignant cells from
the autograft 10-16 Operationally, the measure of a
malignant progenitor is its ability to regenerate the malignancy. In
practical terms, this means that a xenotransplant model of human
myeloma is desirable to assess the extent to which, if any, mobilized
blood collections include myeloma progenitors able to repopulate the
patient with malignant disease.
NOD SCID mice are the most immunodeficient of the SCID
variants,29 are the most supportive host for normal and
malignant human stem cells,30,31 and B-cell differentiation
occurs in the absence of supplemental growth factors.31
Most SCID mouse myeloma models use MM cell lines.32-35 In 2 studies, fresh human MM BMC survived in conventional SCID mice, but no
colonization of the mouse BM was detected.36,37 Ex vivo MM
cells or human MM cell lines colonize human fetal bone implanted
subcutaneously in SCID mice, but do not migrate to the mouse
BM.38,39 A clinically relevant model of primary MM requires
migration of introduced MM cells to and from the BM.
Injection of cancer cells into the left cardiac ventricle allows
injected cells to bypass the lungs and flow directly to the BM.40-42 This route of injection should detect MM cells
able to traffic from the blood to the BM. However, malignant spread of MM also involves migration from one bone site to another. Here, we
describe the use of intracardiac (IC) injection of human MM cells into
immunodeficient NOD SCID mice to measure traffic from blood to the BM,
and the use of intraosseus (IO) injection into the sternum to measure
the ability to exit the bone and home to new skeletal locations. For
these NOD SCID models, murine T cells are absent and human T cells do
not engraft.31-44 Thus, a cell-mediated attack against
engrafted MM cells, or control by T-cell immunoregulation, is not possible.
In this study, we show that peripheral cells from myeloma
patients with aggressive disease, and G-CSF mobilized blood cells from
myeloma patients with minimal disease after remission induction chemotherapy include myeloma cells able to engraft human myeloma to the
BM of NOD SCID mice, as measured by phenotypic, pathologic, and
molecular analysis. On the basis of their ability to generate progeny
in the murine microenvironment, we have termed the engrafting cells, MM
progenitors. By using a cellular limiting dilution assay to quantify
cells with clonotypic transcripts, we show that engrafted myeloma cells
are frequent in the murine BM. The engrafting myeloma progenitor from
patients with aggressive disease self-renews in the murine BM as
measured by its ability to transfer the human myeloma clone to a
secondary recipient mouse.
Patients
Mice
Antibodies
Immunofluorescence Mouse cells were treated with Intraprep (Coulter, Hialeah, FL) to lyse red blood cells, and stained with the above mAbs in 2-color immunofluorescence.14 Samples were analyzed on a FACSsort (Becton Dickinson). Files of 10 000 to 20 000 cells were collected and analyzed with Lysis II software.ELISA (enzyme-linked immunosorbent assay) assay for human light chain The 96-well microtiter plates ((Flow Laboratories, McLean, VA) were coated with 50 µg per well of 2 mg/mL goat F(ab)2 antihuman Ig(IgM+IgG+IgA, H+L) (Southern Biotechnology) and blocked with 20% FCS. Serum samples were added at serial 2-fold dilutions for 60 minutes at 37°C, washed and bound human Ig detected with goat antihuman kappa-horseradish peroxidase (HRP) or goat antihuman lambda-HRP (Southern Biotechnology). After washing, ATBS substrate was added (Sigma, St Louis, MO) and color development read at 405 nm. A standard curve was constructed with purified human immunoglobulin. All reactions always included normal mouse serum, and all sera were assayed for both light chain types.Histology Sternum, humerus, and spleen tissue were removed at death for routine histologic examination, as well as any obvious tumor masses. No x-ray guided sampling was performed. Tissue was fixed in neutral buffered formalin and/or B-5, decalcified in RDO (BioGenex, San Ramon, CA), followed by routine paraffin embedding and sectioning. Routine morphology was assessed with hematoxylin and eosin staining. Immunohistochemistry was performed with a streptavidin/HRP-biotin method (Dako, LSAB+) using diaminobenzadine as the chromogen. Antihuman kappa and lambda light chain antibodies were obtained from Dako (Glostrup, Denmark) (polyclonal rabbit) and used at a 1/8000 dilution.Reverse transcription polymerase chain reaction (RT-PCR) RT-PCR was as previously described11 using RNA purified from MM-engrafted mouse spleen or BM cells, or from normal NOD SCID mouse control tissues. Primers to histone11 amplified both human and mouse transcripts. Primers to 2-microglobulin
(CCAGCAGAGAATGGAAAGTC, GATGCTGCTTACATGTCTCG) were specific for
human transcripts and did not detect mouse B2 microglobulin
transcripts. Consensus primers for human IgH VDJ were to FR1, FR2, and
Jh and were previously described.11 Patient-specific
primers were to the CDR2 and CDR3.11 These were identified
from plasma cells at the time of diagnosis and confirmed to be
expressed by > 80% of individual plasma cells from that patient as
measured using single cell and in situ RT-PCR,11 and
specificity was confirmed.11 Amplification using
patient-specific CDR2/CDR3 primers occurred only for RNA from mice
engrafted with the appropriate MM patient, and not for RNA from mice
engrafted with an unrelated patient or an uninjected mouse. The
detection of clonotypic transcripts used PCR with CDR2/CDR3 primers for 35 cycles. For engrafted mice in which clonotypic transcripts were not
detected in the initial PCR reaction, a nested PCR strategy was used,
in which the first step was amplification with FR1/Jh primers for 35 cycles and then a second stage PCR with CDR2/CDR3 primers for 35 cycles.
