|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 3 (February 1), 2000:
pp. 1069-1077
PHAGOCYTES
Cell-specific, activation-dependent regulation of neutrophil
CD32A ligand-binding function
Shanmugam Nagarajan,
Kala Venkiteswaran,
Michael Anderson,
Umar Sayed,
Cheng Zhu, and
Periasamy Selvaraj
From the Department of Pathology and Laboratory Medicine, Emory
University School of Medicine, and the School of Mechanical
Engineering, Georgia Institute of Technology, Atlanta, GA.
 |
Abstract |
Neutrophils express 2 low-affinity Fc R, FcRIIIB (CD16B), and
FcRIIA (CD32A). CD16B is a glycosyl-phosphatidyl inositol-anchored molecule, whereas CD32A is a polypeptide-anchored molecule. These 2 receptors also differ in their signaling. The biological significance of coexpression of 2 FcRs with distinct membrane anchors and signaling capacities is not clearly understood. Using neutrophils from
a CD16B-deficient donor and normal neutrophils treated with anti-CD16
monoclonal antibodies, the authors demonstrated that affinity
modulation of CD32A is one of the mechanisms by which neutrophils
regulate their FcR-dependent functions. Neutrophils isolated from a CD16B donor rosetted poorly with sheep
erythrocytes opsonized with rabbit IgG (EA) (12% ± 2% versus
80% ± 6% for control) and were unable to mediate
immunophagocytosis. However, activation of CD16B
neutrophils with fMLP, a bacterial chemotactic peptide, increased the
CD32A-dependent EA rosetting to 58%. The CD32A-dependent rosetting of
fMLP-activated normal neutrophils also increased nearly 5-fold, but
there was no increase in CD32A expression. The CD32A-dependent immune
complex (IC) binding was also increased in activated neutrophils. This
affinity regulation was not observed with CD32A expressed on Chinese
hamster ovary cells. These results suggest that in resting neutrophils
CD32A is in a low-affinity state and that these cells primarily engage
CD16B for IC binding. However, once the neutrophils are activated, the
CD32A is converted to a high-affinity state that leads to
CD32A-dependent ligand binding and signaling. These results suggest
that neutrophils adopt a novel strategy to engage the 2 different
FcR selectively during physiologic and pathologic conditions to
carry out their functions efficiently.
(Blood. 2000;95:1069-1077)
© 2000 by The American Society of Hematology.
| |
Introduction |
The peripheral blood phagocytes, neutrophils, and
monocytes recognize foreign organisms and eliminate them from the body
by antibody-dependent cellular cytotoxicity and phagocytosis. FcR plays a major role in mediating antibody-dependent cellular
cytotoxicity and immunophagocytosis and in clearing immune complexes
(IC) from the circulation.1-6 The occupancy of FcR by IC
induces secretion of various inflammatory mediators and lymphokines.
Therefore, knowledge of the structure and function of Fc receptors
is fundamental for understanding inflammatory processes and defense by
the immune system.
The structure and binding properties of 3 types of FcR have been
described.1-5 FcRI (CD64) is a high-affinity receptor of
70 kd expressed on monocytes, tissue macrophages, and activated neutrophils. FcRII (CD32), a low-affinity receptor for monomeric IgG, is a 40-kd protein expressed on monocytes, macrophages,
neutrophils, B cells, platelets, epithelial cells, and endothelial
cells. The FcRIII (CD16), which is also a low-affinity receptor for
monomeric IgG, is a glycoprotein of 50 to 70 kd expressed on
neutrophils, natural killer cells, eosinophils, and macrophages. The
CD16 expressed on natural killer cells and macrophages (CD16A) has a
classical polypeptide membrane anchor, whereas the neutrophil CD16
(CD16B) is glycosyl-phosphatidyl inositol
(GPI)-anchored.7-11
The 2 low-affinity Fc receptors for IgG, CD32A and CD16B, bind ligands
with overlapping specificity.2-5 The density of CD16B expressed on neutrophils is 4 to 5 times higher than that of CD32A (135 000 versus 31 000 molecules/cell).7 The 2 low-affinity FcRs expressed on neutrophils differ in their signaling
capacities. Cross-linking of neutrophil CD16B induces Ca++
mobilization, chicken E cytotoxicity, and degranulation, but it is
unable to signal for respiratory burst, tumor cell cytotoxicity, and
phagocytosis.9,12-18 However, under similar
conditions, CD32A is capable of signaling for all these Fc-dependent
functions in neutrophils.15,19 These studies show that the
polypeptide-anchored form of CD32A is a potent trigger molecule
compared with GPI-anchored CD16B.15 It is intriguing to
note that neutrophils express CD16B at 4 to 5 times higher density with
overlapping ligand specificity, yet CD16B is not as potent as CD32A in
triggering functions. It would be interesting to know why neutrophils
express 2 Fc receptors differing in their membrane anchor and
signaling capacity. We have identified a blood donor with no CD16B
expression but with normal CD32A expression. Using neutrophils from
this donor and normal neutrophils blocked with anti-CD16B monoclonal
antibody (mAb), we demonstrated that the ligand-binding function of
CD32A was modulated from a low-affinity state in resting neutrophils to
a high-affinity state in activated neutrophils. Our findings suggest
that such an affinity regulation could play an important role in the
preferential use of 2 FcRs by neutrophils to carry out its functions
under physiologic and pathologic conditions.
| |
Materials and methods |
Reagents
Human IgG subtypes, rabbit anti-DNP IgG, and crystalline bovine
serum albumin were purchased from Sigma Chemical Company (St. Louis,
MO). Human transferrin and rabbit antihuman transferrin IgG were
purchased from Boehringer Mannheim (Indianapolis, IN). Sheep
erythrocytes (SRBC) were from Colorado Serum Company (Denver, CO).
Na125I was from Amersham (Arlington Heights, IL), and
Iodogen was from Pierce (Rockford, IL). IgG-free fetal bovine serum
(FBS) and other tissue culture media were purchased from GIBCO BRL
(Grand Island, NY).
Cell lines and antibodies
Anti-CD16 (3G8 and CLBFcgran-1) mAbs were described
previously.7 Monoclonal antibodies specific for NA1
(CLBFcgran 11) and NA2 (GRM1) allotypes of CD16B were kindly provided
by Drs T. Huizinga (Amsterdam, Netherlands) and F. Jarred (Virgen de las Nieves AVD, Grenada, Spain), respectively. Fluorescein
isothiocyanate (FITC)-conjugated-F(ab')2 sheep antimouse
IgG was purchased from Tago Immunochemicals (Burlingame, CA). Mouse
anti-DAF (IA10) and anti-CD59 (10G10) were gifts of Drs E. M. Medof
(Case Western Reserve University, Cleveland, OH) and W. F. Rosse (Duke
University, Durham, NC), respectively. Mouse hybridoma cell lines
secreting antibody against CD32 (IV.3), CD64,32.2 CD11a
(TS1/22), CD11b (LM2/1), CD18 (TS1/18), LFA3 (TS2/9), CR1 (mAb 543),
and HLA 1 (W6/32) were obtained from American Type Culture Collection
(Rockville, MD). Mouse antihuman CD11c (SHCL3) was a gift from Dr C. Parkos (Emory University, Atlanta, GA). CHOK1 cell transfectant
expressing CD32A was established by cotransfecting CD32A
cDNA20 in a pCDM8 vector (kindly provided by Dr Brian Seed,
Massachusetts General Hospital, Boston, MA) with a plasmid containing
hygromycin selection marker pSVhygro. Transfectants expressing high
levels of CD32A were selected by panning and immunofluorescent flow
cytometry sorting. Chinese hamster ovary (CHO) cell transfectants were
maintained in 200 µg/mL hygromycin B.
