|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 4 (February 15), 2000:
pp. 1237-1248
GENE THERAPY
Quantitative assessment of retroviral transfer of the human
multidrug resistance 1 gene to human mobilized peripheral blood
progenitor cells engrafted in nonobese diabetic/severe combined
immunodeficient mice
B. Schiedlmeier,
K. Kühlcke,
H. G. Eckert,
C. Baum,
W. J. Zeller, and
S. Fruehauf
From the German Cancer Research Center, Department D 0200, Heidelberg, Germany; EUFETS GmbH, Idar-Oberstein, Germany;
Heinrich-Pette-Institut, Hamburg, Germany; and the Department of
Internal Medicine V, University of Heidelberg, Heidelberg, Germany.
 |
Abstract |
Mobilized peripheral blood progenitor cells (PBPC) are a potential
target for the retrovirus-mediated transfer of cytostatic drug-resistance genes. We analyzed nonobese diabetic/severe combined immunodeficient (NOD/SCID) mouse-repopulating CD34+ PBPC from patients with cancer after retroviral transduction in various cytokine
combinations with the hybrid vector SF-MDR, which is based on the
Friend mink cell focus-forming/murine embryonic stem-cell virus and
carries the human multidrug resistance 1 (MDR1) gene. Five to
13 weeks after transplantation of CD34+ PBPC into NOD/SCID mice
(n = 84), a cell dose-dependent multilineage engraftment of human
leukocytes up to an average of 33% was observed. The SF-MDR provirus
was detected in the bone marrow (BM) and in its granulocyte fractions
in 96% and 72%, respectively, of chimeric NOD/SCID mice. SF-MDR
provirus integration assessed by quantitative real-time polymerase
chain reaction (PCR) was optimal in the presence of Flt-3
ligand/thrombopoietin/stem-cell factor, resulting in a 6-fold (24% ± 5% [mean ± SE]) higher average proportion of gene-marked human
cells in NOD/SCID mice than that achieved with IL-3 alone (P < .01). A population of clearly
rhodamine-123dull human myeloid progeny cells could be
isolated from BM samples from chimeric NOD/SCID mice. On the basis of
PCR and rhodamine-123 efflux data, up to 18% ± 4% of transduced
cells were calculated to express the transgene. Our data suggest that
the NOD/SCID model provides a valid assay for estimating the
gene-transfer efficiency to repopulating human PBPC that may be
achievable in clinical autologous transplantation. P-glycoprotein
expression sufficient to prevent marrow aplasia in vivo may be obtained
with this SF-MDR vector and an optimized transduction protocol.
(Blood. 2000;95:1237-1248)
© 2000 by The American Society of Hematology.
| |
Introduction |
Mobilized peripheral blood progenitor cells (PBPC) are
an attractive target for gene-therapy applications in the treatment of
malignant diseases because they can be collected in ample quantities from peripheral blood (PB) after mobilization by cytokines or cytokine-supported chemotherapy.1 PBPC transplantation has enabled administration of higher doses of cytotoxic treatment to
patients with cancer, resulting in higher remission rates for some
diseases.1,2 The transfer of cytostatic drug-resistance genes into hematopoietic stem cells (HSC) and hematopoietic progenitor cells (HPC) is expected to extend this concept by protecting the bone
marrow (BM) of patients with cancer from myelotoxicity, the main
adverse and often dose-limiting effect of most cytostatic drugs. This
may enable further dose escalation.3-5 The human multidrug
resistance 1 (MDR1) gene is a candidate gene encoding the
membrane-located drug-efflux pump P-glycoprotein. P-glycoprotein confers resistance to a wide array of cytostatic agents, such as
paclitaxel and etoposide.6-8 In mice, transplantation of BM cells from MDR1 transgenic animals, as well as transplantation of retrovirally transduced primary HPC, resulted in chemoprotection in
vivo.9,10
Testing the concept of MDR1-mediated chemoprotection in large
animals or in human gene-therapy trials has been hampered by a low
number of reconstituting vector-marked cells and inefficient expression
of the transgene in vivo, despite high levels of gene transfer into HPC
and long-term culture-initiating cells (LTCIC) in
vitro.11-17 Because long-term repopulating human
hematopoietic cells are mostly quiescent, murine retroviral vectors do
not integrate easily.18,19 Commonly used vectors based on
murine leukemia virus (MLV) are expressed poorly in HSC and their
differentiated myeloid progeny.20,21 Thus, there is a need
for optimization of transduction conditions and vector design.
For analyses of human repopulating stem cells, small-animal
xenotransplantation models have been developed in immunodeficient mice
by several groups in the past 10 years (see Greiner at al22 for a review). These models are now considered to be surrogate assays
for repopulating stem cells in a clinical transplantation setting.23-29 Nonobese diabetic/LtSz-severe combined
immunodeficient/scid (NOD/SCID) mice have multiple defects in innate
immunity,30 including a largely reduced natural killer-cell
activity and a 2-fold reduced BM cellularity that possibly provides
more stem-cell niches for human cells. These mice have been shown to be
superior to SCID mice (CB-17scid/scid) both in terms of the frequency
of engraftment in the mice and the level of human cell
engraftment.30-32 The xenotransplantation of human
hematopoietic cells from different hematopoietic cell sources into
NOD/SCID mice has provided the basis to define and quantify a novel
population of cells, termed SCID-repopulating cells (SRC). SRC are
capable of extensive proliferation and multilineage differentiation in
vivo.31,33-36
In contrast to LTCIC, SRC are not found in the CD34+/38+ cell
fraction.31,37 The engraftment potential of SRC is markedly reduced after ex vivo culture.31,36 Moreover, Gothot et
al38 recently provided direct evidence that CD34+ PBPC SRC
are predominantly in G0 phase and further showed that
G0-G1 transition stimulated by cytokines, which
are necessary for integration of murine retroviral vectors, can
significantly reduce the engraftment potential of SRC. Gene transfer to
SRC has generally been inefficient,31 reflecting the low
levels of vector-marked cells observed in large-animal models and pilot
gene-therapy trials. Similar findings have been reported for
retrovirally transduced CD34+/38 cells from human adult BM
transplanted into beige/nude/X-linked (BNX) immunodeficient mice.39 Thus, these in vivo readout systems may be relevant surrogate assays for the human pluripotent stem cell and provide a
valuable tool for side-by-side comparisons of human gene-therapy protocols in advance of clinical studies.