Cellular limiting dilution RT-PCR To quantify the number of cells that expressed clonotypic IgH transcripts, we used a cellular limiting dilution method previously described.11 Briefly, cells were deposited at defined cell numbers (3-fold dilution series from 100 to 1 cell per tube) into PCR tubes containing lysis buffer for reverse transcription and nested PCR using VH family/Jh primers for the first stage and CDR2/CDR3 primers for the second stage PCR. The entire RT-PCR was performed in the same tube, the amplified product run on a gel and the product detected using ethidium bromide staining. Tubes in which the correct sized product is amplified are those that contained at least 1 clonotypic cell.
Peripheral cells from myeloma patients with aggressive disease engraft human myeloma to NOD SCID mice Blood or pleural effusion cells from patients with aggressive myeloma, defined as the presence of leukemic plasma cells, were injected into mice using intravenous (IV, patient 1) or intracardiac injection (IC, patients 1-5). Mice were sublethally irradiated to facilitate engraftment and growth of human cells. Usually, no engraftment occurred after IV injection. However, pleural effusion cells from patient 1 did engraft after IV injection. Table 2 summarizes the measures used to detect engraftment of mice by human cells. Of the aggregate 48 mice that were injected by any route, 34 developed evidence of disease (71%) with overall morbidity, hind leg paralysis, and/or boney changes, including easily fractured long bones and macroscopic loss of red marrow (Table 2). Mice injected IC with cells from each of the 5 patients developed symptoms at 2 to 5 months after injection. Mean overall latency of end stage disease for the cells from this set of patients ranged from 63 to 131 days (Table 2). For patient 1, the mean latency for mice injected IV (111 ± 61 days) or IC (119 ± 50 days) was shorter than that for mice injected IO (186 ± 46 days, see below).
Human B lineage cells are detectable in the bone marrow (BM) of mice engrafted with peripheral myeloma cells Expression of human CD19 and CD38 identified human B and plasma cells, as shown by the representative dot plots of Figure 1. After IC injection, CD38hi plasma cells comprised 85% of the murine BMC (Figure 1). A large vertebral mass also was predominantly CD38hi plasma cells (Figure 1). Table 3 shows that after IC injection, human B and plasma cells colonize the BM, leading to fragile bones, lack of erythropoiesis, and lytic bone lesions characteristic of human myeloma (see below). In MM patients, plasma cells comprise 5% to ~ 90% of BMC.8-11 In MM-engrafted mice, the proportion of B and plasma cells in blood and BM was comparable, with 0.3% to 87% plasma cells of total BMC. Human B lineage cells were also found in spleen and peripheral blood. For 6 animals, representing engraftment by cells from 3 different MM patients, large skeletal masses of plasma cells were detected on autopsy. Overall, engrafted human cells were detectable in 36 of 51 animals analyzed by flow cytometry (71%). However, flow cytometry may not detect all engrafted myeloma cells because it depends on retention of characteristic phenotypic markers after engraftment. For example, in cells from 1 mouse, no phenotypic expression of human CD45, CD19, or CD38 was detected, but extensive plasma cell infiltration of the BM was evident by histology, and clonotypic transcripts were detectable from BM and from a large CD38 plasma cell tumor, indicating extensive human
engraftment (not shown). Confirming the presence of human B lineage
cells, human light chain was detected in 10 of 15 sera from these
MM-engrafted mice. In most cases the light chain was monotypic.
However, in some mice, the non-MM light chain was also detectable,
presumably indicating engraftment of normal B cells. Representative
sera are shown in Figure 2.
The presence of transcripts for 2 microglobulin and IgH VDJ transcripts, detected using
consensus FR2/Jh primers, were found in the BMC from engrafted mice
engrafted but not in control uninjected mice (Figure
3A). Sixteen of 17 mice tested, which had
been engrafted IC with cells from the 5 aggressive myelomas, had human
2 microglobulin and IgH VDJ RNA transcripts. Overall, human 2
microglobulin and IgH VDJ transcripts were more readily detected in BM
than in spleen (not shown). In situ hybridization for Epstein-Barr
virus (EBV) on sections of bone that had large numbers of plasma cells
was negative, indicating that the engrafted human B lineage cells were
not EBV-transformants (not shown).
