|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 95 No. 3 (February 1), 2000:
pp. 992-998
NEOPLASIA
From the Princess Margaret Hospital, Toronto, Ontario, Canada; and
Weill Medical College, Cornell University Medical School, New York, NY.
The t(4;14) translocation occurs in 25% of multiple myeloma (MM)
and results in both the ectopic expression of fibroblast growth factor
receptor 3 (FGFR3) from der4 and immunoglobulin heavy chain-MMSET
hybrid messenger RNA transcripts from der14. The subsequent selection
of activating mutations of the translocated FGFR3 by MM cells
indicates an important role for this signaling pathway in tumor
development and progression. To investigate the mechanism by which
FGFR3 overexpression promotes MM development, interleukin-6
(IL-6)-dependent murine B9 cells were transduced with retroviruses
expressing functional wild-type or constitutively activated mutant
FGFR3. Overexpression of mutant FGFR3 resulted in IL-6 independence,
decreased apoptosis, and an enhanced proliferative response to IL-6. In
the presence of ligand, wild-type FGFR3-expressing cells also exhibited
enhanced proliferation and survival in comparison to
controls. B9 clones expressing either wild-type FGFR3 at high levels or
mutant FGFR3 displayed increased phosphorylation of STAT3 and higher
levels of bcl-xL expression than did parental B9 cells
after cytokine withdrawal. The mechanism of the enhanced cell
responsiveness to IL-6 is unknown at this time, but does not
appear to be mediated by the mitogen-activated protein kinases SAPK,
p38, or ERK. These findings provide a rational explanation for the
mechanism by which FGFR3 contributes to both the viability and
propagation of the myeloma clone and provide a basis for the development of therapies targeting this pathway.
(Blood. 2000;95:992-998)
Multiple myeloma (MM) is a terminally differentiated
and uniformly fatal B-cell malignancy that accounts for 10% of all
hematopoietic neoplasms.1 The pleotropic cytokine
interleukin-6 (IL-6) plays a central role in disease pathobiology as
the major myeloma growth factor. Accumulated data suggest that IL-6
contributes to both the viability and proliferation of the malignant
clone2-4 in which the mitogenic signal is probably
transmitted through the mitogen-activated protein kinase (MAPK)
pathway, particularly via ERK25 and the anti-apoptotic
signal through the Jak-STAT pathway.6,7 Mechanisms by which
IL-6 regulates myeloma cell survival include the up-regulation of an
anti-apoptotic gene, bcl-xL8, and the down-regulation of SAPK in response to cell death stimuli.9 Nevertheless, the mechanism by which IL-6 signaling becomes
dysregulated in myeloma remains unknown.
In this regard we and others have previously reported that
translocations into the immunoglobulin heavy (IgH) chain switch region
are ubiquitous in MM cells.10-18 These translocations
involve several heterogeneous translocation partners, including
c-myc,10 MUM1/IRF4,11
cyclin D1,12 c-maf,13 and
FGFR3/MMSET.14,15,18 These recurrent translocations
have been identified with a similar high frequency in primary patient
samples by reverse transcriptase (RT)-polymerase chain
reaction,14 dual color interphase fluorescence in situ
hybridization,17 and multicolor spectral
karyotypes.16 They are present in patients with monoclonal
gammopathy of undetermined significance (MGUS),14 and we
hypothesize that these translocations are an early event in the
development of MGUS or MM.
FGFR3 is a receptor tyrosine kinase normally expressed in cartilage,
the central nervous system, and the brain. Mice lacking the wild-type
gene develop an overgrowth of the long bones,19,20 suggesting that this gene normally negatively regulates bone growth. In
humans, activating mutations of FGFR3 cause various forms of dwarfism
when the mutations arise within the germline.21-23
Interestingly, some of the same activating mutations of FGFR3
known to cause dwarfism have been found to be involved in the IgH
translocations of MM. We have previously identified activating
mutations of FGFR3 in 3 of 6 cell lines and in 1 of 3 primary
patient samples.14 One identified mutation results in
ligand-independent activation of the receptor and is known to
cause thanatophoric dysplasia type 2 (TD II) when it arises
in the germline.24
Currently, the consequences of translocated wild-type FGFR3 or
constitutively active forms of FGFR3 on MM cells are unknown. We postulated that inappropriate expression of FGFR3 by illegitimate isotype switch recombination would enable myeloma cells to
phosphorylate STATs as previously reported in
chondrocytes.25,26 We also reasoned that one of the
downstream targets of STATs was bcl-xL, as we have
previously shown that IL-6, via gp130, causes bcl-xL up-regulation,8 and because leukemia inhibitory factor
(LIF) signaling through gp130 up-regulates
bcl-xL via STAT1 in cardiac myocytes.27 We
report here the results of the investigation of this hypothesis.