Only a few in vitro40-43 and in vivo16,17
studies have reported on the efficiencies of gene transfer and
recovery of retrovirally transduced primitive hematopoietic cells from
mobilized blood. We used CD34+ PBPC from patients with cancer, cells
that may have already had a reduced proliferative capacity because of
previous cytotoxic chemotherapy. These cells were transduced with the
retroviral SF-MDR vector.44,45 Retroviral transduction
occurred in the presence of various cytokines with or without addition
of cell-free stroma-conditioned medium (SCM).40,46,47 We
analyzed the engraftment, transgene integration, and expression in SRC.
A high gene-transfer rate and unambiguous expression of the
MDR1 transgene were found.
| |
Materials and methods |
Selection of CD34+ cells
Samples of mobilized PB apheresis cells obtained in the recovery
phase after chemotherapy supported by granulocyte colony-stimulating factor (G-CSF) (Filgrastim, Amgen, Thousand Oaks, CA) were obtained from 2 patients with multiple myeloma, 3 patients with non-Hodgkin's lymphoma, 3 patients with breast cancer, 1 patient with liposarcoma and, after G-CSF alone, from 1 allogeneic donor, with informed consent.
The patients with cancer had received a median of 3 chemotherapy cycles
(range, 1 to 8) and a median of 1 chemotherapy regimen (range, 1 to 4).
Three patients had radiotherapy before mobilization. This study was
approved by an ethics committee at the Medical Faculty of the
University of Heidelberg. Mononuclear cells (MNC) were collected from
apheresis samples by Ficoll density centrifugation (Biochrom KG,
Berlin, Germany). CD34+ PBPC were recovered by positive immunoselection
by using the MACS CD34 Multisort Cell Isolation Kit (Miltenyi Biotec,
Bergisch Gladbach, Germany) according to the manufacturer's
instructions. The selected fractions contained a median of 94% CD34+
cells (range, 48%-99%).
SCM
Confluent layers of the preadipocyte cell line FBMD-1, derived from
murine BM stroma (provided by R. E. Ploemacher), were grown at 33°C
under 10% carbon dioxide.48 The cells were cultured in
Dulbecco's minimum essential medium (MEM) supplemented with 5%
fetal-calf serum (FCS), 5% horse serum (Stem Cell Technologies, Vancouver, BC, Canada), 3.5 mmol/L HEPES, 2 mmol/L glutamine, 1%
penicillin/streptomycin (Gibco, Eggenstein, Germany),
10 5 mol/L hydrocortisone-21-hemisuccinate, 0.2 mmol/L alanine, 0.3 mmol/L asparagine, 0.5 mmol/L asparagine acid, 0.5 mmol/L cysteine, 0.4 mmol/L glutamine acid, 0.3 mmol/L proline, 0.01 mmol/L vitamin B12, 0.1 mmol/L biotin,
104 mol/L sodium selenite (Sigma, Deisenhofen,
Germany), 0.8 mmol/L sodium pyruvate, and 104 mol/L
 -mercaptoethanol (all Serva, Heidelberg, Germany, unless otherwise
mentioned). After the layers were confluent, the medium was removed and
fresh medium was added and conditioned for 10 days. The SCM was
harvested and nonadherent cells were removed by centrifugation and
stored at 70°C.
Retroviral vector
The SF-MDR vector is based on the Friend mink cell
focus-forming/murine embryonic stem-cell virus (FMEV). It contains the human MDR1 gene under the transcriptional control of the spleen focus-forming virus long-terminal repeat (LTR), which has been combined
with a permissive leader sequence of the murine embryonic stem-cell
virus (MESV) to overcome transcriptional repression of U3-mediated gene
expression.44,45
Retroviral Transwell transduction of CD34+ PBPC
Immediately after isolation, 2 × 106 fresh CD34+
selected PBPC were seeded into 6-well plates coated with 20 µg/cm2 of the recombinant fibronectin fragment
CH-29649-51 (RetroNectin; Takara Shuzo, Japan). Cells were
transduced for 96 hours by Transwell cocultivation with
1 × 105 SF-MDR virus producer cells that were grown
above the PBPC in Transwell inserts (high density [0.4 µm pore
size], Falcon, Heidelberg, Germany). Titers of cell-free supernatants
obtained from the virus producer cells ranged from
1 × 105/mL to 5 × 105/mL. The
cells were cultured in  -MEM supplemented with 10% FCS, 2 mmol/L
glutamine, and 1% penicillin/streptomycin (referred to as
"transduction medium") with or without 50% SCM. In the different cytokine combinations used, Flt-3 ligand (FL; R&D Systems, Wiesbaden, Germany), stem-cell factor (SCF; R&D Systems), and vascular endothelial growth factor (VEGF; R&D Systems) were added to yield final
concentrations of 100 ng/mL each. Thrombopoietin (TPO; R&D Systems) and
IL-6 (R&D Systems) were used at concentrations of 20 ng/mL each, and IL-3 (Novartis, Nürnberg, Germany) was used at a concentration of
50 ng/mL. In all experiments, mock transductions were performed over 96 hours at identical cell and growth-factor concentrations. After the
96-hour transduction period, transduced and mock transduced PBPC were
harvested, washed 3 times in phosphate-buffered saline (PBS; Gibco) and
resuspended in Iscove's modified Dulbecco's medium (IMDM) plus 10%
FCS (Stem Cell Technologies) at a concentration of
1 × 106 input of CD34+ PBPC/mL of medium. In
experiments 1 to 7, CD34+ PBPC samples were transduced in several
separate aliquots in each experiment. The aliquots of each experiment
were pooled after transduction for transplantation of cells from 1 patient into a given set of NOD/SCID mice. In experiments 8 to 10, the
individual transduction aliquots were transplanted into individual mice
(Table 1).