Monotypic human plasma cells infiltrate the murine BM On autopsy, many MM-engrafted mice had easily fractured or spongy bones, and for a large proportion, the BM appeared white. A small proportion of the injected mice developed hind leg paralysis. Human plasma cells were shown by immunohistochemistry to fill the mouse BM (Figure 4). For those tissues analyzed by flow cytometry as in Figure 1, other bones from the same animal, or sections of the vertebral mass, were histologically identified as plasma cells. Infiltrating plasma cells were monotypic, with restricted human light chain expression (not shown). For 9 of 11 IC-injected mice analyzed, morphologically detected monotypic plasma cells were seen in the BM.
Intra-osseus injection of aggressive MM cells results in MM engraftment in distant BM sites For 3 MM patients with aggressive disease, peripheral cells were injected directly into the mouse sternum, a rich site of hematopoiesis, to detect intraskeletal traffic. For mice with IO injection of MM cells to the sternum, the distribution of monotypic human B lineage cells provided strong evidence of exit from the BM to colonize the blood and distant BM sites. IO-injected mice developed disease symptoms with a latency of 186 ± 41 days (patient 1, 5 mice), or 26 and 35 days (patient 2, 2 mice) and 88 days (patient 3, 1 mouse). Phenotypically identified B lineage cells were detected in IO-injected mice at levels comparable to those in IC-injected mice (Table 3). Figure 1 shows that for 1 representative IO-injected mouse, CD38hi plasma cells comprised 25% of murine femoral BMC. This indicates that MM cells had migrated from the sternum to the femur. After IO injection, human light chain of the appropriate type was detectable in mouse serum (Figure 2). Myeloma cells grew at the site of injection as indicated by the presence of morphologically identified monotypic plasma cells in the sternum for 3 of 6 mice analyzed. However, distant bone sites were also colonized. After injection to the sternum, the femur became engrafted with human cells, as detected by 2-microglobulin and IgH transcripts,
comparable to the results shown in Figure 3, and by the presence
of lytic bone lesions (see below). Like the IC-injected mice, the
IO-injected mice developed easily fractured bones, and a macroscopic
absence of red marrow.
MM-engrafted mice innoculated IC or IO exhibit lytic bone lesions To determine whether MM-engrafted mice displayed the osteolytic bone lesions, animals were radiographed after they were killed. Consistent with the fragile bones observed in many mice, lytic lesions were often detectable in the long bones, vertebral bodies, or in the skull. Overall, for those mice radiographed, 9 of 14 mice injected IC with aggressive myeloma cells had lytic bone lesions, as did 4 of 7 IO-injected mice. However, no lytic lesions were detectable at week 20 for 8 sublethally irradiated but unengrafted mice, or for 4 normal control mice (not shown). Radiograph images in Figure 5A show lytic bone lesions in vertebral bodies and the tibia for IC-injected mice. Figure 5B shows lytic lesions in the skull, vertebral bodies, and tibia from IO-injected mice, showing colonization of distant bone sites. For 3 mice, a bone having evidence of lytic lesions by x-ray analysis was dissected, fixed, and sectioned. For all 3, the affected area was seen to be infiltrated with monotypic human plasma cells (not shown).
Clonotypic human B lineage cells in MM-engrafted mice For each individual myeloma patient, the malignant clone is uniquely characterized by the IgH VDJ gene rearrangement of the BM plasma cells. All plasma cells and the majority of circulating B cells in myeloma patients express transcripts encoding the same IgH VDJ rearrangement.10,11 For most patients described in Table 1, the clonotypic IgH VDJ rearrangement was identified, its specificity for the patient confirmed, and the sequence validated as clonotypic by showing its expression in > 80% of autologous plasma cells. Figure 3B shows that for 4 different mice engrafted IC with cells from patient 1, but not from a normal mouse, clonotypic IgH VDJ transcripts were detected in the BM from 3 of 4 mice and in vertebral tumors from 2 mice (section B, row 1). For most mice, clonotypic sequences were detectable in a first stage PCR reaction, suggesting a high copy number of target transcripts. For 1 mouse with no detectable clonotypic transcripts, human engraftment was weakly detected, based on the presence of 2-microglobulin transcripts (section B, row 2, 1e). The
amplification of histone transcripts indicates the presence of intact
mRNA in all samples (section B, row 3). Figure 3C shows clonotypic
transcripts in the BM of mice engrafted with cells from patient 2, as
well as demonstrating the specificity of the patient-specific RT-PCR.