Isolation and flow cytometric analysis of neutrophils
Neutrophils and mononuclear cells were isolated from human
peripheral blood using the dextran sedimentation method as described previously.9 Neutrophils were prepared at room temperature and used as quickly as possible. All the washing media and centrifuges were also kept at room temperature to avoid temperature fluctuations during neutrophil preparation.
For flow cytometry analysis, cells (5 × 105) were
incubated with the mouse mAbs or control mIgG1 (X63), followed by
staining with FITC-conjugated-F(ab')2 sheep antimouse IgG.
The samples were analyzed in FACScan flow cytometer (Becton Dickinson,
San Jose, CA).
Rosetting of human IgG-conjugated erythrocytes to neutrophils
Human IgG subtypes and antibodies were coupled to SRBC by the
chromium chloride method.21 Neutrophils
(5 × 105/well) in Hanks' balanced salt
solution/1% IgG-free FBS were incubated with human IgG-coupled SRBC
(2 × 107/well) for 4 hours at 4°C in the
presence and absence of Fab fragments of anti-CD16 mAb, CLBFcgran-1, or
anti-CD32A mAb, IV.3. At least 200 cells were examined under light
microscopy for rosetting. Neutrophils with a minimum of 5 SRBC attached
were scored as rosettes. Rosetting assays were also carried out using
SRBC coated with TNP-rabbit anti-DNP IgG. Rosetting was also conducted
in the presence of mAbs against CD11a, CD11b, CD11c, and CD18 to
determine whether integrins contributed to the rosette formation of
neutrophils with rabbit anti-DNP IgG-opsonized SRBC. Aggregate RBCs,
occasionally seen during the preparation of IgG-coated SRBC, were
removed immediately before rosetting by being passed through a nylon mesh.
Polymerase chain reaction amplification of CD16 gene-specific
sequences
CD16 gene-specific sequences8 were analyzed using
genomic DNA isolated from peripheral blood mononuclear
cells.22 The region of exon 5 (corresponding
to 611-825 bp of cDNA) with gene-specific restriction endonuclease
sites (Dra I and Taq I) was amplified from genomic DNA by polymerase
chain reaction (PCR) as described.23 An aliquot of
PCR-amplified product was subjected to Taq I or Dra I restriction
enzyme digest, and the digested products were analyzed on 2% NuSieve
agarose gels.
Phagocytosis assay
Phagocytosis of rabbit anti-DNP IgG-opsonized SRBC (EA) was
determined as described.24 Briefly, neutrophils
(1 × 106) in 100 µL RPMI/2% IgG-free FBS/10
mmol/L HEPES, pH 7.3, were incubated on ice with
8 × 107 of EA in 50 µL of the same buffer for 30 minutes in duplicate tubes in the presence or absence of Fab fragments
of anti-CD16 and anti-CD32 mAbs. One set of tubes was transferred to
37°C and incubated for another 30 minutes. Surface-bound and
unbound EA were removed by hypotonic lysis in H2O for 20 seconds. The cells were washed in cold phosphate-buffered saline and
lysed in 200 µL of 10 mmol/L phosphate buffer, pH 6.5, containing
0.1% sodium dodecyl sulphate and 0.1% Triton X-100. Pseudoperoxidase
activity of hemoglobin from the ingested E was assayed as
described,24 using a 20 µL aliquot of the cell lysate,
o-tolidine (50 µg/mL) in 50 mmol/L acetate buffer, pH 5.5, and 0.12%
H2O2. The color developed was read at 405 nm in
a Bio-Rad enzyme-linked immunosorbent assay plate reader. Neutrophils
incubated with unopsonized TNP-E were used as controls.
Immune complex binding assay
Human transferrin was iodinated with Na125I using
Iodogen,25 and a soluble immune complex was prepared as
described.26 Briefly, 125I-transferrin (50 µg/mL) was mixed with rabbit antihuman transferrin IgG (50 µg/mL)
for 4 hours at 4°C. The complex was centrifuged at 15 000 rpm for
30 minutes at 4°C, and the supernatant was used for an
125I-IC binding assay. No visible pellet was seen after
centrifugation of the IC. Formyl-methionyl-leucyl-phenylalanine
(fMLP)-activated and control neutrophils
(5 × 105/well) were preincubated with Fab fragment
of indicated mAbs (50 µL of 100 µg/mL) for 30 minutes at 4°C.
125I-IC was then added, and incubation continued for 45 minutes at 4°C. After the cells were washed with cold Hanks'
balanced salt solution/1% fetal bovine serum, the 125I-IC
bound to cells was counted in a gamma counter. The IC bound to
neutrophils in binding buffer was taken as 100%. The IC binding in the
presence of a 50-fold excess of Fab fragments of anti-CD16 mAb
(CLBFcgran-1) and anti-CD32 mAb (IV.3) was taken as nonspecific binding.
The molecular size of IC was determined by size exclusion
chromatography using Sephacryl S300-HR (Pharmacia, Piscataway, NJ). 125I-IC (100 µg/mL) was passed through Sephacryl S300-HR,
protein peaks were identified by monitoring absorbance at 280 nm, and the radioactivity in each fraction was counted in a gamma counter. The
protein peak corresponding to 125I-IC was identified by
binding of purified CD16 to 125I-IC. Calculations using the
specific activities of radiolabeled transferrin and the molecular size
of the IC showed that IC was made up of 3 transferrin and 2 IgG molecules.
| |
Results |
Characterization of CD16B deficiency in blood donor neutrophils
The expression of CD16B and CD32A on neutrophils from donor 17 were
analyzed by flow cytometry. As shown in Figure
1, a CD16-specific mAb, CLBFcgran-1 did not
bind to neutrophils from a blood donor (donor 17, or D17). In addition,
anti-CD16 mAbs 3G8, CLBFcgran-11, and GRM1 also did not bind to
neutrophils from the same donor (data not shown). However, the
expression of CD32A on neutrophils was similar to that observed in
neutrophils from the control donor (Figure 1). CD16B is expressed as a
GPI-anchored form on neutrophils. Because the cell surface
expression of GPI-anchored proteins such as CD16B, CD55, and CD59 is
defective in patients with paroxysmal nocturnal
hemoglobinuria27 because of a defect in the biosynthesis of
the GPI-anchor, the expression of other GPI-anchored proteins was
analyzed. The expression of CD55 and CD59 in neutrophils from D17 were
normal (data not shown), indicating that the deficient CD16B expression
in D17 was not caused by paroxysmal nocturnal hemoglobinuria. Neither
control nor D17 neutrophils expressed CD64. The expression of other
cell surface proteins, such as LFA-3, CD11a, CD11b, CD11c, CR1, and
HLA class I, was not altered in neutrophils from D17 (data
not shown).