Generation of retroviral supernatants and supernatant transduction
of CD34+ PBPC
Retroviral supernatant was harvested from 90% confluent
layers of GPenv+AM12/SF-MDR producer cells after a 16-hour cultivation period in -MEM supplemented with 10% FCS, 2 mol/L glutamine, and
1% penicillin/streptomycin. It was then filtered (0.45 µm) and kept
frozen until use. The viral titer of the supernatants was determined by
infecting a known number of A2780 cells with different volumes of viral
supernatant. The proportion of cells showing a rhodamine
(Rh)-123dull phenotype in the A2780 target cell population
was determined 48 hours after infection by using fluorescence-activated
cell-separation (FACS) analysis as described below. The titer was
calculated by multiplying the percentage of Rh-123dull
cells by the number of target cells plated and corrected for the amount
of viral supernatant applied. After thawing, viral titers ranged from
1 × 105/mL to 5 × 105/mL. Two
million CD34+ cells were prestimulated for 48 hours in 2 mL of
transduction medium with IL-3, IL-6, SCF, and FL, or FL (100 ng/mL),
SCF (100 ng/mL), and TPO (20 ng/mL). After precultivation, retroviral
transduction was done with cell-free viral supernatant twice during 48 hours. The prestimulated CD34+ cells were transferred to dishes coated
with CH-296 (20 µg/cm2) that contained 1 mL of virus
supernatant supplemented with either IL-3, IL-6, SCF, and FL, or FL,
SCF, and TPO. After a 4-hour retroviral infection period, the virus
supernatant was replaced with fresh cytokine-supplemented transduction
medium. After a total of 96 hours in culture, the cells were harvested
as described above.
Colony-forming cell (CFC) assays
Semisolid CFU assays were done after the 96-hour transduction
period. CD34+ cells were plated in duplicate at
5 × 102 cells/mL in 1 mL of complete
methylcellulose medium (Methocult GF, H4434, Stem Cell Technologies)
containing a mixture of recombinant human cytokines (SCF, IL-3,
granulocyte-macrophage colony-stimulating factor [GM-CSF], and
erythropoietin). After 12 to 14 days of incubation at 37°C,
colony-forming units granulocyte-macrophage (CFU-GM) were enumerated.
CFU-GM colonies were plucked and analyzed for the presence of the
vector-derived MDR1 gene as described below. For detection of
human progenitor cells in engrafted NOD/SCID mice, chimeric-mouse BM
cells were resuspended in IMDM plus 10% FCS and incubated for 2 to 4 hours at 37°C in tissue culture dishes. The nonadherent cells were
plated in duplicate at 5 × 105 cells/mL. BM cells
from NOD/SCID mice that did not receive transplants served as controls
in every experiment and did not produce CFC under these conditions. To
select for MDR1-expressing human CFC, freshly thawed
vincristine (Sigma) was added to yield a final concentration of 20 nmol/L.
Liquid culture and Rh-123 efflux assay
Sixty-thousand transduced or mock-transduced CD34+ PBPC cells were
cultured for 10 days in a cytokine mixture containing 10 ng/mL each of
SCF, IL-1 (IC-Chemikalien, Ismaning, Germany), IL-3, IL-6, G-CSF
(Amgen, Thousand Oaks, CA, USA), and GM-CSF (IC-Chemikalien). IMDM
containing 15% heat-inactivated FCS was used as the culture medium.
Under these conditions, the cultured CD34+ cells differentiated into
Rh-123bright CD11b+/CD15+ and CD11b+/CD15 cells,
which have been shown to represent precursors and mature cells of the
granulomonocytic lineage.52 MDR1 gene expression in
these cells was determined by their ability to efflux Rh-123, resulting
in an Rh-123dull phenotype.43
One million cells obtained after liquid culture of
2 × 106 chimeric-mouse BM cells were washed and
resuspended in IMDM containing 5% FCS and Rh-123 (Sigma) at a final
concentration of 0.2 µg/mL. After an incubation period of 30 minutes
at 37°C, cells were centrifuged, resuspended in IMDM containing 5%
FCS, and further incubated for 60 minutes at 37°C to allow the
cells to efflux loaded Rh-123. Subsequently, the cells were washed
twice and resuspended in 300 µL of staining medium (95% PBS, 4%
FCS, and 1% 1 mol/L HEPES). Immediately before flow cytometric
measurement, propidium iodide staining (Sigma; final concentration, 1 µg/mL) was done to exclude dead cells from the analysis. Separate
control procedures were performed with use of the P-glycoprotein
inhibitor cyclosporine (Sandimmun; Novartis, Basel, Switzerland) at a
final concentration of 1.5 µmol/L during all incubation steps.
Animals
A breeding colony of NOD/SCID mice was established at the animal
laboratory of the German Cancer Research Center (breeding stocks
originally from Jackson Laboratories, Bar Harbor, ME). Mice were kept
in isolators under pathogen-free conditions. Five to 24 hours before
transplantation, 5- to 10-week-old female mice were conditioned by
sublethal irradiation with a total dose of 3 Gy. Between
5 × 105 and 4 × 106 human CD34+
PBPC were transplanted intravenously in a volume of 300 µL of IMDM
per mouse. Starting on the day of transplantation, animals received 1 to 2 µg of human IL-3 (Novartis) and 2 to 4 µg of human G-CSF
(Amgen) 3 times per week subcutaneously. Additionally, all mice were
treated with antiasialo GM1 (Wako Chemicals, Neuss, Germany).
Immediately before transplantation, the mice received intraperitoneal
injections of 250 µL of PBS (Gibco) containing 50 µL of antiasialo
GM1; identical treatments were repeated on day 5 and day 11 after
transplantation of CD34+ cells.
Analysis of engraftment
Mice were killed by cervical dislocation 5 to 13 weeks after
transplantation of human cells. PB was aspirated from the heart. BM
cells were flushed from the femurs of each mouse into IMDM, and spleen
cells were obtained by homogenization. For lysis of erythrocytes, cells
were treated with hemolytic buffer (150 mmol/L ammonium chloride, 12 mmol/L sodium bicarbonate, and 0.1 mmol/L EDTA) immediately after
removal. Single-cell suspensions from BM, spleen, and PB were
preincubated for 20 minutes at 4°C in staining medium (95% PBS,
4% FCS, and 1% 1 mol/L HEPES) containing 10% unconjugated human IgG
(Endobulin; Immuno GmbH, Heidelberg, Germany). Cells
(1 × 105-1 × 106 per reaction)
were labeled with fluorochrome-conjugated antibodies for 30 minutes at
4°C, then washed and resuspended in 200 µL of staining medium.
All antibodies were from Becton Dickinson unless otherwise noted.