Primers specific for patient 9 amplify product only from the mouse
engrafted with patient 9, whereas primers specific for patient 2 amplify product only from mice engrafted with cells from patient 2.
Clonotypic myeloma cells are frequent in BM of MM-engrafted mice To determine the frequency of clonotypic cells in mice, we used a cellular limiting dilution assay. BMC and spleen cells from engrafted mice were deposited at limiting dilution into PCR tubes, followed by RT-PCR with patient-specific primers to detect clonotypic transcripts. A representative dilution series for an IC-injected mouse (Figure 6A) and for an IO-injected mouse (Figure 6B) are shown. All tubes contained intact mRNA as indicated by the presence of detectable histone transcripts (not shown). For the IC-injected mouse, all 3 tubes that had 10 cells per tube, and 1 of 3 tubes with 3 cells per tube are positive for clonotypic transcripts, a frequency of about 12%. Figure 7A also shows the very high frequency of clonotypic cells in vertebral plasma cell masses from 3 mice injected IC with PBMC from patient 5. For the IO-injected mouse, the frequency of clonotypic cells in BMC from the femur was about 22% (2 of 3 tubes at 3 cells per tube were positive or at least 2 clonotypic cells per 9 cells analyzed), indicative of migration from the sternum to the femur. For both mice, the frequency of clonotypic cells in spleen was about 100-fold higher in BM than in spleen (not shown). As shown in Table 4A, high frequencies were obtained from mice engrafted IC with cells from patient 1 and patient 5. For other patients, clonotypic transcripts were seen only in RNA from aliquots of 106 BM cells (a frequency of at least 1/106), or a limiting dilution series was not available. The clonotypic cells were detectable in mice at relatively high frequency at about 3 to 6 months after injection, indicating persistence of the myeloma clone for prolonged periods.
Self-renewal of the myeloma clone occurs in MM-engrafted mice If the myeloma clone self-renews after engraftment into mice, myeloma stem cells should be generated in the bone marrow. To determine whether this was the case, BMC from the femora of primary MM-engrafted mice were injected IC into an irradiated secondary mouse, and the frequency of clonotypic cells in this secondary recipient was analyzed at 2 to 3 months after inoculation. Figure 1 shows that 3.4% of murine BMC in a secondary recipient were CD38hi plasma cells. Analysis of human light chain in serum of the secondary mice indicates the presence of human kappa light chain (the monoclonal Ig type) (Figure 2) but not lambda light chain, suggesting the presence of the human myeloma clone. For 4 secondary mice, clonotypic transcripts were detected in purified RNA from BMC (not shown), or lytic lesions were detected in the bones. Figure 5 shows multiple lytic lesions in the femur of a secondary recipient mouse. To determine the frequency of clonotypic cells colonizing the secondary recipient, a limiting dilution analysis was performed for BM harvested from the secondary recipient (Figure 7). The frequency of clonotypic cells in BM after the secondary transfer was about 10%. The frequency in spleen was < 0.03% (not shown). For other secondary mice, clonotypic cells were not detected in the limiting dilution assay, even though they were seen in purified RNA, indicating a frequency of between 1/103 to 1/106 in BM. This experiment shows that the myeloma stem cell homes to, and self-renews in the BM, as measured by its ability to engraft the same myeloma clone into a secondary recipient.G-CSF mobilized blood cells include myeloma progenitors G-CSF mobilized blood cells were injected into mice to detect progenitors capable of transferring the myeloma clone. A total of 49 mice were injected with mobilized blood cells from 7 myeloma patients (Table 2). No plasma cells were detectable in the circulating blood of any patient on clinical screening. All 7 patients had minimal disease at the time of mobilization. Clonotypic transcripts were detectable in RNA purified from aliquots of the injected cells for the 6 evaluable patients. After IC injection of mobilized cells from 3 of 7 patients, mice developed disease symptoms with a latency of 103 to 157 days (Table 2). Few human cells were detectable in injected mice by using flow cytometry. For 4 of 5 G-CSF mobilized blood engraftments, human light chain was detected in 6 of 9 mice tested, but it did not always correlate with the expected mIg type, suggesting at least some Ig originated from normal B cells. On radiograph, numerous lytic bone lesions were apparent. Fifteen of 29 mice (52%) injected with mobilized cells from all 6 patients tested, had lytic bone lesions (Table 2). Figure 5C shows representative radiographs from mice engrafted with cells from patients 6 and 9 (fresh G-CSF mobilized blood) and from patient 5A (cryopreserved G-CSF mobilized blood), indicating that an MM progenitor is present in mobilized blood, and that it survives cryopreservation. Overall, evidence of MM engraftment was detected in at least 2 injected mice for G-CSF mobilized cells from 6 of 7 patients (Table 2).Clonotypic transcripts are detectable in mice engrafted with G-CSF mobilized blood Mobilized blood cells include normal hematopoietic progenitors, as well as putative malignant progenitors. We found that 13/35 mice tested had human 2 microglobulin transcripts (37%), and 18 of 35 had
detectable IgH VDJ transcripts (51%), indicating engraftment by human
B cells. With patient-specific primers to the CDR2/CDR3 of the myeloma
IgH VDJ, 10 of 35 mice tested (29%), from 3 of 6 patients for whom the
clonotypic sequence was available, had clonotypic transcripts (Table 2)
in BM and/or in spleen. For most of these mice, a nested second stage
PCR reaction was required to detect clonotypic sequences, suggesting a
low copy number of the target transcripts. Table 4B reports the
frequency of clonotypic cells in mice that had been injected with
mobilized blood cells from patients 7, 9, and 11. The patient-specific
PCR product from mice engrafted with patient 9 was sequenced and found to be identical with the sequence derived from BM plasma cells of
patient 9, verifying the accuracy of the PCR. For mobilized blood from
patient 9, engraftment of clonotypic cells was detectable at 4 weeks
after injection and persisted for at least 3 months (Table 4). Overall,
the frequency of clonotypic cells appeared to be lower than that found
after injection of aggressive myeloma cells (compared with Table 4A).