Retroviral vector construction
Retrovirus production
Generation of B9 lines expressing wild-type FGFR3 and FGFR3-TD mutant Supernatant from the G418 selected GP+E producer lines was added to B9 cells along with 2% IL-6 conditioned media from the SP2/mIL-6 cell line31 and 8 µg/mL of polybrene (Sigma). After 2 days, fresh retroviral supernatant was added. After an additional 72 hours of incubation, B9 cells were selected in 2% IL-6 conditioned medium and 1.2 mg/mL G418 for 2 weeks, generating the cell lines B9-MINV (empty vector), B9-WT (wild-type FGFR3), and B9-TD (TD II mutant form of FGFR3). After selecting for stably transduced cells, a limiting cell dilution was performed to generate single-cell clones of B9-WT and B9-TD. Subsequent Western blot analysis used individual high- or low-expressing clones of B9-WT and B9-TD.Tissue culture Cells were cultured at 37°C in a humidified atmosphere containing 5% CO2. B9 cells were grown in IMDM supplemented with 5% FCS, 2% IL-6 conditioned medium, and penicillin-streptomycin (Gibco). KMS11, a human myeloma cell line containing an FGFR3 translocation, was kindly provided by Masayoshi Namba (Okayama, Japan). KMS11 was grown in RPMI Medium 1640 supplemented with 10% FCS and penicillin-streptomycin. U266, a human myeloma cell line, was grown in IMDM with 10% FCS. GP+E and PA317 cells were grown in Dulbecco modified Eagle medium supplemented with 10% FCS and penicillin-streptomycin.Cell viability and proliferation To examine cell viability and proliferation, B9, B9-MINV, B9-WT, and B9-TD were washed 4 times in IMDM without FCS and then plated in triplicate in a 96-well plate at a density of 1 × 104 cells/well in varying concentrations of IL-6 and cultured for 48-96 hours. Total cell number and percent viability were determined every 24 hours by trypan blue staining and enumeration with a hemocytometer. For proliferation assays, 0.5 µCi of 3H-thymidine (Amersham, Arlington Heights, IL) was added to each well in the last 18 hours of the assay. Cells were harvested onto glass filter paper (Gelman Science, Ann Arbor, MI), and 3H-thymidine counts determined by liquid scintillation.Ligand stimulated proliferation assay B9-WT cells were plated at a concentration of 2 × 105 cells/mL in a 96-well plate in the presence of increasing concentrations of acidic fibroblast growth factor (aFGF) (R&D Labs, Minneapolis, MN) and heparin (Sigma). Cells were subsequently incubated for 2 or 3 days and then analyzed with the use of the chromogenic dye 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Boehringer Mannheim, Mannheim, Germany). Absorbance at 570 nm-650 nm was read on an enzyme-linked immunosorbent assay plate reader (Molecular Devices, Sunnyvale, CA). After optimal concentrations of aFGF (40 ng/mL) and heparin (30 µg/mL) for the support of cell proliferation were determined, B9, B9-MINV, B9-WT, and B9-TD were washed four times in IMDM lacking FCS and plated in triplicate at a concentration of 2 × 105 cells/mL in 96-well plates. Each cell line was analyzed under 4 different conditions: 40 ng/mL aFGF and 30 µg/mL of heparin, 40 ng/mL aFGF and 30 µg/mL of heparin plus 2% IL-6, 2% IL-6 without ligand, and 0% IL-6 without ligand. Cells were incubated for 48-72 hours and then analyzed by MTT.Cell cycle and apoptosis analysis Cell lines were washed and then plated in IMDM plus 5% FCS at a density of 0.5 × 106 in 0% IL-6 or 0.1 × 106 in the presence of IL-6. Cells were cultured for 48 or 72 hours. After harvesting the cells, 500 µL of a hypotonic fluorochrome solution (0.1% sodium citrate, 0.1% Triton X-100, 50 µg/mL of propidium iodide) was added to each cell pellet. The samples were incubated overnight in the dark at 4°C. Flow cytometry was performed on a FACScan (Becton Dickinson, Meylan, France) the following day, using Cell Quest software to acquire data and ModFit LT software for analysis. Tunel assays (Promega, Madison, WI) were performed according to the manufacturer's protocol. In brief, 4 × 106 cells were fixed with 1% paraformaldehyde for 20 minutes on ice. Cells were incubated at 37°C for 1 hour with terminal deoxynucleotidyl transferase (TdT) enzyme and nucleotide mix containing fluorescein-12-dUTP to end label the 3'OH end of the fragmented DNA. The reaction was ceased by addition of 20 mM ethylenediaminetetraacetic acid, and cells were washed twice in 0.1% Triton X-100 and stained with propidium iodide for 30 minutes. Analysis was performed by flow cytometry, and apoptotic cells were fluorescein-12-dUTP positive.Western blots Western blot analysis was carried out according to previously published procedures.32 Membranes were probed with antibodies to the C-terminus end of FGFR3, to murine bcl-xS/L, to murine bcl-2, to murine bax, anti-phosphotyrosine (all Santa Cruz Biotechnology, Santa Cruz, CA), anti-phospho-STAT1 (Upstate Biotechnology, Lake Placid, NY), anti-STAT3 and anti-STAT1 (Transduction Laboratories, Lexington, KY), or with polyclonal rabbit anti-phospho-STAT1/STAT5, anti-phospho-STAT5, anti-phospho-STAT3 (all 3 kindly provided by David A. Frank, Dana-Farber Cancer Institute, Boston, MA), and anti-STAT5 (kindly provided by Dr J. N. Ihle, Memphis, IN). Goat