Antimouse CD45-fluorescein isothiocyanate (FITC; Sigma) and antihuman
CD45-phycoerythrin (PE; Pharmingen, Hamburg, Germany) were used to
identify the ratio of human to mouse leukocytes. Immediately before
measurement, dead cells were excluded from the analysis by using
propidium iodide (Sigma) uptake. Specific subsets of human cells were
quantified by a triple-staining method that used antihuman CD45-PE,
antimouse CD45-Quantum Red (Sigma), and FITC-conjugated antibodies
directed against the following human lineage markers: CD2, CD19, CD33,
CD34, and CD38. Alternatively, subsets of human cells were analyzed by
gating on human CD45-PerCP+ cells and then assessed by staining with
antihuman CD34-FITC/CD38-PE, CD14-FITC/CD33-PE, or
CD19-FITC/CD20-PE or stained for CD2-FITC/CD4-PE/CD8-PE. Samples were acquired on a Becton Dickinson FACSCalibur
(10 000-20 000 events) and analyzed by using the CellQuest software
package. In every experiment, parallel staining and FACS analysis was
done on normal human PB cells and on BM, spleen, and PB cells obtained from NOD/SCID mice not given transplants.
Enrichment of human cells from chimeric mice
About 1 × 107 freshly isolated chimeric-mouse BM
cells were cultivated overnight in IMDM supplemented with 10% FCS, 2 mmol/L glutamine, and 1% penicillin/streptomycin in the presence of
FL/TPO/SCF (10 ng/mL of each cytokine) and subjected to Ficoll
density-gradient centrifugation on the next day. Human cells were
recovered from chimeric-mouse BM by first labeling the MNC fraction
with a combination of paramagnetic microbeads conjugated to monoclonal
antimouse antibodies (CD45 and TER119, Miltenyi Biotech) directed
against all murine hematopoietic cells and subsequent magnetic cell
separation on a depletion column (type AS; Miltenyi Biotech). The
unlabeled human cells were recovered in the column flow-through, and
specific enrichment of human cells was verified by dual staining of
cell aliquots with a combination of PE-conjugated antihuman CD45 and FITC-labeled antimouse CD45 antibodies. The flow-through fraction contained on average 84.5% ± 0.9% human CD45+ cells (n = 5).
The average recovery of human cells was 59.3% ± 6.5% (n = 5).
Qualitative polymerase chain reaction (PCR) analysis
CFU-GM grown in semisolid medium were individually plucked and lysed
as described.43 Mouse BM cells
(1 × 106) were separated by Ficoll density
centrifugation (BM-Minificoll), and the interphase (MNC) and the
cell-pellet fractions (granulocytes) were individually lysed. Genomic
DNAs from mouse BM and spleen cells were isolated from
3-5 × 106 cells by using the QIAamp Blood Kit
(Qiagen, Hilden, Germany) with elution of the purified DNAs in a final
volume of 200 µL. Nested PCR for the selective detection of the
retrovirally transduced MDR1 gene (MDR1 complementary
DNA [cDNA]) was done with 10 µL of colony lysates or with 10 µL
of each genomic DNA in a total volume of 50 µL by using the Taq PCR
Master Mix Kit (Qiagen) supplemented with 20 pmol each of sense and
antisense primers. In each PCR, a positive control was set up that used
10 µL of lysates of virus producer cells diluted
105-fold in provirus-negative cells (sensitivity
reached, 1 transduced cell in 105 negative cells). In both
PCR rounds, the sense primers were located in the leader sequence of
the SF-MDR retrovirus vector backbone, whereas the antisense primers
were complementary to the 5' end of the MDR1 gene. The
first PCR round yielded an 825-base pair (bp) DNA fragment with the
sense/antisense primers 5' CGGATCGCTCACAACCAGTC 3'/5'
ACACCAGCATCATGAGAGGAAGTC 3'. The second PCR round yielded a
565-bp DNA fragment with the sense/antisense primer combination 5' ACCTTTAACG-TCGGATGGC 3'/5' CTTCTTTGCTCCTCCATTGC
3'. Amplification conditions were as follows: 95°C for 2.5 minutes, then 30 cycles at 95°C for 45 seconds, 58°C for 30 seconds, and 72°C for 1 minute, followed by extension at 72°C
for 10 minutes (PTC-200; MJ Research, Watertown, MA). For assessment of
human colonies recovered from the BM of NOD/SCID mice that had
transplantation, an internal amplification control was performed on
each colony by using primers specific for the human 2-microglobulin
gene as described53 (5' CAGG-TTTACTCACGTCATCCAGC
3'; 5' TCACATGGTTCACACGGCAGGC 3'; 232-bp product) and
primers specific for the -actin gene of human and mouse
origin53 (5' GTGACGAGG-CCCAGAGCAAGAG 3';
5' ACGCAGCTCATTGTAGAAGGTGTGG 3'; 123-bp product).
Amplification conditions for 2-microglobulin PCR were as follows:
95°C for 1 minute, then 30 cycles at 95°C for 1 minute,
66°C for 20 seconds, and 72°C for 20 seconds, followed by
extension at 72°C for 10 minutes. Amplification conditions for
-actin PCR were identical, except that only 24 cycles of amplification were done. Ten microliters of each PCR product was separated by electrophoresis on a 2% agarose gel and visualized in
UV-light after staining with ethidium bromide.
Real-time quantitative PCR
DNA purified by using the QIAamp Blood Kit was digested with 30 units of RNAse A (Sigma, Deisenhofen). Triplicate samples of 5 µL of
each DNA were used as templates in a duplex PCR (Kühlcke et al,
unpublished data) by using the ABI PRISM 7700 Sequence Detection System
(PE Applied Biosystems, Weiterstadt, Germany). In brief, primers mdr-f
5' AGAAAGCGAAGCAGTGGTTCA 3' and mdr-r 5'
CGAACTGTAGACAAACGATG-AGCTA 3' amplified a 90-bp fragment from the
MDR1 cDNA (reaction 1) that was detected by the FAM-labeled TaqMan probe mdr-p 5' TGGTCCGACCTTTTCTGGCCTTATCCA 3'.
Primers hck-f 5' TATTAGCACCATCCATAGGAGGCTT 3' and hck-r
5' GTTAGGG-AAAGTGGAGCGGAAG 3' amplified a 80-bp fragment
from exon1 of the human hematopoietic cell kinase 1 gene54
(reaction 2) that was detected by the VIC-labeled TaqMan probe hck-p
5' TAACGCGTCCACCAAGGATGCGAA 3'. Amplification conditions
were as follows: 50°C for 2.0 minutes, 95°C for 10 minutes,
then 45 cycles at 95°C for 15 seconds and 60°C for 60 seconds.