However, for mice injected with G-CSF mobilized blood cells and having
clonotypic frequencies about 1% or higher, a conservative estimate is
that at the time of death at least 5 × 106
clonotypic cells are present (based on an estimate of about
5 × 108 total lymphocytes in the mouse). These must
have arisen from the 2 to 5 × 106 unfractionated
G-CSF MNC originally injected. Assuming that myeloma stem cells are
likely to be relatively infrequent in G-CSF mobilized blood, this
suggests that considerable clonal expansion of malignant progenitors
has occurred in these mice.
This work shows the ability of peripheral cells from myeloma patients having either aggressive or minimal disease to engraft human myeloma into the BM of NOD SCID mice, as measured by molecular, pathologic, and phenotypic analysis. Further, self-renewal of the engrafted human myeloma clone occurs within the murine BM microenvironment, as identified by molecular analysis of clonotypic IgH VDJ transcripts. Of particular significance is the presence of malignant progenitors in fresh aphereses or in cryopreserved G-CSF mobilized blood cells, identified by their ability to engraft the myeloma clone into mice. Even though at the time of mobilization, these myeloma patients had minimal disease after initial therapy with VAD, the mobilized cells used for hematopoietic rescue after high-dose chemotherapy include myeloma progenitors at a frequency of at least 1 per 2 to 5 × 106 MNC. This observation strengthens the case for purging of malignant cells before autologous transplant by showing the presence among G-CSF mobilized apheresis cells of generative cells able to transfer myeloma to a new host. Myeloma progenitors survive cryopreservation, based on our observation that aliquots of thawed aphereses taken at the time of transplant retain the ability to engraft human myeloma to immundeficient mice. However, the experiments do not identify myeloma progenitors, beyond showing by their progeny that they are present among peripheral cells during stages of minimal disease, as well as during aggressive myeloma progression.
Mr Dan McGinn and Ms Juanita Wizniak provided skilled assistance. Dr John Dick generously provided breeding pairs of NOD SCID mice. We thank Dr Nick Nation Agnieszka Szczepek, Dr Brian Taylor, Yvon DeMossiac, Dr Tim Terry, Cheryl Penrice, and Adele Andriashek for their help.
Submitted April 9, 1999; accepted September 28, 1999.
Funded by the Medical Research Council of Canada.
Reprints: Linda M. Pilarski, Cross Cancer Institute, 11560 University Ave, Edmonton, AB T6G1Z2, Canada.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1.
Billadeau D, Ahmann G, Greipp P, Van Ness B.
The bone marrow of multiple myeloma patients contains B cell populations at different stages of differentiation that are clonally related to the malignant plasma cell.
J Exp Med.
1993;178:1023
2.
Billadeau D, Quam L, Thomas W, et al.
Detection and quantitation of malignant cells in the peripheral blood of multiple myeloma patients.
Blood.
1992;80:1818
3.
Billadeau D, Van Ness B, Kimlinger T, et al.
Clonal circulating cells are common in plasma cell proliferative disorders: a comparison of monoclonal gammopathy of undetermined significance, smoldering multiple myeloma, and active myeloma.
Blood.
1996;88:289 4. Corradini P, Voena C, Omede P, et al. Detection of circulating tumor cells in multiple myeloma by a PCR based method. Leukemia. 1993;7:1879[Medline] [Order article via Infotrieve]. 5. Bakkus MHC, Van Riet I, Van Camp B, Thielemann K. Evidence that the clonogenic cell in multiple myeloma originates from a pre-switched but somatically mutated B cell. Br J Hematol. 1994;87:68[Medline] [Order article via Infotrieve].