antirabbit IgG horseradish peroxidase (PharMingen, Mississauga, ON) or sheep antimouse IgG horseradish peroxidase (Amersham, Arlington Heights, IL) were used as secondary antibodies, and blots were developed by enhanced chemiluminescence (Amersham) according to manufacturer's instructions.Electrophoretic mobility shift assay (EMSA) EMSA was carried out as previously described.33 After generation of nuclear lysates from cells stimulated with and without IL-6, the gel shift assays were performed with the use of double-stranded 32P-labeled oligonucleotide derived from the IRF-1 promoter (CTGATTTCCCCGAAATGAC).34 Five micrograms of nuclear lysates was incubated with 0.25 ng of 32P-labeled oligonucleotide in 20 µL of binding buffer,13 mmol/L HEPES (pH 7.9; 65 mmol/L NaCl, 1 mmol/L DTT, 15 mmol/L ethylenediaminetetraacetic acid, 8% glycerol, 50 µg of poly (dI-dC)/mL) for 15 minutes at 4°C. For competition experiments, 50-fold molar excess of either unlabeled IRF-1 or an oligonucleotide derived from T14 promoter (TTCTTGAGGTAATGAAAGCC)35 was added to the binding reaction. For supershifting experiments, a peptide-specific STAT3 (Zymed, San Francisco, CA) was added at the completion of the binding reaction and incubated for an additional 30 minutes at 4°C.Immunoprecipitation and in vitro kinase assay Immunoprecipitation and in vitro kinase assay were carried out as previously described.32 Twenty-five microliters/reaction of 20% (v/v) Protein-A Sepharose (Pharmacia, Uppsala, Sweden) was incubated with 12 µL of anti-FGFR3, anti-ERK1 (recognizes ERK1 and ERK2), anti-p38, or anti-JNK1 (SAPK) (all from Santa Cruz Biotechnology) overnight at 4°C; 1250 µg of total cell lysate was incubated with the bead complex for 2 hours at 4°C. Immunoprecipitates were split into equal aliquots. One aliquot was washed 4 times with kinase buffer and subjected to in vitro kinase assay. The other aliquot was subjected to standard Western blotting procedure, probing the membranes with anti-FGFR3, ERK1, p38, or JNK1 (SAPK).
Human FGFR3 is functional in transduced B9 cells Western blots confirmed varying levels of expression of FGFR3 in the transduced B9-WT (Figure 1A) and B9-TD (Figure 1B) lines and subclones. An in vitro kinase assay demonstrated that both wild-type and FGFR3-TD lines were capable of autophosphorylation (Figure 2). Phosphotyrosine Western blots further demonstrated that FGFR3 was phosphorylated only in the absence of ligand within the B9-TD line, thus indicating that the mutant receptor possessed constitutive tyrosine kinase activity. On addition of ligand, aFGF, and heparin, phosphorylation of wild-type FGFR3 was induced in B9-WT (not shown).
FGFR3 overexpression can substitute for IL-6 receptor signaling We first asked if overexpression of FGFR3 would influence IL-6- induced proliferation of B9 cells. Parental B9, B9-MINV, and pooled B9-WT cells had a similar rate of proliferation at all concentrations of IL-6 as assessed by 3H-thymidine incorporation. However, the proliferative rate of pooled B9-TD cells expressing mutant FGFR3 was higher than that for the other 3 cell lines at all concentrations of IL-6 (Figure 3). Two days after withdrawal of IL-6, B9, B9-MINV, B9-WT, and B9-TD, cells were 30%, 16%, 44%, and 75% viable, respectively. After 4 days of cytokine starvation, there were 6 times more viable cells in B9-TD culture than for the other lines, and, unlike the parental B9 cell line, B9-TD cells could be maintained indefinitely in the absence of IL-6. Thus, activated FGFR3 enhanced cell proliferation in response to IL-6 and could substitute for the absolute dependence of B9 cells on IL-6. Because many myelomas do not immediately acquire FGFR3 mutation, we next examined the response of cells expressing the wild-type or mutant protein to the addition of the aFGF ligand. On ligand stimulation of IL-6-starved cells, B9-WT proliferation was greater than that seen for parental B9 and B9-MINV cells, and the already increased proliferation of B9-TD cells was further enhanced (Figure 4). Some B9-WT clones expressing the highest levels of FGFR3 (eg, clone #3 and clone #6) also exhibited IL-6 independence. These data together demonstrate an enhanced responsiveness of FGFR3-expressing cells to IL-6 stimulation and the acquisition of IL-6 independence proportional to the degree of activation of FGFR3.
Signaling by FGFR3 decreases apoptosis in the absence of IL-6 The mechanism of enhanced survival of B9-TD cells in the absence of IL-6 and ligand was next examined. There was little difference in the cell-cycle status of B9, B9-WT, and B9-TD in the presence or absence of IL-6. It was noted, however, that B9-TD cells had fewer sub-G0 apoptotic cells in the absence of IL-6 and ligand than did either controls or B9-WT. Indeed, with the use of a Tunel assay, the vast majority of parental B9 cells were apoptotic 5 days after withdrawal of IL-6, whereas only 53% of pooled B9-TD cells were undergoing apoptosis (Table 1). B9-MINV and pooled B9-WT had between 85% and 88% apoptotic cells in the absence of IL-6 and ligand. These data demonstrate that activated FGFR3 prevents apoptosis of IL-6-dependent cells in the absence of IL-6.