For each of the 2 reactions, the PCR cycle number that generated the
first fluorescence signal above a threshold (the threshold cycle
[CT]) was determined. The difference between the CT of reaction 1 and
the CT of reaction 2 (the  CT value) was then used to quantitate the
percentage of MDR1-transduced human cells with the help of a
standard curve. To obtain a standard curve over 5 log, standards for
vector copy number per cell were prepared by sorting variable numbers
of MDR1-infected K562 cells that contained a single SF-MDR
vector copy into a defined number of noninfected K562 cells. DNA
isolated from these cell mixtures and from BM of engrafted mice were
analyzed in triplicate in the real-time duplex PCR.
Statistical analysis
The Student t test was used to test for significance in each
set of values, assuming equal variance. Mean values ± SE
are given unless otherwise stated.
| |
Results |
In 8 experiments (8 patient samples), retroviral transduction of
CD34+ PBPC was done for 96 hours with or without SCM in the presence of
either IL-3 alone, IL-3/FL, IL-3/IL-6/SCF/FL, FL/TPO/SCF, or
FL/TPO/VEGF by Transwell cocultivation cultures containing SF-MDR virus
producer cells in the insert. We evaluated viral supernatant infection
of CD34+ PBPC in 2 additional experiments (2 patient samples) by using
the cytokine combinations IL-3/IL-6/SCF/FL or FL/TPO/SCF.
Aliquots of each transduced or mock-transduced CD34+ PBPC sample were
plated into methylcellulose-based assays of colony-forming units to
assess the efficiency of MDR1 gene transfer into
lineage-committed progenitor cells. Other cell aliquots were cultivated
for 10 days to determine P-glycoprotein expression in the
myelomonocytic progeny of MDR1-transduced PBPC by means of
efflux of the fluorescent dye Rh-123. This assay is characterized by a
high accuracy and a lower variability than in results of CFC assays
plated with cytostatic drugs.43 The remaining transduced
and mock-transduced CD34+ PBPC were injected into the tail veins of
sublethally irradiated NOD/SCID mice to determine the engraftment
capacity of transduced CD34+ PBPC and the levels of gene transfer and
expression. Results obtained with Transwell cocultivation
are described immediately below. Supernatant data are compared with
cocultivation data later.
Gene transfer into clonogenic progenitors
After Transwell transduction, the level of gene transfer into
myeloid lineage-committed progenitors ranged from < 5% to 45% (mean, 22%) (Table 1). The proportion of Rh-123dull cells
(MDR1-expressing cells) in the myelomonocytic progeny ranged from 0.1% to 7.1% (median, 4.3%). MDR1-transduced PBPC had a
median 2-log reduction in the Rh-123 fluorescence intensity compared with mock-transduced control cells (example shown in Figure
1). Addition of the P-glycoprotein
inhibitor cyclosporine blocked the Rh-123 efflux from transduced cells
(Figure 1), confirming that the Rh-123dull events were due
to MDR1 gene expression.
View larger version (20K):
[in this window]
[in a new window]
| Fig 1.
MDR1 gene expression in the myelomonocytic
progeny of CD34+ peripheral blood progenitor cells (PBPC) after a
96-hour Transwell transduction period in fibronectin-coated wells.
Aliquots of MDR1-transduced and mock-transduced CD34+ PBPC
samples were cultured for 10 days in liquid medium containing a myeloid
differentiation-inducing cytokine mixture. Rh-123 efflux in the progeny
of MDR1-transduced and mock-transduced CD34+ PBPC was
determined by fluorescence-activated cell separation (FACS) analysis
without or with inclusion of the P-glycoprotein inhibitor cyclosporine
(CsA).
|
|
Human-cell engraftment in NOD/SCID mice
The repopulating ability of CD34+ PBPC transduced by Transwell
cocultivation was analyzed 5 to 13 weeks after transplantation in NOD/SCID mice. Cells recovered from the BM, spleen, and PB were
analyzed for the presence of human CD45+ leukocytes. Mice with < 0.1% human CD45+ cells were considered to have nonengraftment.
The average percentage of human CD45+ cells was not statistically
different in mice given transplants of 2 × 106
transduced CD34+ cells and those given mock-transduced cells (values
for both femurs, 18% ± 3% [n = 36] compared with 15% ± 5% [n = 8]; P = .7). There was also no difference in the
absolute number of human CD45+ cells (3.0 ± 0.6 × 106 cells [n = 36] compared with 2.5 ± 1.0 × 106 cells [n = 8];
P = .7) in these two groups. These data indicate that
Transwell cocultivation with murine SF-MDR virus producer cells neither impaired the repopulating capacity of human PBPC cells
nor induced a myeloproliferative state. A cell dose-dependent long-term
engraftment of human leukocytes in NOD/SCID mice was apparent (Figure
2). The findings with respect to the
proportions of human leukocytes detected in the spleen and PB at the
different graft sizes paralleled the BM results. There was no clear-cut relation between the proportion of human cells and time to analysis (data not shown). However, the individual groups may have been too
small to show such a difference.
View larger version (37K):
[in this window]
[in a new window]
| Fig 2.
Cell dose-dependent engraftment of CD34+ PBPC in
NOD/SCID mice (n = 63) after injection of Transwell-transduced or
mock-transduced cells under various culture conditions.
The number of transplanted cells reflects the input CD34+ cell number
(ie, after transduction, the cells were not recounted before
xenotransplantation). The proportions of human CD45+ leukocytes in bone
marrow ( ), spleen ( ), and peripheral blood ( ) determined by
FACS are shown as mean ± SE values. In each experiment, normal
human PB and mice not given transplants were analyzed as controls.
Comparison of human-cell engraftment between mice injected
with 5 × 105 CD34+ cells after retroviral
transduction in the presence of IL-3 or IL-3/FL yielded
P = .01 (**). The 3 denotes IL-3; 6, IL-6; FL, Flt3-ligand;
T, thrombopoietin; S, stem-cell factor; and V, vascular epithelial
growth factor.
|
|
Human-cell engraftment was similar in the different cytokine groups
(Figure 2). The addition of SCM during the transduction did not result
in higher levels of human cells (data not shown). The multilineage
engraftment was similar in MDR1-transduced and mock-transduced
CD34+ PBPC and in the different cytokine groups. Human multilineage
hematopoiesis in the BM of mice (Figure 3) consisted of myeloid maturation stages (CD33+, 47% ± 5%),
monocytes (CD14+, 14% ± 4%), B lymphocytes (CD19+, 15% ± 3%), T lymphocytes and natural killer cells (CD2+, 13% ± 2%) and
primitive progenitors (CD34+, 8% ± 2%).