View larger version (17K):
[in this window]
[in a new window]
| Fig 1.
Immunofluorescent flow cytometry analysis of neutrophils
from donor 17 and control.
Cells were stained with indicated mAbs followed by
FITC-conjugated-F(ab')2 sheep antimouse IgG.
CLBFcgran-1 is an antiCD16 mAb; IV.3 is an anti-CD32A mAb. X63 is a
nonbinding mouse myeloma IgG.
|
|
The expression of CD16A in the LGL fraction of the mononuclear cell
fraction from D17 was analyzed by flow cytometry, and the expression of
CD16A in LGL was normal (data not shown), as reported in persons
deficient in CD16B.28 CD16A and CD16B are products of 2 different highly homologous genes,8 and the failure in
expression of CD16B in neutrophils from D17 might have been caused by a
defect in the gene or in the transcription of the gene specific for
CD16B. Because similar deficiencies in CD16B expression resulting from
a CD16B gene defect have been reported in a patient with systemic lupus
erythematosus23 and in a healthy mother,29 we
performed a similar PCR amplification of CD16 genes23 using
genomic DNA from D17 and a control donor. A 215-bp product was obtained
by PCR amplification of DNA from D17 and the control (Figure
2B, lanes 1 and 4). The restriction sites
for Dra I and Taq I were present only in the CD16A gene6;
therefore, CD16A or CD16B gene-specific fragments can be identified by
differential susceptibility to these restriction endonucleases (Figure
2A). All the 215-bp PCR product obtained from D17 was completely
susceptible to Taq I and Dra I restriction endonuclease digestion,
whereas only part of the 215-bp PCR product from the control was
susceptible (Figure 2B). These results indicated that the CD16A gene
was normal and that the lack of the expression of CD16B in neutrophils
resulted from partial or complete deletion of the CD16B gene.
View larger version (40K):
[in this window]
[in a new window]
| Fig 2.
Analysis of CD16A and CD16B genes expressed in donor 17 by PCR.
(A) Restriction map of CD16B (neutrophils) and CD16A (natural killer
[NK] cells). Gene-specific restriction endonuclease sites Dra I (D)
and Taq I (T) are indicated in a box. Also shown are the positions of
the primers used for PCR amplification of the segment of the exon 5 (corresponding to 611-825 bp of cDNA). (thick bars) Coding regions of
cDNA. (thin bars) Noncoding regions of cDNA. (B) Restriction
endonuclease analysis of PCR products recovered from donor 17 and
control. The exon 5 segment was amplified with primers 1 (forward,
gtttggcagtgtcaa) and 2 (reverse, gctcttattactcccatggga) using genomic
DNA from control (left panel) and D17 (right panel). The PCR product
was treated without (lanes 1 and 3) or with Dra I (lanes 2 and 4) or
with Taq I (lanes 3 and 6), and then it was analyzed by 2% NuSieve
agarose gel.
|
|
Deficient IgG binding by D17 neutrophils
The functional status of FcR on neutrophils from D17 was analyzed
for its ability to bind to human IgG subtypes. The binding of human IgG
subtypes to neutrophils was analyzed using the IgG subtypes coupled to
SRBC (E-IgG), and subsequent rosette formation was quantified.
Neutrophils from a control donor showed approximately 60%, 43%, and
55% rosette formation with E-IgG1, E-IgG2, and E-IgG3, respectively
(Figure 3). No E-IgG rosetting to normal
neutrophils was observed in the presence of an anti-CD16 mAb,
CLBFcgran1, whereas in the presence of an anti-CD32 mAb, IV.3, 44%,
20%, and 43% rosetting was observed with E-IgG1, E-IgG2 and E-IgG3,
respectively. In contrast, the binding of E-IgG subtypes to the
neutrophils from D17 was reduced significantly (Figure 3); only 9%,
5%, and 8.5% rosetting with E-IgG1, E-IgG2, and E-IgG3, respectively. The low-level rosetting of E-IgG subtypes to D17 neutrophils was mediated through CD32A, as evident from the complete inhibition of
binding by IV.3 (Figure 3). E-IgG4 did not bind to neutrophils from
either the control or D17 (Figure 3). We also analyzed the binding of
the rabbit IgG by determining the rosette formation of neutrophils with
rabbit anti-DNP IgG-opsonized, TNP-conjugated SRBC (EA). The rosette
formation of D17 neutrophils with EA was only approximately
12% ± 2% (mean ± SD from 4 different blood donations)
compared with 79% ± 6% rosette formation with the control neutrophils.
View larger version (25K):
[in this window]
[in a new window]
| Fig 3.
Rosetting of human IgG-coupled SRBC with neutrophils from
donor 17.
Neutrophils from control (closed bar) or donor 17 (hatched bar) were
incubated with human IgG subtype-coupled SRBC in the absence or
presence of 5 µg/mL Fab fragments of anti-CD16 mAb, CLBFcgran-1, or
anti CD32A mAb, IV.3. The rosetting assay was performed as described in
"Materials and Methods." Cells were incubated with IgG-coupled
SRBC at 4°C, and the rosettes formed were counted by light
microscopy. Experiments were performed in duplicate.
|
|
Neutrophils from donor 17 do not phagocytose rabbit IgG
opsonized SRBC
The consequence of the CD16B deficiency on the capacity of D17
neutrophils to phagocytose EA was analyzed. Neutrophils from the
control were able to phagocytose the EA efficiently, but neutrophils from D17 were not phagocytic (Figure 4A),
despite the normal expression of CD32A. This was not surprising
considering that D17 neutrophils bound poorly to EA. To confirm that
the defective phagocytosis was caused by lack of binding and to
determine whether CD32A retained its signaling capacity to mediate
phagocytosis in the absence of CD16B, Fab fragments of anti-CD32A mAb
were used as a ligand to coat SRBC (E-IV.3). When IV.3 was used as the
ligand, neutrophils from D17 and the control showed approximately 80%
rosette formation. The level of phagocytosis of the E-IV.3 by
neutrophils from D17 was similar to the level seen in control
neutrophils (Figure 4B), and it was much higher than that of IgG-coated
E. This suggested that CD32A is capable of phagocytic signaling when
stable binding is achieved by the use of high-affinity ligands such as
mAb. These results indicated that in the absence of CD16B expression,
D17 neutrophils cannot mediate phagocytosis of EA because of
inefficient ligand binding by CD32A. These results also showed that the
signal produced by CD16B was not required for phagocytosis. Under
similar conditions, Fab fragments of anti-CD16-coated E (E-3G8) were
not phagocytosed, though they bound normal neutrophils as efficiently as IV.3-coated E, which is in agreement with the observations by
others.30,31
View larger version (17K):
[in this window]
[in a new window]
| Fig 4.
Phagocytosis of rabbit IgG-opsonized SRBC and
FcR-specific, mAb-coated SRBC by neutrophils from donor 17.