FGFR3 signaling induces phosphorylation of STAT3 Because the STATs are a key mediator of cytokine signaling, Western blot analysis was performed with the use of antibodies that bind to tyrosine phosphorylated STAT1, STAT3, or STAT5. STAT5 was phosphorylated in all cell lines independent of the presence or absence of IL-6 and was not further activated by FGFR3. STAT1 and STAT3 were phosphorylated in all of the cell lines after IL-6 stimulation. However, STAT3 was also constitutively phosphorylated (in the absence of IL-6) in both B9-WT clones expressing high levels of FGFR3 and in B9-TD cells (Figure 5). To confirm that STAT3 was constitutively activated in cells expressing high levels of wild-type FGFR3 or mutant FGFR3, EMSAs were performed. In the absence of IL-6 stimulation, both B9-WT and B9-TD cells displayed a protein-DNA complex that was only present in parental B9 cells in the presence of IL-6 (Figure 6). This complex could be competed with an excess of unlabeled IRF-1 but was not affected by a molar excess of nonspecific oligonucleotide. It was demonstrated that the complex contained STAT3 because a peptide-specific STAT3 antibody could supershift the complex in B9-TD cells.
FGFR3 survival signal is mediated by up-regulation of bcl-xL Because we have previously shown that the IL-6 survival signal in myeloma is mediated by up-regulation of bcl-xL,8 we next examined the expression of this protein by Western blots and demonstrated that the baseline level of bcl-xL is higher in B9-TD cells expressing constitutively activated FGFR3 than in B9 controls (Figure 7A). With the withdrawal of IL-6 from B9 or B9-MINV control cells, there is a decrease in the amount of bcl-xL protein over 48 hours. In contrast, the expression of bcl-xL in B9-TD clones remained relatively constant after the withdrawal of IL-6 from the culture medium. Some B9-WT clones expressing high levels of FGFR3 also exhibit a marked increase in baseline expression of bcl-xL (Figure 7B). Of interest, the addition of ligand actually decreases bcl-xL expression in B9-WT clones, perhaps because of down-regulation of the receptor.
Enhanced proliferative response to IL-6 is not mediated by MAP kinases Although overexpression of bcl-xL may explain the enhanced survival of B9 cells overexpressing FGFR3, it does not explain the enhanced proliferative rate of the transduced cell lines in response to IL-6. Because cytokines not only activate the JAK-STAT signaling pathway but also function to phosphorylate members of the MAPK family, we next examined ERK-, p38-, and SAPK-induced activation. Although p38 was induced by IL-6, no change in SAPK, ERK1, ERK2, or p38 activity was noted in the FGFR3-expressing cell lines (not shown). Thus, the mechanism of enhanced IL-6 responsiveness in FGFR3-expressing cells remains unknown.
The t(4;14) translocation occurs in approximately 25% of MM cell lines and patient samples and results in the ectopic expression of FGFR3 from the der1414 and IgH-MMSET hybrid messenger RNA transcripts from the der4.18 Furthermore, activating mutations of the translocated FGFR3 have been identified in some myeloma samples, indicating an important role for the FGFR3 signaling pathway in these cases.14 One such activating mutant of FGFR3 is known to cause TD II, a severe form of human dwarfism, when the mutation arises in the germline.21,22 Prior investigation of the role of FGFR3 in dwarfism has demonstrated that such mutations result in constitutive activation of the receptor independent of ligand.23,24 This activation leads to phosphorylation and translocation of STAT1 to the nucleus followed by up-regulation of the cell cycle regulator p21, resulting in growth arrest in chondrocytes.25 In a related TD I mutation of FGFR3, STAT1 is also activated, along with the MAPK pathway, with a resulting increase in apoptosis secondary to increased levels of bax and decreased bcl-2.26 The net effect of these mutations in human chondrocytes is, therefore, growth arrest and cell apoptosis, explaining the chondrocyte growth arrest viewed clinically. Clearly, such changes would not explain why activation of FGFR3 promotes the growth or development of MM cells.
We are grateful to Dr Brent Zanke and Dr Ian Dubé for advice, as well as to Nathan Faliconi, Fawzy Saad, Darrin Cappe, Meenakshi Bali, and Christine Dodgson for technical assistance.
Submitted March 16, 1999; accepted September 11, 1999.
Supported by funds from MRC of Canada and the Nelson Arthur Hyland Foundation.
Reprints: A. Keith Stewart, Department of Medical Hematology-Oncology, 5th Floor Room 126, The Princess Margaret Hospital, 610 University Ave, Toronto, Ontario M5G 2M9; e-mail: k.stewart{at}utoronto.ca.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1. Malpas J, Bergsagel DE, Kyle RA. Myeloma: Biology and Management. Oxford, England: Oxford University Press; 1998.
2.
Klein B, Zhang X, Lu Z, Bataille R.
Interleukin-6 in human multiple myeloma.
Blood.
1995;85:863-872 3. Sabourin LA, Hawley RG. Suppression of programmed death and G1 arrest in B-cell hybridomas by interleukin-6 is not accompanied by altered gene expression of immediate early response genes. J Cell Physiol. 1990;145:564-574[Medline] [Order article via Infotrieve]. 4. Kawano M, Hirano T, Matsuda T, et al. Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature. 1988;332:83-85[Medline] [Order article via Infotrieve].
5.
Berger LC, Hawley RG.