View larger version (40K):
[in this window]
[in a new window]
| Fig 3.
Human multilineage engraftment in the bone marrow (BM) of
chimeric NOD/SCID mice.
(A) Histogram of expression of human panleukocyte marker CD45 in BM
cells of a mouse given a transplant of human CD34+ PBPC (solid line)
and a control mouse (no transplant) (dotted line). (B) Isotype control
for nonspecific IgG staining of CD45+ cells shown in (A). (C) Further
analysis of human CD45+ cells for the presence of myeloid and monocytic
cells (CD33 and CD14), B cells (CD19 and CD20), T cells (CD2 and
CD4/8), and immature progenitor cells (CD34 and CD38).
|
|
Detection of SF-MDR-marked human cells in BM and spleen of
chimeric NOD/SCID mice
A qualitative nested PCR allowed detection of proviral DNA in all
whole BM samples (n = 29) isolated from long-term engrafted NOD/SCID
mice given  1 × 106 CD34+ PBPC per graft (Table
2). Human cells containing provirus were
detected in the spleen in 68% of the animals (n = 22; Table 2).
Additionally, BM cell aliquots from 31 mice were separated by
Ficoll density-gradient centrifugation into MNC and polymorphonuclear cells or granulocytes (example shown in Figure
4A). Because granulocytes have a short
lifespan, detection of SF-MDR provirus DNA in the granulocyte cell
fraction 5 to 13 weeks after transplantation indicates that
repopulating cells with high proliferative potential are gene
marked.55 In 68% of the mice, the SF-MDR provirus was detected in the BM MNC fraction and the BM granulocyte fraction, whereas 26% of the animals had PCR-positive MNC with a PCR-negative granulocyte fraction. The BM in this 26% may have harbored
MDR1-transduced repopulating progenitor cells with a lower
proliferative potential. Two engrafted mice in which only the BM MNC
and granulocyte fractions but not genomic DNA from unseparated BM were
analyzed did not have gene-marked cells in either the MNC or the
granulocyte fraction. An SF-MDR proviral signal in the granulocyte
fraction alone was not observed.
View this table:
[in this window]
[in a new window]
|
Table 2.
Detection of SF-MDR provirus in chimeric NOD/SCID mice
into which MDR1-transduced human CD34+ PBPC were
transplanted
|
|
View larger version (37K):
[in this window]
[in a new window]
| Fig 4.
Detection of SF-MDR provirus in cells obtained from
chimeric NOD/SCID mice.
(A) PCR analysis of the mononuclear cell (MNC) fraction and the
granulocyte (polymorphonuclear; PMN) fractions of BM recovered from 11 mice (NOD/SCID set 7) engrafted with mock-transduced (1 and 2) or
MDR1-transduced (3-11) CD34+ PBPC. (B) Detection of the SF-MDR
proviral genome in individual colonies derived from 2 chimeric mice
(NOD/SCID sets 2 and 8) engrafted with Transwell-transduced CD34+ PBPC.
(C) Detection of the SF-MDR proviral genome in individual colonies
derived from 2 chimeric mice (NOD/SCID set 10) engrafted with
supernatant-transduced CD34+ PBPC. M denotes molecular-weight size
marker; Nc, no-template PCR control; and Pc, SF-MDR producer cells
diluted 105-fold in provirus-negative HL-60 cells.
|
|
Quantification of in vivo gene-marked human cells
Because the nested PCR analysis we used allowed us to determine only
whether the engrafted mice contained levels of gene-marked human cells
above our detection limit (> .001%), we developed a real-time duplex
PCR assay for quantification of vector-marked human cells in genomic
DNA from whole BM of engrafted mice. This assay allowed continuous
monitoring of 2 amplification products simultaneously during the
PCR one amplicon from the vector-derived MDR1 cDNA and one
from the human hematopoietic cell kinase (HCK) gene54for normalization of the variable content of human
DNA (internal standard) in each BM sample.
The proportions of gene-marked human cells in the BM of 29 engrafted
NOD/SCID mice are shown in Table 3. Five to
13 weeks after transplantation, gene-marked cells were detected within the human-cell population at average levels ranging from 0.9% to 30%.
Six animals (21%) had MDR1 gene-transfer percentages of between 10% and 30% of engrafted human cells. A respective
MDR1-engraftment proportion ranged from 1% to < 10% in
11 animals (38%) and from 0.1% to < 1% in 10 animals (34%).
MDR1 marking of < 0.1% of engrafted human cells occurred in
only 2 animals (7%). Substantially higher average proportions of
vector-marked human cells were detected in the BM of mice given
transplants of CD34+ PBPC transduced in the presence of
IL-3/IL-6/SCF/FL or FL/TPO/SCF. Mice in the IL-3/IL-6/SCF/FL group had
2.9-fold (P = .03), 4.4-fold (P = .01), and
13.5-fold (P = .003) more vector-marked human cells,
respectively, than those in the IL-3 group with or without SCM, the
IL-3/FL group, or the FL/TPO/VEGF group. Similarly, engrafted mice in
the FL/TPO/SCF group had on average 3.9-fold (P = .02),
5.9-fold (P = .003), and 18.3-fold (P = .08) higher
proportions of gene-marked human cells. There were no significant
differences between mice in the IL-3/IL-6/SCF/FL group and those in the
FL/TPO/SCF group (P = .7).
View this table:
[in this window]
[in a new window]
|
Table 3.
MDR1 provirus-marked human cells detected in BM
of chimeric mice by quantitative real-time PCR and by end point PCR on
single colonies
|
|
Recovery of transduced and drug-resistant human CFC from chimeric
NOD/SCID mice
Unselected human clonogenic progenitor cells recovered from the BM
of NOD/SCID mice given transplants were analyzed with a provirus-specific PCR. Human colonies with amplifiable DNA were obtained from 5 of 13 chimeric-mouse BM samples that had Transwell transduction and analysis (Table 3). Three of the 5 BM samples contained provirus-marked colonies (examples shown in Figure 4B). This
suggests MDR1 gene-transfer rates to repopulating human
progenitor cells of 5% and 10%, respectively, which is comparable to
the proportion of gene-marked human cells detected in genomic DNA from
the respective whole BM samples. The other 8 analyzed chimeric-mouse BM
samples yielded colonies that were negative in PCR amplification controls that used primers specific for either the human
2-microglobulin gene or the actin gene of human and mouse origin. Of
40 chimeric-mouse BM samples that contained human cells capable of
forming colonies in human-specific CFC assays under nonselective
conditions, 4 BM samples (data not shown) gave rise to human-cell
colonies resistant to a concentration of 20 nmol/L of vincristine
(6-fold higher than the median inhibitory concentration
[IC50]). No colonies of human vincristine-resistant cells
were obtained from chimeric-mouse BM samples derived from
control mice given mock-transduced CD34+ cells.