Neutrophils isolated from control (closed bar) or D17 (hatched bar)
were analyzed for the phagocytosis of EA (A) or Fab fragments of
indicated mAb-coated SRBC (B) as described in "Materials and
Methods." The pseudoperoxidase activity of the hemoglobin from the
ingested E was assayed using o-tolidine, and the color formed was
measured at 405 nm in an enzyme-linked immunosorbent assay reader.
|
|
fMLP treatment up-regulates CD32A ligand binding function on D17
neutrophils
The affinity of receptors such as integrins is known to be modulated
by the activation state of the cell.32,33 Therefore, we
have tested whether the activation of D17 neutrophils increases the
ligand-binding function of CD32A. IgG binding was determined by
rosetting of EA with neutrophils. The rosette formation of EA with
neutrophils from D17 was only 12% compared with 86% seen in the
control (Figure 5A). However, the rosetting
of EA with D17 neutrophils was increased from 12% to 58% after fMLP
treatment (Figure 5A). The binding of EA to D17 neutrophils was
completely inhibited by anti-CD32 mAb (IV.3), whereas anti-CD16 mAbs
did not have any effect on the EA rosetting. Furthermore, fMLP
treatment did not affect the level of CD32A expression in D17
neutrophils. In fact, it reduced the level of expression of CD32A by
35% (data not shown). Moreover, CD64 was not expressed in resting and
fMLP-activated D17 or control neutrophils (data not shown). These
results suggested that the activation of neutrophils converted the
low-affinity form of CD32A to a high-affinity form.
View larger version (37K):
[in this window]
[in a new window]
| Fig 5.
Effect of fMLP treatment of neutrophils on rosette
formation with EA.
Neutrophils (1 × 107/mL) from control and donor 17 were incubated with RPMI 1640 medium without serum in the absence or
presence of fMLP (1 µmol/L, 10 µmol/L) for 30 minutes at 37°C.
After washing the cells in RPMI 1640/2% IgG free fetal bovine serum,
the rosette formation of neutrophils from donor 17 (A) and control (B)
with E was performed as described in "Materials and Methods."
Experiments were performed in duplicate.
|
|
Up-regulation of CD32A-dependent EA rosetting in normal neutrophils
by fMLP treatment
Next we determined whether CD32A expressed on normal neutrophils is
in a low-affinity state and can be modulated by cell activation. The
CD32A-dependent ligand binding was determined by treating normal
neutrophils with Fab fragments of anti-CD16 mAb, CLBFcgran1, followed
by rosetting with EA. As shown in Table 1,
normal neutrophils rosetted 70% to 80% with EA, whereas under the
same conditions 5% to 20% of the anti-CD16 mAb-treated neutrophils
formed rosettes. Activation of neutrophils with fMLP increased
CD32A-dependent rosetting to 25% to 60%, suggesting that
ligand-binding capacity of CD32A is modulated in normal neutrophils.
This rosette formation was completely blocked when both anti-CD16 and
anti-CD32 mAbs were added together during rosetting. Addition of mAbs
against  - (CD11a, CD11b, and CD11c) and  -chains (CD18) of
integrins did not influence the rosette formation (data not shown),
suggesting that integrins are not involved in the rosette formation
between EA- and fMLP-activated neutrophils. This finding is in
agreement with the reports from Brown et al34 that
FcR-mediated EA rosette formation of neutrophils was not inhibited
by anti-CD11b/CD18 mAb. Moreover, EA rosette formation was normal in
neutrophils from patients with leukocyte adhesion deficiency patients
who lack integrin expression.34 These results are in
contrast to those of Kusunoki et al,35 who demonstrated
that CD11b integrin is involved in neutrophil adhesion. It is possible
that CD11b integrin may influence the downstream signaling events of
CD32A by associating with FcR, as has been shown for CD16B. However, we did not see any effect of integrin mAbs on EA rosetting. Rosette formation was not caused by CD64 because there was no expression of
CD64 in unactivated and activated neutrophils. In some donors, even the
incubation of neutrophils at 37°C up-regulated CD32A-dependent EA
rosetting. The increase in CD32A-dependent rosetting in fMLP-treated normal neutrophils was not caused by the increased surface expression of CD32A because the FACS analysis showed a decrease in the expression (data not shown). In control and D17 neutrophils, fMLP treatment resulted in a nearly 35% to 40% decrease in CD32A expression and a
3-fold increase in the level CD11b expression. fMLP treatment also
reduced the level of expression of CD16B by 80% in normal neutrophils.
The modulation of level of expression of these receptors by fMLP was
consistent with the previously reported observations.36,37 These results showed that the activation-induced modulation of CD32A
ligand binding was not unique to the CD32A expressed on CD16B negative
neutrophils.
Up-regulation of CD32A-dependent soluble immune complex binding in
normal neutrophils by fMLP treatment
In the results described so far, we demonstrated the modulation of
CD32A ligand-binding function using EA rosette formation. Because the
EA rosette formation represents the binding of particulate immune
complexes such as IgG-coated SE, we also determined whether such a
modulation of the CD32A ligand-binding function could be observed with
soluble immune complexes. The CD32A-dependent soluble IC binding was
determined by treating neutrophils with Fab fragments of anti-CD16 mAb,
CLBFcgran1, followed by 125I-IC binding.
IC was prepared by mixing known protein concentrations of radiolabeled
transferrin and rabbit antitransferrin IgG. The molecular size of the
IC was determined to be approximately 530 kd by size-exclusion chromatography. The total binding of IC to unactivated neutrophils showed a dose-dependent increase (Figure
6A). Total binding of IC to activated
neutrophils was decreased to approximately 81% compared with that of
unactivated neutrophils (Figure 6A). This decrease in binding may have
been caused by the reduced cell surface expression of CD16B as a result
of CD16B shedding from activated neutrophils. Under similar conditions,
the CD32A-dependent binding of unactivated neutrophils was very low,
approximately 3.3% of total binding (Figure 6C). However, after fMLP
treatment, the CD32A-dependent binding of IC increased by 2.5-fold
after the activation of neutrophils (Figure 6D). Under similar
conditions, radiolabeled monomeric IgG, isolated by gel filtration, did
not show any detectable binding to activated or unactivated
neutrophils, suggesting that CD16B and CD32A cannot bind monomeric IgG
stably. This is in agreement with earlier reports from Huizinga et
al.38
View larger version (27K):
[in this window]
[in a new window]
| Fig 6.
Effect of neutrophil activation on binding of soluble
immune complexes by CD32A.
125I-Transferrin/rabbit antihuman transferrin IgG immune
complex (125I-IC) was prepared as described in
"Materials and Methods." The molecular size of the IC was
determined by gel filtration. fMLP (1 µmol/L) activation of
neutrophils was performed as described in the legend to Figure 5. After
washing the cells with RPMI 1640/2% IgG-free fetal bovine serum,
125I-IC binding was carried out as described in
"Materials and Methods." Total binding (A) of IC to unactivated
(open circle) and activated (closed circle) neutrophils was performed
in the presence of a binding buffer. CD32A-dependent binding (C) was
performed in the presence of Fab fragments of anti-CD16 mAb,
CLBFcgran-1. Scatchard plot analysis of total binding (B) and
CD32A-dependent binding (D) was done after converting the specific
binding to bound/free IC as functions of the bound IC. Binding in the
presence of a 50-fold excess of Fab fragments of mAbs against CD16B and
CD32A was taken as nonspecific binding. The IC bound to neutrophils in
binding buffer was taken as 100%. Experiments were performed in
triplicate.
|
|
Scatchard plot analysis of IC binding to unactivated and activated
neutrophils was performed to determine the binding affinity of CD32A.