Interferon- 6. Fukada T, Hibi M, Yamanaka Y, et al. Two signals are necessary for cell proliferation induced by a cytokine receptor gp130: involvement of STAT3 in anti-apoptosis. Immunity. 1996;5:449-460[Medline] [Order article via Infotrieve].
7.
Ogata A, Chauhan D, Teoh G, et al.
IL-6 triggers cell growth via the ras-dependent mitogen-activated protein kinase cascade.
J Immunol.
1997;159:2212-2221
8.
Schwarze MMK, Hawley RG.
Prevention of myeloma cell apoptosis by ectopic bcl-2 expression or interleukin 6-mediated up-regulation of bcl-xL.
Cancer Res.
1995;55:2262-2265
9.
Xu F, Sharma S, Gardner A, et al.
Interleukin-6-induced inhibition of multiple myeloma cell apoptosis: support for the hypothesis that protection is mediated via inhibition of the JNK/SAPK pathway.
Blood.
1998;92:241-251
10.
Bergsagel PL, Chesi M, Nardini E, Brents LA, Kirby SL, Kuehl WM.
Promiscuous translocations into immunoglobulin heavy chain switch regions in multiple myeloma.
Proc Natl Sci Acad U S A.
1996;93:13,931-13,936 11. Iida S, Rao PH, Butler M, et al. Deregulation of MUM1/IRF4 by chromosomal translocation in multiple myeloma. Nat Genet. 1997;17:226-230[Medline] [Order article via Infotrieve].
12.
Chesi M, Bergsagel PL, Brents LA, Smith CM, Gerhard DS, Kuehl WM.
Dysregulation of cyclin D1 by translocation into an IgH gamma switch region in two multiple myeloma cell lines.
Blood.
1996;88:674-681
13.
Chesi M, Bergsagel PL, Shonukan OO, et al.
Frequent dysregulation of the c-maf proto-oncogene at 16q23 by translocation to an Ig locus in multiple myeloma.
Blood.
1998;91:4457-4463 14. Chesi M, Nardini E, Brents LA, et al. Frequent translocation t(4;14)(p16.3;q32.3) in multiple myeloma is associated with increased expression and activating mutations of fibroblast growth factor receptor 3. Nat Genet. 1997;16:260-264[Medline] [Order article via Infotrieve].
15.
Avet-Loiseau H, Li JY, Facon T, et al.
High incidence of translocations t(11;14)(q13;q32) and t(4;14)(p16;q32) in patients with plasma cell malignancies.
Cancer Res.
1998;58:5640-5645
16.
Sawyer JR, Lukacs JL, Munshi N, et al.
Identification of new nonrandom translocations in multiple myeloma with multicolor spectral karyotyping.
Blood.
1998;92:4269-4278
17.
Nishida K, Tamura A, Nakazawa N, et al.
The Ig heavy chain gene is frequently involved in chromosomal translocations in multiple myeloma and plasma cell leukemia as detected by in situ hybridization.
Blood.
1997;90:526-534
18.
Chesi M, Nardini E, Lin RSC, Smith KD, Kuehl WM, Bergsagel PL.
The t(4;14) translocation in myeloma dysregulates both FGFR3 and a novel gene, MMSET, resulting in IgH/MMSET hybrid transcripts.
Blood.
1998;92:3025-3034 19. Deng C, Wynshaw-Boris A, Zhou F, Kuo A, Leder P. Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell. 1996;84:911-921[Medline] [Order article via Infotrieve]. 20. Colvin JS, Bohne BA, Harding GW, McEwan DG, Ornitz DM. Skeletal overgrowth and deafness in mice lacking fibroblast growth factor receptor 3. Nat Genet. 1996;12:390-397[Medline] [Order article via Infotrieve]. 21. Tavormina PL, Shiang R, Thompson LM, et al. Thanatophoric dysplasia (types I and II) caused by distinct mutations in fibroblast growth factor receptor 3. Nat Genet. 1995;9:321-328[Medline] [Order article via Infotrieve]. 22. Bonaventure J, Rousseau F, Legeai-Mallet L, Le Merrer M, Munnich A, Maroteaux P. Common mutations in the fibroblast growth factor receptor 3 (FGFR 3) gene account for achondroplasia, hypochondroplasia, and thanatophoric dwarfism. Am J Med Genet. 1996;63:148-154[Medline] [Order article via Infotrieve]. 23. Naski MC, Wang Q, Xu J, Ornitz DM. Graded activation of fibroblast growth factor receptor 3 by mutations causing achondroplasia and thanatophoric dysplasia. Nat Genet. 1996;13:233-237[Medline] [Order article via Infotrieve]. 24. Webster MK, D'Avis PY, Robertson SC, Donoghue DJ. Profound ligand-independent kinase activation of fibroblast growth factor receptor 3 by the activation loop mutation responsible for a lethal skeletal dysplasia, thanatophoric dysplasia type II. Mol Cell Biol. 1996;16:4081-4087[Abstract]. 25. Su WS, Kitagawa M, Xue N, et al. Activation of Stat1 by mutant fibroblast growth-factor receptor in thanatophoric dysplasia type II dwarfism. Nature. 1997;386:288-292[Medline] [Order article via Infotrieve].
26.
Legeai-Mallet L, Benoist-Lasselin C, Delezoide A, Munnich A, Bonaventure J.
Fibroblast growth factor receptor 3 mutations promote apoptosis but do not alter chondrocyte proliferation in thanatophoric dysplasia.