Retroviral transduction on CH-296 with cell-free viral
supernatant
We analyzed viral supernatant infection of CD34+ PBPC by using the
cytokine combinations IL-3/IL-6/SCF/FL and FL/TPO/SCF because they
provided efficient gene transfer into long-term repopulating cells in
our Transwell cocultivation protocol. Results in the supernatant transduction group are shown in Tables 1 to 3 (patient samples 9 and 10). A notable finding was that after transduction in
FL/TPO/SCF, the proportion of Rh-123dull cells in the
myeloid progeny of supernatant-transduced CD34+ PBPC compared with
Transwell cocultivation-transduced CD34+ PBPC was increased
2.6-fold (P = .01; Table 1). The gene-transfer rate into
clonogenic myeloid progenitors (Table 1), the level of
human-cell engraftment (Table 2), the proportion of vector-marked human
cells (Table 3), and the proportion of vector-marked human-cell colonies (Table 3; examples shown in Figure 4C) were similar in the
supernatant and Transwell transduction groups. These
findings suggest that our Transwell cocultivation data may be
transferable to the more clinically relevant supernatant-transduction setting.
Analysis of gene expression in chimeric mice
The proportion of human Rh-123dull
(MDR1-expressing) cells in human CD45+ leukocytes in
unseparated whole BM of chimeric NOD/SCID mice was assessed by flow
cytometry (Figure 5A). In 23 of 36 analyzed engrafted mice that had received CD34+ PBPC transduced by either Transwell cocultivation or viral supernatant infection,
Rh-123dull cells in the human-cell population were
detectable at low levels; the range was from 0.2% to 3.1% above the
level of human CD45+/Rh-123dull cells detected in the
control mice given mock-transduced CD34+ cells. A paired analysis
comparing the average proportion of human CD45+/Rh-123dull
cells (0.5% ± 0.1%; n = 28) with the average proportion of
vector-marked human cells (10.4% ± 2.6%; n = 28) revealed that,
on average, 5% of the vector-marked human cells expressed the
MDR1 transgene.
View larger version (34K):
[in this window]
[in a new window]
| Fig 5.
Flow cytometry analysis of MDR1 gene expression
in chimeric mice.
(A) Five weeks after transplantation of MDR1-transduced and
mock-transduced CD34+ PBPC samples (NOD/SCID set 10), chimeric-mouse BM
cells were obtained and analyzed for the presence of human leukocytes
(CD45+) and MDR1 expression (Rh-123 efflux) by FACS
after staining with rhodamine-123 (Rh-123), phycoerythrin
(PE)-conjugated antihuman CD45 antibody and propidium iodide (PI). The
proportions of live-gated viable human CD45+ cells expressing the
MDR1 gene (Rh-123dull cells) that were detectable
in 2 representative mice injected with transduced CD34+ PBPC and in a
control mouse into which mock-transduced CD34+ PBPC was transplanted
are shown. (B) MDR1 expression in the in vitro myeloid progeny
of human cells recovered from the corresponding chimeric mice (upper
panel). Human cells selectively enriched from freshly isolated
chimeric-mouse BM cells by immunomagnetic depletion of the mouse BM
cells were subjected to a 10-day liquid culture in the presence of a
myeloid differentiation-inducing cytokine mixture and subsequently
analyzed by FACS after staining with Rh-123, PE-conjugated antihuman
CD33 antibody, and PI. The proportions of human myeloid (CD33+)
Rh-123dull cells are indicated in the right corner of each
plot.
|
|
The Rh-123 efflux assay with freshly isolated BM cells may
have underestimated the proportion of vector-marked human cells expressing the MDR1 transgene, since transduced
MDR1-expressing CD34+ cells may be masked by their
nontransduced human-cell counterparts, which already display moderate
levels of endogenous P-glycoprotein expression.6,56,57 To
test this hypothesis, we cultured cells with a myeloid
differentiation-inducing cytokine mixture that contained SCF,
IL-1bL IL-3, IL-6, GM-CSF, and G-CSF. Human CD45+ cells were
enriched by immunomagnetic depletion of the mouse BM cells from BM
samples from 5 chimeric animals (NOD/SCID set 10) that had received
either MDR1-transduced (n = 4) or mock-transduced (n = 1)
CD34+ PBPC. We then cultured 1 × 105 enriched human
BM cells for 10 days to determine MDR1 expression in the human
myelomonocytic progeny. Dual staining of the cells with Rh-123 and an
antihuman CD33 antibody (Figure 5B) showed 2- to 6.5-fold higher levels
of up to 6.5% human CD33/Rh-123dull cells.
MDR1-expressing cells became more clearly detectable. In
side-by-side comparisons, the proportion of MDR1-expressing human cells to MDR1-transduced human cells increased from 6% ± 2% (n = 4) to 18% ± 4% (n = 4; P = .03)
after liquid culture.
| |
Discussion |
In this study, we showed engraftment in NOD/SCID mice of
MDR1-transduced and P-glycoprotein-expressing PBPC from
patients with cancer. We achieved gene-transfer efficiencies of up to
55% in clonogenic progenitors, values similar to those reported by other groups,58-60 either by Transwell cocultivation of
CD34+ PBPC with vector-producing cells or by adding viral supernatant.