The relative affinity of CD32A to IC was increased
(Kd 65.4 nmol/L versus 38.7 nmol/L for unactivated
and activated neutrophils, respectively) after activation (Figure 6D).
The amount of CD32A-dependent binding also increased. Because the
expression of CD32A on neutrophils was not increased on activation, the
increase in the total number of CD32A-dependent IC binding could have
been caused by the increase in the number of active CD32A on activated
neutrophils or the increase in the affinity of CD32A to IC. These
results demonstrate that the activation of neutrophils up-regulated the
binding of CD32A to soluble IC and to particulate ICs such as EA.
Recombinant CD32A expressed on Chinese hamster ovary cells binds
ligand-coated SRBC
Leukocyte integrins such as LFA-1 are functionally inactive in
resting peripheral blood lymphocytes but functionally active when
expressed on COS cells.32,33 A platelet integrin, IIb/IIIa, is expressed as low-avidity state and can be activated to bind ligand
regardless of whether it is expressed on platelet or CHO cells. This
suggests that not all receptors exhibit similar cell-specific differences in their affinity modulation. Therefore, we tested whether
the ligand-binding function of CD32A expressed on CHO cells could be
modulated. CHO cell transfectants expressing CD32A were allowed to form
rosettes with EA. As shown in Table 2,
nearly 53% of CHO cell transfectants formed rosettes. The rosettes
were blocked by an anti-CD32A mAb, IV.3. Incubation of CHO cells with fMLP or PMA before rosetting did not influence ligand binding, suggesting that the CD32A ligand-binding function was not modulated in
CHO cells. Untransfected CHO cells did not form rosettes with IgG-coated SRBC (data not shown).
| |
Discussion |
Fc receptor ligation in neutrophils triggers the release of
granule contents and inflammatory mediators. The release of neutrophil granule contents during normal physiologic function, ie, secondary to binding and clearance of IC, could result in severe pathologic reactions. Therefore, it is important that in normal circumstances neutrophils perform IC clearing functions without releasing
unwanted inflammatory mediators. The CD16B-deficient neutrophils
provide an opportunity to address the mechanisms by which neutrophils use 2 low-affinity FcRs to carry out their physiologic functions. Using CD16B-deficient neutrophils, we showed that in normal
neutrophils, CD32A existed as a low-affinity state that was converted
to a high-affinity state on neutrophil activation.
Analysis of neutrophil FcR' ligand-binding functions showed that
CD16B-negative D17 neutrophils did not bind rabbit or human IgG-coated
cells efficiently. A similar deficiency in ligand binding in another
CD16B-deficient person was reported by Clark et al.23 CD32A
exists in 2 allotypes, low responders (CD32ALR) and high
responders (CD32AHR), defined by the allotype affinity to
human IgG2. CD32ALR binds human IgG2, whereas
CD32AHR does not bind human IgG2; however, both allotypes
can efficiently bind human IgG1 and IgG3.39 Our rosetting
studies with human IgG subtypes showed that the deficiency in rosetting
was not caused by CD32A polymorphism.39 Neutrophils from
D17 also did not phagocytose EA. Efficient binding and phagocytosis was
observed, however, when erythrocytes were coated with high-affinity
ligands such as IV.3, an anti-CD32A mAb, indicating that CD32A is
competent in signaling for phagocytosis if stable binding of EA is
achieved on neutrophils. Therefore, the lack of phagocytosis of EA by
D17 neutrophils was a consequence of inefficient ligand binding by CD32A expressed on D17 neutrophils. This also suggested that in normal
neutrophils, CD16B is the FcR that stabilizes IC binding.
In contrast to our observations, Stroncek et al40 reported
that 38% of neutrophils from a CD16B-deficient donor can form rosettes. This discrepancy might have resulted from differences in
neutrophil preparation and rosetting procedures. In their report, it
should be noted, neutrophils were prepared and stored in ice, and the
rosetting was carried out at 37°C. We and other
investigators41-43 have observed that neutrophils are
activated by handling procedures such as changes in temperature. It is
clear from our study that neutrophil activation could increase
rosetting mediated by CD32A (Table 1), which may explain the
observation of Stroncek et al.40 Therefore, it is important
that neutrophils be prepared without subjecting them to an activation
process. This can be achieved by preparing and storing neutrophils at
room temperature and using them as quickly as possible.
The molecular mechanism that converted the CD32A from an inactive to an
active state during neutrophil activation was unclear. Possible
mechanisms include partial cleavage of CD32A by granule proteases,
phosphorylation, receptor clustering, or cytoskeletal attachment of the
cytoplasmic domain of CD32A during neutrophil activation. Previous
studies have shown that fMLP stimulation results in alteration of the
cytoskeletal network of neutrophils.44 CD32A has been shown
to be activated by serine proteases and elastase on cultured myeloid
cells and neutrophils.45-48 It is also possible that the
increased receptor mobility49 or association with other receptors50-53 could cause a change in CD32A affinity. It
is possible that various activation signaling mechanisms may
differentially regulate CD32A function. Examples of affinity modulation
of cell surface receptors by cell activation have been reported by
others.32,33
It is also possible that affinity modulation may be cell specific. Such
cell specificity has been observed with the LFA-1 molecule.54,55 LFA-1 expressed on unactivated PBL does not bind its ligand ICAM-1, whereas LFA-1 on activated PBL, Jurkat cells,
transfected COS cells, or purified LFA-1 can bind ICAM-1, suggesting
that affinity modulation by cell activation is a cell-specific phenomenon. Our results with CD32A-transfected CHO cells also showed
such a cell-type specific affinity modulation. Affinity modulation has
also been reported for mouse CD32B expressed on B
lymphocytes.56 Interestingly, the affinity of this receptor has been shown to decrease after the 48-hour incubation of cells with
activators such as IL- 4 or PMA.
Various studies have demonstrated that in normal neutrophils, CD16B is
the dominant FcR in binding IC.57,58 These reports are
in agreement with our findings that more than 80% to 95% of IC
binding to neutrophils was inhibited by anti-CD16 mAb. The high density
of CD16B may be responsible for this dominance. However, our
observations with D17 neutrophils suggested that CD32A did not
contribute to IC binding in normal neutrophils because it was in an
inactive or low-affinity state. The results presented here and
elsewhere30,31 with anti-CD16 mAb-coated E suggest that
CD16B alone is unable to deliver the signal for phagocytosis of EA and
that CD32A is required for phagocytosis in normal neutrophils.
It is unclear how CD32A that is unable to bind ligands in resting
neutrophils can deliver signals for events such as phagocytosis. One
possibility is that CD32A, in its low-affinity state, is able to
interact with Fc domains available on IC captured by CD16B. The signal
produced by this weak interaction of CD32A, in synergy with the signal
delivered by CD16B, may be enough for the phagocytic event.