J Biol Chem.
1998;273:13,007-13,014 27. Fujio Y, Kunisada K, Hirota H, Yamauchi-Takihara K, Kishimoto T. Signals through gp130 upregulate bcl-x gene expression via STAT1-binding cis-element in cardiac myocytes. J Clin Invest. 1997;99:2898-2905[Medline] [Order article via Infotrieve]. 28. Hawley RG, Lieu FHL, Fong AZC, Goldman SJ, Leonard JP, Hawley TS. Retroviral vectors for production of interleukin-12 in the bone marrow to induce graft-verus-leukemia effect. Ann N Y Acad Sci. 1996;795:341-345[Medline] [Order article via Infotrieve].
29.
Miller AD, Buttimore C.
Redesign of retrovirus packaging cell lines to avoid recombination leading to helper virus production.
Mol Cell Biol.
1986;6:2895-2902
30.
Markowitz D, Goff S, Bank A.
A safe packaging line for gene transfer: separating viral genes on two different plasmids.
J Virol.
1988;62:1120-1124 31. Harris JF, Hawley RG, Hawley TS, Crawford-Sharpe GC. Increased frequency of both total and specific monoclonal antibody producing hybridomas using a fusion partner that constitutively expresses recombinant IL-6. J Immunol Methods. 1992;148:199-207[Medline] [Order article via Infotrieve]. 32. Branch DR, Mills GB. pp60c-src expression is induced by activation of normal human T lymphocytes. J Immunol. 1995;154:3678-3685[Abstract]. 33. Ho JMY, Beattie BK, Squire JA, Frank DA, Barber DL. Fusion of the ets transcription factor TEL to Jak2 results in constitutive Jak-Stat signaling. Blood. 1999;12:4354-4364. 34. Pine R, Canova A, Schindler C. Tyrosine phosphorylated p91 binds to a single element in the ISGF2/IRF-1 promoter to mediate induction by IFN alpha and IFN gamma, and is likely to autoregulate the p91 gene. EMBO J. 1994;13:158-167[Medline] [Order article via Infotrieve]. 35. Jaster R, Zhu Y, Pless M, Bhattacharya S, Mathey-Prevot B, D'Andrea AD. JAK2 is required for induction of the murine DUB-1 gene. Mol Cell Biol. 1997;17:3364-3372[Abstract]. 36. Fukada T, Ohtani T, Yoshida Y, et al. STAT3 orchestrates contradictory signals in cytokine-induced G1 to S cell-cycle transition. EMBO J. 1998;17:6670-6677[Medline] [Order article via Infotrieve]. 37. Catlett-Falcone R, Landowski TH, Oshiro MM, et al. Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. Immunity. 1999;10:105-115[Medline] [Order article via Infotrieve]. 38. Zushi S, Shinomura Y, Kiyohara T, et al. STAT3 mediates the survival signal in oncogenic ras-transfected intestinal epithelial cells. Int J Cancer. 1998;78:326-330[Medline] [Order article via Infotrieve].
39.
Kanai M, Goke M, Tsunekawa S, Podolsky DK.
Signal transduction pathway of human fibroblast growth factor receptor 3: identification of a novel 66-kDa phosphoprotein.
J Biol Chem.
1997;272:6621-6628 40. Tan Y, Rouse J, Zhang A, Cariati S, Cohen P, Comb MJ. FGF and stress regulate CREB and ATF-1 via a pathway involving p38 MAP kinase and MAPKAP kinase-2. EMBO J. 1996;15:4629-4642[Medline] [Order article via Infotrieve].
41.
Fracchiolla NS, Luminari S, Baldini L, Lombardi L, Maiolo AT, Neri A.
FGFR3 gene mutations associated with human skeletal disorders occur rarely in multiple myeloma.
Blood.