6.
Berenson J, Wong R, Kim K, Brown N, Lichtenstein A.
Evidence for peripheral blood B lymphocyte but not T lymphocyte involvement in multiple myeloma.
Blood.
1987;70:1550 7. Berenson JR, Lichtenstein AK. Clonal rearrangement of immunoglobulin genes in the peripheral blood of multiple myeloma patients. Br J Hematol. 1989;73:425[Medline] [Order article via Infotrieve].
8.
Bergsagel PL, Masellis S, Szczepek A, Mant MJ, Belch AR, Pilarski LM.
In multiple myeloma, clonotypic B lymphocytes are detectable among CD19+ peripheral blood cells expressing CD38, CD56 and monotypic immunoglobulin light chain.
Blood.
1995;85:436 9. Brown RD, Luo X-F, Gibson J, et al. Longitudinal analysis of circulating myeloma cells detected by allele specific mRNA in situ hybridization. Am J Hematol. 1998;58:273[Medline] [Order article via Infotrieve].
10.
Szczepek AJ, Bergsagel PL, Axelsson L, Brown CB, Belch AR, Pilarski LM.
CD34+ cells in the blood of patients with multiple myeloma express CD19 and IgH mRNA and have patient-specific IgH VDJ rearrangements.
Blood.
1997;89:1824
11.
Szczepek AJ, Seeberger K, Wizniak J, Mant MJ, Belch AR, Pilarski LM.
A high frequency of circulating B cells share clonotypic IgH VDJ rearrangements with autologous bone marrow plasma cells in multiple myeloma, as measured by single cell and in situ RT-PCR.
Blood.
1998;92:2844
12.
Pilarski LM, Szczepek AJ, Belch AR.
Deficient drug transporter function of bone marrow-localized and leukemic plasma cells in multiple myeloma.
Blood.
1997;90:3751 13. Rasmussen T, Kastrup J, Knudsen LM, Johnson HE. High numbers of clonal CD19+ cells in the peripheral blood of a patient with multiple myeloma. Br J Haematol. 1998;105:265.
14.
Pilarski LM, Belch AR.
Circulating monoclonal B cells expressing p-glycoprotein may be a reservoir of multidrug resistant disease in multiple myeloma.
Blood.
1994;83:724
15.
Lemoli RM, Fortuna A, Motta MR, et al.
Concomitant mobilization of plasma cells and hematopoietic progenitors into peripheral blood of multiple myeloma patients: positive selection and transplantation of enriched CD34+ cells to remove circulating tumor cells.
Blood.
1996;87:1625 16. Pilarski LM, Szczepek AJ, Belch AR. In multiple myeloma (MM), clonotypic CD34+45loSSc/FSClo/med B cells survive cryopreservation and co-purify with CD34+ hematopoietic progenitor cells [abstract]. Blood. 1998;92:267b.
17.
Gazitt Y, Tian E, Barlogie B, et al.
Differential mobilization of myeloma cells and normal hematopoietic stem cells in multiple myeloma after treatment with cyclophosphamide and granulocyte-macrophage colony-stimulating factor.
Blood.
1996;87:805
18.
Gazitt Y, Reading CC, Hoffman R, et al.
Purified CD34+ Lin- Thy+ stem cells do not contain clonal myeloma cells.
Blood.
1995;86:381 19. Cassel A, Leibovitz N, Hornstein L, Quitt M, Aghai E. Evidence for the existence of circulating monoclonal B-lymphocytes in multiple myeloma patients. Exp Hematol. 1990;18:1171[Medline] [Order article via Infotrieve].
20.
Corradini P, Voena C, Astolfi M, et al.
High dose sequential chemotherapy in multiple myeloma: residual tumor cells are detectable in bone marrow and peripheral blood cell harvests and after autografting.
Blood.
1995;85:1596 21. Dreyfus F, Melle J, Quarre C, Pillier C. Contamination of peripheral blood by monoclonal B cells following treatment of multiple myeloma by high dose chemotherapy. Br J Hematol. 1993;85:411[Medline] [Order article via Infotrieve]. 22. Abonour R, Scott KM, Kunkel LA, et al. Autologous transplantation of mobilized peripheral blood CD34+ cells selected by immunomagnetic procedures in patients with multiple myeloma. Bone Marrow Transplant. 1998;22:957[Medline] [Order article via Infotrieve]. 23. Henry JM, Sykes PJ, Brisco MJ, To LB, Juttner CA, Morley A. Comparison of myeloma cell contamination of bone marrow and peripheral blood stem cell harvests. Br J Haematol. 1996;92:614[Medline] [Order article via Infotrieve]. 24. Mariette X, Fermand JP, Brouet JC. Myeloma cell contamination of peripheral blood stem cell grafts in patients with multiple myeloma treated by high dose therapy. Bone Marrow Transplant. 1994;14:47[Medline] [Order article via Infotrieve]. 25. Billadeau D, Prosper F, Verfaille CM, Weisdorf D, Van Ness B. Sequential analysis of bone marrow and peripheral blood after stem cell transplant for myeloma shows disparate tumor involvement. Leukemia. 1998;11:1565.