Alternatively, the engagement of CD16B with IgG may be responsible for
the up-regulation of CD32A function. CD16B cross-linking promotes actin
assembly and enhances the phagocytosis by CD32A in
neutrophils.59 It has been shown that CD16B cross-linking induces phosphorylation of CD32A in neutrophils.31 CD16B
interaction with IC could also affect the extracellular domain of CD32A
at the IC binding site on neutrophil membranes. For example,
GPI-anchored CD16B is capable of delivering a signal for lysosomal
enzyme release in response to IC binding.17 Therefore, on
binding to IC, CD16B can induce the release of lysosomal proteases in
the vicinity of the IC-binding site. Consequently, neutrophil lysosomal
proteases such as elastase can convert the low-affinity form of CD32A
to a high-affinity form that could then efficiently interact with the
IC captured by the CD16B and signal for events such as phagocytosis. Indeed, a recent report by Salmon et al60 demonstrated that the cross-linking of neutrophil CD16B could enhance the phagocytosis mediated by CD32A in an oxidant-dependent manner, suggesting that the
signal delivered by CD16B influences CD32A function.
The absence of CD16B expression on D17 neutrophils reported here
appears to have been caused by partial or complete deletion of the
CD16B gene. The D17 blood donor is apparently healthy except for
frequent sinusitis. Five persons previously reported are healthy without any complications,29,61 whereas 2 others are
reported to have systemic lupus erythematosus.23,62 The
pathophysiologic conditions associated with CD16B deficiency are not
yet clear. The relatively normal function of these persons probably
resulted from the conversion of CD32A to a high-affinity state which is capable of binding IgG-coated particles, suggesting that CD32A can
carry out FcR-dependent neutrophil functions efficiently in the
absence of CD16B.
Results from this study and earlier reports57,58 indicate
that CD16B is the dominant FcR for IC binding to neutrophils. The
CD32A-dependent particulate IC binding was poor in CD16B-negative neutrophils; however, this binding was increased on activation. Binding
studies with soluble IC have shown that the affinity of neutrophil
CD32A increased nearly 2-fold on activation with fMLP. However, our
experiments with particulate immune complexes such as EA demonstrated
that this modest increase in affinity resulted in the efficient binding
of EA, suggesting that in addition to moderate affinity changes, other
factors such as increased avidity caused by receptor clustering may
also contribute to efficient EA binding. Alternatively, the 2-fold
increase in CD32A affinity may be sufficient to reach the threshold for
efficient CD32A-mediated binding of neutrophils to EA. In summary, our
study demonstrated the existence of a novel mechanism of regulation of
FcR-dependent functions of neutrophils. This mechanism, which
retained the strong signaling CD32A in a low-affinity state in normal
neutrophils and in a high-affinity state in activated neutrophils, is
likely to be of physiologic importance. Because CD16B is the dominant FcR for binding to IC, the IC binding function of neutrophils may be
primarily carried out by weak-signaling CD16B. Subsequent to IC
binding, it is possible that CD16B delivers a signal that converts only
a limited number of CD32A localized at IC contact sites on the
neutrophils to a high-affinity state. Thus, controlled activation of
CD32A could be achieved. Such a mechanism of engaging a high number of
weak-signaling CD16B and low number of strong-signaling CD32A during IC
binding may result in the reduced release of inflammatory mediators
during normal physiologic states. Neutrophil activation also resulted
in the release of CD16B from cell surfaces.37,63 Therefore,
activated neutrophils express a lower number of weak-signaling CD16B
while maintaining the strong-signaling high-affinity form of CD32A on
their cell surfaces (Figure 7).
Combinations of these changes in receptor expression and affinity would
enable neutrophils to mediate Fc-dependent functions when
neutrophils encounter bacterial peptides such as fMLP.
View larger version (45K):
[in this window]
[in a new window]
| Fig 7.
Model showing the functional states and expression levels
of low-affinity Fc receptors, CD32A and CD16B, on resting and
activated neutrophils.
|
|
| |
Acknowledgments |
The authors thank Drs V. Udhayakumar, Peter Jensen, Aron E. Lukacher,
and Charles Parkos for their critical comments on the manuscript and
Nawaz Ahmed and Terry Vales for their valuable technical assistance.
| |
Footnotes |
Submitted October 6, 1998; accepted September 29, 1999.
Supported by grants AI38282 and AI30631 from the National Institutes of Health.
Reprints: Periasamy Selvaraj, Department of Pathology and
Laboratory Medicine, 7307 WMB, 1639 Pierce Drive, Emory University, Atlanta GA 30322; e-mail: pselvar{at}emory.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Unkless JC, Scigliano E, Freedman VH.
Structure and function of human and murine receptors for IgG.
Ann Rev Immunol.
1988;6:251[Medline]
[Order article via Infotrieve].
2.
Ravetch JV, Kinet J-P.
Fc Receptors.
Ann Rev Immunol.
1991;9:457[Medline]
[Order article via Infotrieve].
3.
Sandor M, Lynch RG.
The biology and pathology of Fc receptors.
J Clin Immunol.
1993;13:237[Medline]
[Order article via Infotrieve].
4.
Winkel GJ, Capel PJP.
Human IgG Fc receptor heterogeneity: molecular aspects and clinical implications.
Immunol Today.
1993;14:215[Medline]
[Order article via Infotrieve].
5.
Kimberly RP, Salmon JE, Edberg JC.
Receptors for immunoglobulin G: molecular diversity and implications for disease.
Arthritis Rheum.
1995;38:306[Medline]
[Order article via Infotrieve].
6.
Indik ZK, Park JG, Hunter S, Schreiber AD.
Structure/function relationships of Fc gamma receptors in phagocytosis.
Semin Immunol.
1995;7:45[Medline]
[Order article via Infotrieve].
7.
Selvaraj P, Rosse WF, Silber R, Springer TA.
The major Fc receptor in blood has a phosphatidylinositol anchor and is deficient in paroxysmal nocturnal hemoglobinuria.
Nature.
1988;333:565[Medline]
[Order article via Infotrieve].
8.
Ravetch JV, Perussia B.
Alternative membrane forms of Fc gamma RIII (CD16) on human NK cells and neutrophils: cell-type specific expression of two genes which differ in single nucleotide substitutions.
J Exp Med.
1989;170:481[Abstract/Free Full Text].
9.
Selvaraj P, Carpen O, Hibbs ML, Springer TA.
Natural killer cell and granulocyte FcRIII (CD16) differ in membrane anchor and signal transduction.
J Immunol.
1989;143:3283[Abstract].
10.
Scallon BJ, Scigliano E, Freedman VH, et al.
A human immunoglobulin G receptor exists in both polypeptide-anchored and phosphatidylinositol-glycan-anchored forms.
Proc Natl Acad Sci U S A.
1989;86:5079[Abstract/Free Full Text].
11.
Edberg JC, Redecha PB, Salmon JC, Kimberly RP.
Human FcRIII (CD16): isoforms with distinct allelic expression, extracellular domains, and membrane linkages on polymorphonuclear and natural killer cells.
J Immunol.
1989;143:1642[Abstract].
12.
Perussia B, Acuto O, Terhorst C, et al.
Human natural killer cells analyzed by B73.1, a monoclonal antibody blocking Fc receptor functions. II. studies of B73.1 antibody-antigen interaction on the lymphocyte membrane.
J Immunol.
1983;130:2142[Abstract].