To analyze the engraftment capacity of transduced CD34+ PBPC and to
document gene transfer and expression in human cells with in vivo
repopulating potential, sublethally irradiated NOD/SCID mice were given
transplants of 0.5 × 106 to
4.0 × 106 input CD34+ cells. A cell dose-dependent
multilineage engraftment of up to an average of 33% human leukocytes
(Table 2 and Figure 2) was observed. Differences in BM cellularity and
in the proportions of human CD45+ or CD33+/CD45+ leukocytes,
respectively, were not observed in NOD/SCID mice given transplants of
MDR1-transduced or mock-transduced CD34+ PBPC. These data
suggest that the SF-MDR vector is not toxic to SRC and does not induce
a myeloproliferative state under our culture conditions and observation
period of 5 to 13 weeks.61
What factors were responsible for the high level of human-cell
engraftment in NOD/SCID mice? The data presented here are consistent with levels of human-cell engraftment reported by Hogan et
al62 for freshly isolated CD34+ PBPC from patients with
cancer that were transplanted into NOD/SCID mice in comparable graft
sizes and with similar NOD/SCID mouse-conditioning procedures,
including intraperitoneal injections of antiasialo GM1 antibodies and
administration of cytokines. In contrast to these results,
significantly lower levels of human-cell engraftment in NOD/SCID mice
were reported by van der Loo et al63 with similar graft
sizes of fresh CD34+ PBPC. Factors such as the radiation dose62
or the treatment of mice with antiasialo GM-163 may
account for these differences. In paired comparisons, Hogan et
al62 showed that the average engraftment of human CD34+
PBPCs was independent of supplementation with human cytokines, as was
previously shown for cord blood CB CD34+ cells.64,65 In
contrast, 2 other groups reported that cotransplantation of an
irradiated human stromal cell line secreting a number of cytokines (eg,
SCF, G-CSF, GM-CSF, and IL-6) or a human IL-3-expressing rat
fibroblast cell line into NOD/SCID or SCID mice, respectively, enhanced
engraftment of both fresh and cultivated CD34+ PBPC.66,67
Because of these contradictory data, we administered recombinant IL-3
and G-CSF to the mice in our study.
Levels of human-cell engraftment in NOD/SCID mice similar to those we
observed were reported after retroviral infection over comparably
short-term cultivation periods, with use of MNC or CD34-selected cord
blood cells (or both),31,68,69 which have a higher
engraftment potential in NOD/SCID mice.35 A similar potential of CD34+ PBPC from healthy donors sorted after transduction to engraft human fetal-bone grafts in SCID mice (SCID-human bone assay)
has been described.70
We previously observed an approximately 4-fold reduction in the
repopulating ability of fresh, noncultured CD34+ PBPC after retroviral
transduction in IL-3 alone.32,71 In other studies, SRC
derived from cord blood were expanded 2- to 4-fold, but at the expense
of a decline of their proliferative potential over time.72,73
Others have also found that cytokine-supported short-term retroviral transduction of BM CD34+ cells or CD34+ PBPC in the absence
of supporting BM stromal cells resulted in a severe reduction or loss
of the ability to efficiently engraft and repopulate for the long term
(> 6 months) the BM of immunodeficient BNX mice.46,74 Data from the same group75 proved that adhesion to the
recombinant fibronectin fragment CH-296 through engagement of VLA-4 and
VLA-5 integrins during ex vivo culture was as effective as BM stromal cells in supporting the long-term engraftment potential of human HSC/HPC. This is consistent with the report by Gothot et
al38 that uncultured CD34+ PBPC residing in G1
phase or unfractionated CD34+ cells after a short-term cultivation (36 hours) in the absence of fibronectin or stroma contact had a severely
reduced repopulating capacity in comparison to that of fresh
G0 CD34+ cells, independent of the type of cytokines used.
Thus, the use of fibronectin-coated culture dishes in conjunction with
administration of antiasialo GM1 and human cytokines may have been
important in the high level of human-cell engraftment in our
study. Interestingly, we observed a high engraftment of vector-marked
human cells (Table 3), which suggests a rescuing effect of fibronectin
on repopulating cells that traversed the cell cycle. However,
fibronectin support in culture does not provide complete maintenance of
engraftment capacity, as shown by a 50% reduction in human
cord blood CD34+ cell engraftment in NOD/SCID mice after
24-hour culture in the presence of fibronectin and cytokines, including
FL (reviewed by Lyman and
Jacobsen76).77
We were able to detect integration of the SF-MDR provirus in 96% (48 of 50) of analyzed BM samples (whole BM or Ficoll MNC fraction of BM
cells) from chimeric mice, and provirus-marked granulocytes were
present in 72% (26 of 36) of mice analyzed (Table 2). The development
of a quantitative real-time duplex PCR technique allowed us to monitor
the proportion of MDR1-transduced human cells in the BM of
chimeric mice. We observed no difference in the level of SF-MDR
chimerism between Transwell transduction and viral supernatant
transduction in the presence of IL-3/IL-6/SCF/FL or FL/TPO/SCF,
respectively. The average proportion of vector-marked human cells in
mice ranged from 1% to 38% (Table 3), indicating that these mice were
engrafted with one or more transduced SRC. Comparable rates (range, < 5% to 45%) of vector-marked human CFC derived from corresponding
individual chimeric-mouse BM samples were found (Table 3), confirming
the results obtained with the real-time duplex PCR technique.
Encouraging, clinically relevant gene-transfer rates of 10% to 20% of
in vivo repopulating cells present in mobilized PB of 2 different
nonhuman primates (rhesus macaques and baboons) have been
achieved.78,79 In these 2 studies, both the target cell population (CD34+ PBPC) and the short-term retroviral transduction protocols were similar to those in our study. Therefore, our data are
the first to indicate that the NOD/SCID model is a valid assay for
measuring gene transfer to repopulating human HSC obtained from
mobilized PB and that it is comparable to autologous transplantation in
large-animal models. Furthermore, our results support the possibility that vector-marked human cells capable of multilineage hematopoiesis in
a murine xenograft may also contribute to in vivo hematopoiesis in
humans. This reinforces the relevance of murine in vivo surrogate assays for developing novel vector systems and optimizing clinically applicable protocols for the transduction and ex vivo expansion of
primitive human hematopoietic cells. However, direct evidence for this
theory can be obtained only by parallel transplantation of transduced
CD34+ PBPC into patients and immunodeficient mice. Moderate to high
levels of gene transfer to primitive in vivo repopulating human CD34+
cells in cord blood have been observed in studies in NOD/SCID
mice.68,69,80 However, no comparable cord blood studies in
nonhuman primates or humans have been published to validate these data.
Although we observed no significantly different levels of BM chimerism
with human cells for the various cytokine combinations, transduction in
the presence of either IL-3/IL-6/SCF/FL or FL/TPO/SCF (supernatant
group and Transwell group combined) resulted on average in 3-fold
(mean, 12%; n = 4; P < .01) and 6-fold (mean, 24%;
n = 10; P < .01) higher proportions of in vivo
vector-marked human cells, compared with the mean level of gene-marked
human cells observed with IL-3 alone (mean, 4%; n = 5; Table 3).
These results suggest that in the presence of IL-3/IL-6/SCF/FL or
FL/TPO/SCF, more cells tra |
Top
Abstract
Introduction