26.
Attal M, Harosseau J-L, Stoppa A-M, et al.
A prospective, randomized trial of autologous bone marrow transplantation and chemotherapy in multiple myeloma.
N Engl J Med.
1996;335:91
27.
Barlogie B, Epstein J, Selvanayagam P, Alexanian R.
Plasma cell myeloma 28. Greipp PR. Advances in the diagnosis and management of myeloma. Semin Hematol. 1992;29:24[Medline] [Order article via Infotrieve]. 29. Shultz LD, Schweitzer PA, Christianson SW, et al. Multiple defects in innate and adaptive immunologic function in NOD/LtSz-SCID mice. J Immunol. 1995;154:180[Abstract]. 30. Wang JC, Lapidot T, Cashman JD, et al. High level engraftment of NOD/SCID mice by primative normal and leukemic hematopoietic cells from patients with chronic myeloid leukemia in chronic phase. Blood. 1998;91:2416. 31. Hogan CJ, Shpall EJ, McNulty O, et al. Engraftment and development of human CD34+ enriched cells from umbilical cord blood in NOD/LtSz-scid/scid mice. 1997;90:85.
32.
Huang Y-W, Richardson JA, Vitetta ES.
Anti-CD54 (ICAM-1) has anti-tumor activity in SCID mice with human myeloma cells.
Cancer Res.
1995;55:610
33.
Huang Y-W, Richardson JA, Tong AW, Zhang B-Q, Stone MJ, Vitetta ES.
Disseminated growth of a human multiple myeloma cell line in mice with severe combined immunodeficiency disease.
Cancer Res.
1993;53:1392 34. Bellamy WT, Odeleye A, Finley P, et al. An in vivo model of human multidrug resistant multiple myeloma in SCID mice. Am J Pathol. 1993;142:691[Abstract].
35.
Alsina M, Boyce B, Devlin RD, et al.
Development of an in vivo model of human multiple myeloma bone disease.
Blood.
1996;87:1495
36.
Feo-Zuppardi J, Taylor CW, Iwato K, et al.
Long term engraftment of fresh human myeloma cells in SCID mice.
Blood.
1992;80:2843 37. Ashmann EMJ, van Tol MDJ, Oudemann-Gruber J, Lokhorst H. The SCID mouse as a model for multiple myeloma. Br J Haematol. 1995;89:319[Medline] [Order article via Infotrieve].
38.
Urashima M, Chen BP, Chen S, et al.
The development of a model for the homing of multiple myeloma cells to human bone marrow.
Blood.
1997;90:754
39.
Yaccoby S, Barlogie B, Epstein J.
Primary myeloma cells growing in SCID-Hhu mice: a model for studying the biology and treatment of myeloma and its manifestations.
Blood.
1998;92:2908 40. Arguello F, Baggs RB, Eskenazi AE, Duers RE, Frantz CN. Vascular anatomy and organ specific tumor growth as critical factors in the development of metastases and their distribution among organs. Int J Cancer. 1991;48:583[Medline] [Order article via Infotrieve].
41.
Arguello F, Baggs RB, Frantz CN.
A murine model of experimental metastasis to bone and bone marrow.
Cancer Res.
1988;48:6876
42.
Arguello F, Furlanetto RW, Baggs RB, et al.
Incidence and distribution of experimental metastases in mutant mice with defective organ microenvironments (genotypes SlSld and W/Wv).
Cancer Res.
1992;52:2304 43. Christianson SW, Greiner DL, Hesselton R, et al. Enhanced human CD4+ T cell engraftment in b2-deficient NOD SCID mice. J Immunol. 1997;158:3578[Abstract].
44.
Yurasov S, Kollmann TR, Kim A, et al.
Severe combined immunodeficiency mice engrafted with human T cells, B cells and myeloid cells after transplantation with human fetal bone marrow or liver cells and implanted with human fetal thymus: a model for studying human gene therapy.
Blood.
1997;89:1800 45. Deans JP, Wilkins JA, Caixia S, Pruski E, Pilarski LM. Prolonged expression of high molecular mass CD45RA isoform during the differentiation of human progenitor thymocytes to CD3+ cells in vitro. J Immunol. 1991;147:4060[Abstract]. 46. Pilarski LM, Mant MJ, Ruether BA. Review: analysis of immunodeficiency in multiple myeloma: observations and hypothesis. J Clin Lab Anal. 1987;1:214. 47. Bensinger WI, Demirer T, Buckner CD, et al. Syngeneic marrow transplantation in patients with multiple myeloma. Bone Marrow Transplant. 1996;18:527[Medline] [Order article via Infotrieve].