1998;92:2987-2989
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  M. GUAN, L. ZHU, G. SOMLO, A. HUGHES, B. ZHOU, and Y. YEN Bortezomib Therapeutic Effect is Associated with Expression of FGFR3 in Multiple Myeloma Cells Anticancer Res, January 1, 2009; 29(1): 1 - 9. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L.R. Brito, B. Walker, M. Jenner, N. J. Dickens, N. J.M. Brown, F. M. Ross, A. Avramidou, J. A.E. Irving, D. Gonzalez, F. E. Davies, et al. MMSET deregulation affects cell cycle progression and adhesion regulons in t(4;14) myeloma plasma cells Haematologica, January 1, 2009; 94(1): 78 - 86. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Martinez-Torrecuadrada, L. H. Cheung, P. Lopez-Serra, R. Barderas, M. Canamero, S. Ferreiro, M. G. Rosenblum, and J. I. Casal Antitumor activity of fibroblast growth factor receptor 3-specific immunotoxins in a xenograft mouse model of bladder carcinoma is mediated by apoptosis Mol. Cancer Ther., April 1, 2008; 7(4): 862 - 873. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Sauvageau, M. Miller, S. Lemieux, J. Lessard, J. Hebert, and G. Sauvageau Quantitative expression profiling guided by common retroviral insertion sites reveals novel and cell type specific cancer genes in leukemia Blood, January 15, 2008; 111(2): 790 - 799. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. G. Richardson, T. Hideshima, and K. C. Anderson Plasma cell dyscrasias ASH Self-Assessment Program, January 1, 2007; 2007(1): 298 - 327. [Full Text] [PDF]
|
|
|
|
|
|
E. Masih-Khan, S. Trudel, C. Heise, Z. Li, J. Paterson, V. Nadeem, E. Wei, D. Roodman, J. O. Claudio, P. L. Bergsagel, et al. MIP-1{alpha} (CCL3) is a downstream target of FGFR3 and RAS-MAPK signaling in multiple myeloma Blood, November 15, 2006; 108(10): 3465 - 3471. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Pedranzini, T. Dechow, M. Berishaj, R. Comenzo, P. Zhou, J. Azare, W. Bornmann, and J. Bromberg Pyridone 6, A Pan-Janus-Activated Kinase Inhibitor, Induces Growth Inhibition of Multiple Myeloma Cells Cancer Res., October 1, 2006; 66(19): 9714 - 9721. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. W. Finch and J. S. Rubin Keratinocyte growth factor expression and activity in cancer: implications for use in patients with solid tumors. J Natl Cancer Inst, June 21, 2006; 98(12): 812 - 824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Trudel, A. K. Stewart, E. Rom, E. Wei, Z. H. Li, S. Kotzer, I. Chumakov, Y. Singer, H. Chang, S.-B. Liang, et al. The inhibitory anti-FGFR3 antibody, PRO-001, is cytotoxic to t(4;14) multiple myeloma cells Blood, May 15, 2006; 107(10): 4039 - 4046. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Jaksic, S. Trudel, H. Chang, Y. Trieu, X. Qi, J. Mikhael, D. Reece, C. Chen, and A. K. Stewart Clinical Outcomes in t(4;14) Multiple Myeloma: A Chemotherapy-Sensitive Disease Characterized by Rapid Relapse and Alkylating Agent Resistance J. Clin. Oncol., October 1, 2005; 23(28): 7069 - 7073. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Martinez-Torrecuadrada, G. Cifuentes, P. Lopez-Serra, P. Saenz, A. Martinez, and J. I. Casal Targeting the Extracellular Domain of Fibroblast Growth Factor Receptor 3 with Human Single-Chain Fv Antibodies Inhibits Bladder Carcinoma Cell Line Proliferation Clin. Cancer Res., September 1, 2005; 11(17): 6280 - 6290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chen, I. R. Williams, B. H. Lee, N. Duclos, B. J. P. Huntly, D. J. Donoghue, and D. G. Gilliland Constitutively activated FGFR3 mutants signal through PLC{gamma}-dependent and -independent pathways for hematopoietic transformation Blood, July 1, 2005; 106(1): 328 - 337. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Chang, A. K. Stewart, X. Y. Qi, Z. H. Li, Q. L. Yi, and S. Trudel Immunohistochemistry accurately predicts FGFR3 aberrant expression and t(4;14) in multiple myeloma Blood, July 1, 2005; 106(1): 353 - 355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Zhu, G. Somlo, B. Zhou, J. Shao, V. Bedell, M. L. Slovak, X. Liu, J. Luo, and Y. Yen Fibroblast growth factor receptor 3 inhibition by short hairpin RNAs leads to apoptosis in multiple myeloma Mol. Cancer Ther., May 1, 2005; 4(5): 787 - 798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Trudel, Z. H. Li, E. Wei, M. Wiesmann, H. Chang, C. Chen, D. Reece, C. Heise, and A. K. Stewart CHIR-258, a novel, multitargeted tyrosine kinase inhibitor for the potential treatment of t(4;14) multiple myeloma Blood, April 1, 2005; 105(7): 2941 - 2948. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. X. Zhu, S. Benn, Z. H. Li, E. Wei, E. Masih-Khan, Y. Trieu, M. Bali, C. J. McGlade, J. O. Claudio, and A. K. Stewart The SH3-SAM Adaptor HACS1 is Up-regulated in B Cell Activation Signaling Cascades J. Exp. Med., September 20, 2004; 200(6): 737 - 747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Dring, F. E. Davies, J. A. L. Fenton, P. L. Roddam, K. Scott, D. Gonzalez, S. Rollinson, A. C. Rawstron, K. S. Rees-Unwin, C. Li, et al. A Global Expression-based Analysis of the Consequences of the t(4;14) Translocation in Myeloma Clin. Cancer Res., September 1, 2004; 10(17): 5692 - 5701. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. N. Meyer, R. F. Gastwirt, D. D. Schlaepfer, and D. J. Donoghue The Cytoplasmic Tyrosine Kinase Pyk2 as a Novel Effector of Fibroblast Growth Factor Receptor 3 Activation J. Biol. Chem., July 2, 2004; 279(27): 28450 - 28457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Trudel, S. Ely, Y. Farooqi, M. Affer, D. F. Robbiani, M. Chesi, and P. L. Bergsagel Inhibition of fibroblast growth factor receptor 3 induces differentiation and apoptosis in t(4;14) myeloma Blood, May 1, 2004; 103(9): 3521 - 3528. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Abroun, H. Ishikawa, N. Tsuyama, S. Liu, F.-J. Li, K.-i. Otsuyama, X. Zheng, M. Obata, and M. M. Kawano Receptor synergy of interleukin-6 (IL-6) and insulin-like growth factor-I in myeloma cells that highly express IL-6 receptor {alpha} Blood, March 15, 2004; 103(6): 2291 - 2298. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. C. Munshi, T. Hideshima, D. Carrasco, M. Shammas, D. Auclair, F. Davies, N. Mitsiades, C. Mitsiades, R. S. Kim, C. Li, et al. Identification of genes modulated in multiple myeloma using genetically identical twin samples Blood, March 1, 2004; 103(5): 1799 - 1806. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. N. Onwuazor, X.-Y. Wen, D.-Y. Wang, L. Zhuang, E. Masih-Khan, J. Claudio, B. Barlogie, J. D. Shaughnessy Jr, and A. K. Stewart Mutation, SNP, and isoform analysis of fibroblast growth factor receptor 3 (FGFR3) in 150 newly diagnosed multiple myeloma patients Blood, July 15, 2003; 102(2): 772 - 773. [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. J. Elenitoba-Johnson, S. D. Jenson, R. T. Abbott, R. A. Palais, S. D. Bohling, Z. Lin, S. Tripp, P. J. Shami, L. Y. Wang, R. W. Coupland, et al. Involvement of multiple signaling pathways in follicular lymphoma transformation: p38-mitogen-activated protein kinase as a target for therapy PNAS, June 10, 2003; 100(12): 7259 - 7264. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Keats, T. Reiman, C. A. Maxwell, B. J. Taylor, L. M. Larratt, M. J. Mant, A. R. Belch, and L. M. Pilarski In multiple myeloma, t(4;14)(p16;q32) is an adverse prognostic factor irrespective of FGFR3 expression Blood, February 15, 2003; 101(4): 1520 - 1529. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. C. Anderson and W. S. Dalton Synopsis of a Research Roundtable Presented on Cell Signaling in Myeloma: Regulation of Growth and Apoptosis--Opportunities for New Drug Discovery Mol. Cancer Ther., December 1, 2002; 1(14): 1361 - 1365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. B. Pollett, S. Trudel, D. Stern, Z. H. Li, and A. K. Stewart Overexpression of the myeloma-associated oncogene fibroblast growth factor receptor 3 confers dexamethasone resistance Blood, November 15, 2002; 100(10): 3819 - 3821. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G Pratt Molecular aspects of multiple myeloma Mol. Pathol., October 1, 2002; 55(5): 273 - 283. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kong, C. S. Wang, and D. J. Donoghue Interaction of Fibroblast Growth Factor Receptor 3 and the Adapter Protein SH2-B. A ROLE IN STAT5 ACTIVATION J. Biol. Chem., May 3, 2002; 277(18): 15962 - 15970. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Guasch, V. Ollendorff, J.-P. Borg, D. Birnbaum, and M.-J. Pebusque 8p12 Stem Cell Myeloproliferative Disorder: the FOP-Fibroblast Growth Factor Receptor 1 Fusion Protein of the t(6;8) Translocation Induces Cell Survival Mediated by Mitogen-Activated Protein Kinase and Phosphatidylinositol 3-Kinase/Akt/mTOR Pathways Mol. Cell. Biol., December 1, 2001; 21(23): 8129 - 8142. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Wang, R. P. Green, G. Zhao, and D. M. Ornitz Differential regulation of endochondral bone growth and joint development by FGFR1 and FGFR3 tyrosine kinase domains Development, October 1, 2001; 128(19): 3867 - 3876. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. De Vos, G. Couderc, K. Tarte, M. Jourdan, G. Requirand, M.-C. Delteil, J.-F. Rossi, N. Mechti, and B. Klein Identifying intercellular signaling genes expressed in malignant plasma cells by using complementary DNA arrays Blood, August 1, 2001; 98(3): 771 - 780. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Li, Y. X. Zhu, E. E. Plowright, P. L. Bergsagel, M. Chesi, B. Patterson, T. S. Hawley, R. G. Hawley, and A. K. Stewart The myeloma-associated oncogene fibroblast growth factor receptor 3 is transforming in hematopoietic cells Blood, April 15, 2001; 97(8): 2413 - 2419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Chesi, L. A. Brents, S. A. Ely, C. Bais, D. F. Robbiani, E. A. Mesri, W. M. Kuehl, and P. L. Bergsagel Activated fibroblast growth factor receptor 3 is an oncogene that contributes to tumor progression in multiple myeloma Blood, February 1, 2001; 97(3): 729 - 736. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. S. Dalton, P. L. Bergsagel, W. M. Kuehl, K. C. Anderson, and J. L. Harousseau Multiple Myeloma Hematology, January 1, 2001; 2001(1): 157 - 177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Klasa, A. F. List, and B. D. Cheson Rational Approaches to Design of Therapeutics Targeting Molecular Markers Hematology, January 1, 2001; 2001(1): 443 - 462. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. G. Willis and M. J. S. Dyer The role of immunoglobulin translocations in the pathogenesis of B-cell malignancies Blood, August 1, 2000; 96(3): 808 - 822. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
), B9-MINV (
), pooled B9-WT (
), and B9-TD
(×) cell lines were incubated in the presence of increasing
concentrations of IL-6, and a 3H-thymidine proliferation
assay was performed. Pooled B9-TD cells exhibit enhanced proliferation
at all concentrations of IL-6.
interrupts interleukin-6-dependent signaling events in myeloma cells.
Blood.
1997;89:261-271