13.
Shen L, Guyre PM, Fanger MW.
Polymorphonuclear leukocyte function triggered through the high affinity Fc receptors for monomeric IgG.
J Immunol.
1987;139:534[Abstract].
14.
Lanier LL, Ruitenberg JJ, Phillips JH.
Functional and biochemical analysis of CD16 antigen on natural killer cells and granulocytes.
J Immunol.
1988;141:3478[Abstract].
15.
Fanger MW, Shen L, Graziano RF, Guyre PM.
Cytotoxicity mediated by human Fc receptors for IgG.
Immunol Today.
1989;10:92[Medline]
[Order article via Infotrieve].
16.
Kimberly RP, Ahlstrom JW, Click ME, Edberg JC.
The glycosyl phosphatidylinositol-linked FcRIII PMN mediates transmembrane signaling events distinct from FcRII.
J Exp Med.
1990;171:1239[Abstract/Free Full Text].
17.
Huizinga TWJ, Dolman KM, Van Der Linden NJM, et al.
Phosphatidylinositol-linked FcRIII mediates exocytosis of neutrophil granule proteins, but does not mediate initiation of the respiratory burst.
J Immunol.
1990;144:1432[Abstract].
18.
Naziruddin B, Duffy B, Tucker J, Mohankumar T.
Evidence for cross-regulation of FcRIIIB (CD16) receptor-mediated signaling by FcRII (CD32) expressed on polymorphonuclear neutrophils.
J Immunol.
1992;149:3702[Abstract].
19.
Lin CT, Shen Z, Boros P, Unkeless JC.
Fc receptor-mediated signal transduction.
J Clin Immunol.
1994;14:1[Medline]
[Order article via Infotrieve].
20.
Stengelin S, Stamenkovic I, Seed B.
The isolation of cDNAs for two distinct human Fc receptors by ligand affinity cloning.
EMBO J.
1988;7:1053[Medline]
[Order article via Infotrieve].
21.
Kofler R, Wick G.
Some methodological aspects of the chromium chloride method for coupling antigen to erythrocytes.
J Immunol Methods.
1977;16:201[Medline]
[Order article via Infotrieve].
22.
Miller D, Dykes DD, Polesky HF.
Simple salting out procedure for extracting DNA from human nucleated cells.
Nucl Acids Res.
1988;16:1215[Free Full Text].
23.
Clark MR, Liu L, Clarkson SB, Ory PA, Goldstein IM.
An abnormality of the gene that encodes neutrophil Fc receptor III in a patient with systemic lupus erythematosus.
J Clin Invest.
1990;86:341.
24.
Jungi TW.
A rapid and sensitive method allowing photometric determination of erythrophagocytosis by mononuclear phagocytes.
J Immunol Methods.
1985;82:141[Medline]
[Order article via Infotrieve].
25.
Fraker PJ, Speck JC.
Protein and cell membrane iodinations with a sparingly soluble chloramide,1,3,4,6-tetrachloro-3,6-diphenyl glycoluril.
Biochem Biophys Res Comm.
1978;80:849[Medline]
[Order article via Infotrieve].
26.
Nagarajan S, Chesla S, Cobern L, Anderson P, Zhu C, Selvaraj P.
Ligand binding and phagocytosis by CD16 (Fc gamma receptor III) isoforms.
J Biol Chem.
1995;270:25,762[Abstract/Free Full Text].
27.
Rosse WF.
Phosphatidylinositol-linked proteins and paroxysmal nocturnal hemoglobinuria.
Blood.
1990;75:1595[Free Full Text].
28.
de Haas M, Kleijer M, Minchinton R, Roos D, Kr.Von dem Borne AEG.
Soluble FcRIIIa is present in plasma and is derived from natural killer cells.
J Immunol.
1994;152:900[Abstract].
29.
Huizinga TWJ, Kuijipers RWAM, Kleijer M, et al.
Maternal genomic neutrophil FcRIII deiciency leading to neonatal isoimmune neutropenia.
Blood.
1990;76:1927[Abstract/Free Full Text].
30.
Anderson CL, Shen L, Eicher DM, Wewers MD, Gill JK.
Phagocytosis mediated by three distinct Fc receptor classes on human leukocytes.
J Exp Med.
1990;71:1333.
31.
Edberg JC, Kimberly RP.
Modulation of Fc and complement receptor function by the glycosyl-phosphatidylinositol-anchored form of FcRIII.
J Immunol.
1994;152:5826[Abstract].
32.
Springer TA.
Adhesion receptors of the immune system.
Nature.
1990;346:425[Medline]
[Order article via Infotrieve].
33.
Hynes RO.
Integrins: versatility, modulation, and signalling in cell adhesion.
Cell.
1992;69:11[Medline]
[Order article via Infotrieve].
34.
Graham IL, Gresham HD, Brown EJ.
An immobile subset of plasma membrane CD11b/CD18 (Mac-1) is involved in phagocytosis of targets recognized by multiple receptors.
J Immunol.
1989;142:2352[Abstract].
35.
Kusunoki T, Tsuruta S, Higashi H, et al.
Involvement of CD11b/CD18 in enhanced neutrophil adhesion by Fc receptor stimulation.
J Leukoc Biol.
1994;5:735.
36.
Miller LJ, Bainton DF, Borregaard N, Springer TA.
Stimulated mobilization of monocyte MAC-1 and P150,95 adhesion proteins from an intracellular vesicular compartment to the cell surface.
J Clin Invest.
1987;80:535.
37.
Huizinga TWJ, Van Der Schoot CE, Jost C, et al.
The PI-linked receptor FcRIII is released on stimulation of neutrophils.
Nature.
1988;333:667[Medline]
[Order article via Infotrieve].
38.
Huizinga TW, Kerst M, Nuyens JH, et al.
Binding characteristics of dimeric IgG subclass complexes to human neutrophils.
J Immunol.
1989;142:2359[Abstract].
39.
Warmerdam PAM, Parren PWHI, Vlug A, Aarden LA, Van de Winkel JGJ, Capel PJA.
Polymorphism of the human Fc receptor II (CD32): molecular basis and functional aspects.
Immunobiology.
1992;185:175[Medline]
[Order article via Infotrieve].
40.
Stroncek DF, Skubitz KM, Plachta LB, et al.
Alloimmune neonatal neutropenia due to an antibody to the neutrophil Fcgamma receptor III with maternal deficiency of CD16 antigen.
Blood.
1991;77:1572[Abstract/Free Full Text].
41.
Fearon DT, Collins LA.
Increased expression of C3b receptors on polymorphonuclear leukocytes induced by chemotactic factors and by purification procedures.
J Immunol.
1983;130:370[Medline]
[Order article via Infotrieve].
42.
Forsyth KD, Levinsky RJ.
Preparative procedures of cooling and re-warming increase leukocyte integrin expression and function on neutrophils.
J Immunol Methods.
1990;128:159[Medline]
[Order article via Infotrieve].
43.
Macey MG, Jiang XP, Veys P, McCarthy D, Newland AC.
Expression of functional antigens on neutrophils: effects of preparation.
J Immunol Methods.
1992;149:37[Medline]
[Order article via Infotrieve].
44.