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
T. M. Tancred, A. R. Belch, T. Reiman, L. M. Pilarski, and J. Kirshner Altered Expression of Fibronectin and Collagens I and IV in Multiple Myeloma and Monoclonal Gammopathy of Undetermined Significance J. Histochem. Cytochem., March 1, 2009; 57(3): 239 - 247. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kirshner, K. J. Thulien, L. D. Martin, C. Debes Marun, T. Reiman, A. R. Belch, and L. M. Pilarski A unique three-dimensional model for evaluating the impact of therapy on multiple myeloma Blood, October 1, 2008; 112(7): 2935 - 2945. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Taylor, J. Kriangkum, J. A. Pittman, M. J. Mant, T. Reiman, A. R. Belch, and L. M. Pilarski Analysis of clonotypic switch junctions reveals multiple myeloma originates from a single class switch event with ongoing mutation in the isotype-switched progeny Blood, September 1, 2008; 112(5): 1894 - 1903. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Rozemuller, E. van der Spek, L. H. Bogers-Boer, M. C. Zwart, V. Verweij, M. Emmelot, R. W. Groen, R. Spaapen, A. C. Bloem, H. M. Lokhorst, et al. A bioluminescence imaging based in vivo model for preclinical testing of novel cellular immunotherapy strategies to improve the graft-versus-myeloma effect Haematologica, July 1, 2008; 93(7): 1049 - 1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Huff and W. Matsui Multiple Myeloma Cancer Stem Cells J. Clin. Oncol., June 10, 2008; 26(17): 2895 - 2900. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Bergsagel and W. M. Kuehl Molecular Pathogenesis and a Consequent Classification of Multiple Myeloma J. Clin. Oncol., September 10, 2005; 23(26): 6333 - 6338. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Johrer, K. Janke, J. Krugmann, M. Fiegl, and R. Greil Transendothelial Migration of Myeloma Cells Is Increased by Tumor Necrosis Factor (TNF)-{alpha} via TNF Receptor 2 and Autocrine Up-Regulation of MCP-1 Clin. Cancer Res., March 15, 2004; 10(6): 1901 - 1910. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Matsui, C. A. Huff, Q. Wang, M. T. Malehorn, J. Barber, Y. Tanhehco, B. D. Smith, C. I. Civin, and R. J. Jones Characterization of clonogenic multiple myeloma cells Blood, March 15, 2004; 103(6): 2332 - 2336. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Mitsiades, N. S. Mitsiades, R. T. Bronson, D. Chauhan, N. Munshi, S. P. Treon, C. A. Maxwell, L. Pilarski, T. Hideshima, R. M. Hoffman, et al. Fluorescence Imaging of Multiple Myeloma Cells in a Clinically Relevant SCID/NOD in Vivo Model: Biologic and Clinical Implications Cancer Res., October 15, 2003; 63(20): 6689 - 6696. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Pilarski and A. R. Belch Clonotypic Myeloma Cells Able to Xenograft Myeloma to Nonobese Diabetic Severe Combined Immunodeficient Mice Copurify with CD34+ Hematopoietic Progenitors Clin. Cancer Res., October 1, 2002; 8(10): 3198 - 3204. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Taylor, J. A. Pittman, K. Seeberger, M. J. Mant, T. Reiman, A. R. Belch, and L. M. Pilarski Intraclonal Homogeneity of Clonotypic Immunoglobulin M and Diversity of Nonclinical Post-Switch Isotypes in Multiple Myeloma: Insights into the Evolution of the Myeloma Clone Clin. Cancer Res., February 1, 2002; 8(2): 502 - 513. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Anderson, J. D. Shaughnessy Jr., B. Barlogie, J.-L. Harousseau, and G. D. Roodman Multiple Myeloma Hematology, January 1, 2002; 2002(1): 214 - 240. [Abstract] [Full Text] |
||||
![]() |
T. Reiman, K. Seeberger, B. J. Taylor, A. J. Szczepek, J. Hanson, M. J. Mant, R. W. Coupland, A. R. Belch, and L. M. Pilarski Persistent preswitch clonotypic myeloma cells correlate with decreased survival: evidence for isotype switching within the myeloma clone Blood, November 1, 2001; 98(9): 2791 - 2799. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Perez, H. M. Rinder, C. Wang, J. B. Tracey, N. Maun, and D. S. Krause Xenotransplantation of immunodeficient mice with mobilized human blood CD34+ cells provides an in vivo model for human megakaryocytopoiesis and platelet production Blood, March 15, 2001; 97(6): 1635 - 1643. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||