Southwick FS, Dabiri GA, Paschetto M, Zigmond SH.
Polymorphonuclear leukocytes adherence induces actin polymerization by a transduction pathway which differs from that used by chemoattractants.
J Cell Biol.
1989;109:1561[Abstract/Free Full Text].
45.
Tax WJM, Van de Winkel JGJ.
Human Fc receptor II: a standby receptor activated by proteolysis?
Immunol Today.
1990;11:308[Medline]
[Order article via Infotrieve].
46.
Debets JMH, Van de Winkel JGJ, Cueppens JL, Dieteren IEM, Buurman WA.
Cross-linking of both FcRI and FcRII induces secretion of tumor necrosis by human monocytes requiring high affinity Fc-FcR interactions.
J Immunol.
1990;144:1304[Abstract].
47.
Van de Winkel JGJ, Jansze M, Capel PJA.
Effect of protease inhibitors on human monocyte IgG Fc receptor II: evidence that serine esterase activity is essential for FcRII-mediated binding.
J Immunol.
1990;145:1890[Abstract].
48.
Trevani AS, Andonegui GA, Istruriz MA, Schatner M, Serebrinsky G, Gefner JR.
Effect of proteolytic enzymes on neutrophil FcRII activity.
Immunology.
1994;82:632[Medline]
[Order article via Infotrieve].
49.
Ross GD, Reed W, Dalzell JG, Becker SE, Hogg N.
Macrophage cytoskeleton association with CR3 and CR4 regulates receptor mobility and phagocytosis of iC3b-opsonized erythrocytes.
J Leukoc Biol.
1992;51:109[Abstract].
50.
Brown EJ, Bohnsack JF, Gresham HD.
Mechanism of inhibition of immunoglobulin G-mediated phagocytosis by monoclonal antibodies that recognize the Mac-1 antigen.
J Clin Invest.
1988;81:365.
51.
Zhou M-J, Brown EJ.
CR3 (Mac-1, amb2, CD11b/CD18) and FcRIII cooperate in generation of a neutrophil respiratory burst: requirement for FcRII and tyrosine phosphorylation.
J Cell Biol.
1994;125:1407[Abstract/Free Full Text].
52.
Krauss JC, Poo H, Xue W, Mayo-Bond L, Todd RF, Petty HR.
Reconstitution of antibody-dependent phagocytosis in fibroblasts expressing Fc gamma recepter IIIB and the complement receptor type 3.
J Immunol.
1994;153:1769[Abstract].
53.
Todd RF III, Petty HR.
b2(CD11/CD18) integrins can serve as signaling partners for other leukocyte receptors.
J Lab Clin Med.
1997;129:492[Medline]
[Order article via Infotrieve].
54.
Dustin ML, Springer TA.
T cell receptor cross-linking transiently stimulates adhesiveness through LFA-1.
Nature.
1989;341:619[Medline]
[Order article via Infotrieve].
55.
Larson RS, Hibbs ML, Springer TA.
The leukocyte integrin LFA-1 reconstituted by cDNA transfection in a nonhematopoietic cell line is functionally active and not transiently regulated.
Cell Regul.
1990;1:359[Medline]
[Order article via Infotrieve].
56.
Laszlo G, Dickler HB.
Alterations of lymphocyte Fc-gammaR II expression and ligand binding capacity induced by various activators.
Cell Immunol.
1991;137:24[Medline]
[Order article via Infotrieve].
57.
Hundt M, Schmidt RE.
The glycosylphosphatidylinositol-linked Fc receptor III represents the dominant receptor structure for immune complex activation of neutrophils.
Eur J Immunol.
1992;22:811[Medline]
[Order article via Infotrieve].
58.
Huizinga TWJ, Kerst M, Nuyens JH, et al.
Binding characteristics of dimeric IgG subclass complexes to human neutrophils.
J Immunol.
1989;142:2359.
59.
Salmon JE, Brogle NL, Edberg JC, Kimberly RP.
Fc receptor III induces actin polymerization in human neutrophils and primes phagocytosis mediated by Fc receptor II.
J Immunol.
1991;146:997[Abstract].
60.
Salmon JE, Millard SS, Brogle NL, Kimberly RP.
Fc receptor IIIb enhances Fc receptor IIa function in an oxidant-dependent and allele-sensitive manner.
J Clin Invest.
1995;95:2877.
61.
Fromont P, Bettaieb A, Skouri H, et al.
Frequency of polymorphonuclear neutrophil Fc receptor III deficiency in the French population and its involvement in the development of neonatal alloimmune neutropenia.
Blood.
1992;79:2131[Abstract/Free Full Text].
62.
Enenkel B, Jung D, Frey J.
Molecular basis of IgG Fc receptor III defect in a patient with systemic lupus erythematosus.
Eur J Immunol.
1991;21:659[Medline]
[Order article via Infotrieve].
63.
Lanier LL, Phillips JH, Testi R.
Membrane anchoring and spontaneous release of CD16 (FcR III) by natural killer cells and granulocytes.
Eur J Immunol.
1989;19:775[Medline]
[Order article via Infotrieve].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
D. Rusu, R. Drouin, Y. Pouliot, S. Gauthier, and P. E. Poubelle
A Bovine Whey Protein Extract Can Enhance Innate Immunity by Priming Normal Human Blood Neutrophils
J. Nutr.,
February 1, 2009;
139(2):
386 - 393.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. O. Richards, S. Karki, G. A. Lazar, H. Chen, W. Dang, and J. R. Desjarlais
Optimization of antibody binding to Fc{gamma}RIIa enhances macrophage phagocytosis of tumor cells
Mol. Cancer Ther.,
August 1, 2008;
7(8):
2517 - 2527.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Lauterbach, P. O'Donnell, K. Asano, and T. N. Mayadas
Role of TNF priming and adhesion molecules in neutrophil recruitment to intravascular immune complexes
J. Leukoc. Biol.,
June 1, 2008;
83(6):
1423 - 1430.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Utomo, J. Hirahashi, D. Mekala, K. Asano, M. Glogauer, X. Cullere, and T. N. Mayadas
Requirement for Vav Proteins in Post-Recruitment Neutrophil Cytotoxicity in IgG but Not Complement C3-Dependent Injury
J. Immunol.,
May 1, 2008;
180(9):
6279 - 6287.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Shashidharamurthy, R. A. Hennigar, S. Fuchs, P. Palaniswami, M. Sherman, and P. Selvaraj
Extravasations and emigration of neutrophils to the inflammatory site depend on the interaction of immune-complex with Fc{gamma} receptors and can be effectively blocked by decoy Fc{gamma} receptors
Blood,
January 15, 2008;
111(2):
894 - 904.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Nagarajan, N. H. Fifadara, and P. Selvaraj
Signal-Specific Activation and Regulation of Human Neutrophil Fc{gamma} Receptors
J. Immunol.,
May 1, 2005;
174(9):
5423 - 5432.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Hewins, J. M. Williams, M. J.O. Wakelam, and C. O.S. Savage
Activation of Syk in Neutrophils by Antineutrophil Cytoplasm Antibodies Occurs via Fc{gamma} Receptors and CD18
J. Am. Soc. Nephrol.,
March 1, 2004;
15(3):
796 - 808.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction