|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 95 No. 4 (February 15), 2000:
pp. 1237-1248
GENE THERAPY
From the German Cancer Research Center, Department D 0200, Heidelberg, Germany; EUFETS GmbH, Idar-Oberstein, Germany;
Heinrich-Pette-Institut, Hamburg, Germany; and the Department of
Internal Medicine V, University of Heidelberg, Heidelberg, Germany.
Mobilized peripheral blood progenitor cells (PBPC) are a potential
target for the retrovirus-mediated transfer of cytostatic drug-resistance genes. We analyzed nonobese diabetic/severe combined immunodeficient (NOD/SCID) mouse-repopulating CD34+ PBPC from patients with cancer after retroviral transduction in various cytokine
combinations with the hybrid vector SF-MDR, which is based on the
Friend mink cell focus-forming/murine embryonic stem-cell virus and
carries the human multidrug resistance 1 (MDR1) gene. Five to
13 weeks after transplantation of CD34+ PBPC into NOD/SCID mice
(n = 84), a cell dose-dependent multilineage engraftment of human
leukocytes up to an average of 33% was observed. The SF-MDR provirus
was detected in the bone marrow (BM) and in its granulocyte fractions
in 96% and 72%, respectively, of chimeric NOD/SCID mice. SF-MDR
provirus integration assessed by quantitative real-time polymerase
chain reaction (PCR) was optimal in the presence of Flt-3
ligand/thrombopoietin/stem-cell factor, resulting in a 6-fold (24% ± 5% [mean ± SE]) higher average proportion of gene-marked human
cells in NOD/SCID mice than that achieved with IL-3 alone (P < .01). A population of clearly
rhodamine-123dull human myeloid progeny cells could be
isolated from BM samples from chimeric NOD/SCID mice. On the basis of
PCR and rhodamine-123 efflux data, up to 18% ± 4% of transduced
cells were calculated to express the transgene. Our data suggest that
the NOD/SCID model provides a valid assay for estimating the
gene-transfer efficiency to repopulating human PBPC that may be
achievable in clinical autologous transplantation. P-glycoprotein
expression sufficient to prevent marrow aplasia in vivo may be obtained
with this SF-MDR vector and an optimized transduction protocol.
(Blood. 2000;95:1237-1248)
Mobilized peripheral blood progenitor cells (PBPC) are
an attractive target for gene-therapy applications in the treatment of
malignant diseases because they can be collected in ample quantities from peripheral blood (PB) after mobilization by cytokines or cytokine-supported chemotherapy.1 PBPC transplantation has enabled administration of higher doses of cytotoxic treatment to
patients with cancer, resulting in higher remission rates for some
diseases.1,2 The transfer of cytostatic drug-resistance genes into hematopoietic stem cells (HSC) and hematopoietic progenitor cells (HPC) is expected to extend this concept by protecting the bone
marrow (BM) of patients with cancer from myelotoxicity, the main
adverse and often dose-limiting effect of most cytostatic drugs. This
may enable further dose escalation.3-5 The human multidrug
resistance 1 (MDR1) gene is a candidate gene encoding the
membrane-located drug-efflux pump P-glycoprotein. P-glycoprotein confers resistance to a wide array of cytostatic agents, such as
paclitaxel and etoposide.6-8 In mice, transplantation of BM cells from MDR1 transgenic animals, as well as transplantation of retrovirally transduced primary HPC, resulted in chemoprotection in
vivo.9,10
Testing the concept of MDR1-mediated chemoprotection in large
animals or in human gene-therapy trials has been hampered by a low
number of reconstituting vector-marked cells and inefficient expression
of the transgene in vivo, despite high levels of gene transfer into HPC
and long-term culture-initiating cells (LTCIC) in
vitro.11-17 Because long-term repopulating human
hematopoietic cells are mostly quiescent, murine retroviral vectors do
not integrate easily.18,19 Commonly used vectors based on
murine leukemia virus (MLV) are expressed poorly in HSC and their
differentiated myeloid progeny.20,21 Thus, there is a need
for optimization of transduction conditions and vector design.
For analyses of human repopulating stem cells, small-animal
xenotransplantation models have been developed in immunodeficient mice
by several groups in the past 10 years (see Greiner at al22 for a review). These models are now considered to be surrogate assays
for repopulating stem cells in a clinical transplantation setting.23-29 Nonobese diabetic/LtSz-severe combined
immunodeficient/scid (NOD/SCID) mice have multiple defects in innate
immunity,30 including a largely reduced natural killer-cell
activity and a 2-fold reduced BM cellularity that possibly provides
more stem-cell niches for human cells. These mice have been shown to be
superior to SCID mice (CB-17scid/scid) both in terms of the frequency
of engraftment in the mice and the level of human cell
engraftment.30-32 The xenotransplantation of human
hematopoietic cells from different hematopoietic cell sources into
NOD/SCID mice has provided the basis to define and quantify a novel
population of cells, termed SCID-repopulating cells (SRC). SRC are
capable of extensive proliferation and multilineage differentiation in
vivo.31,33-36
In contrast to LTCIC, SRC are not found in the CD34+/38+ cell
fraction.31,37 The engraftment potential of SRC is markedly reduced after ex vivo culture.31,36 Moreover, Gothot et
al38 recently provided direct evidence that CD34+ PBPC SRC
are predominantly in G0 phase and further showed that
G0-G1 transition stimulated by cytokines, which
are necessary for integration of murine retroviral vectors, can
significantly reduce the engraftment potential of SRC. Gene transfer to
SRC has generally been inefficient,31 reflecting the low
levels of vector-marked cells observed in large-animal models and pilot
gene-therapy trials. Similar findings have been reported for
retrovirally transduced CD34+/38 Only a few in vitro40-43 and in vivo16,17
studies have reported on the efficiencies of gene transfer and
recovery of retrovirally transduced primitive hematopoietic cells from
mobilized blood. We used CD34+ PBPC from patients with cancer, cells
that may have already had a reduced proliferative capacity because of
previous cytotoxic chemotherapy. These cells were transduced with the
retroviral SF-MDR vector.44,45 Retroviral transduction
occurred in the presence of various cytokines with or without addition
of cell-free stroma-conditioned medium (SCM).40,46,47 We
analyzed the engraftment, transgene integration, and expression in SRC.
A high gene-transfer rate and unambiguous expression of the
MDR1 transgene were found.
Selection of CD34+ cells
SCM
Retroviral vector The SF-MDR vector is based on the Friend mink cell focus-forming/murine embryonic stem-cell virus (FMEV). It contains the human MDR1 gene under the transcriptional control of the spleen focus-forming virus long-terminal repeat (LTR), which has been combined with a permissive leader sequence of the murine embryonic stem-cell virus (MESV) to overcome transcriptional repression of U3-mediated gene expression.44,45Retroviral Transwell transduction of CD34+ PBPC Immediately after isolation, 2 × 106 fresh CD34+ selected PBPC were seeded into 6-well plates coated with 20 µg/cm2 of the recombinant fibronectin fragment CH-29649-51 (RetroNectin; Takara Shuzo, Japan). Cells were transduced for 96 hours by Transwell cocultivation with 1 × 105 SF-MDR virus producer cells that were grown above the PBPC in Transwell inserts (high density [0.4 µm pore size], Falcon, Heidelberg, Germany). Titers of cell-free supernatants obtained from the virus producer cells ranged from 1 × 105/mL to 5 × 105/mL. The cells were cultured in -MEM supplemented with 10% FCS, 2 mmol/L
glutamine, and 1% penicillin/streptomycin (referred to as
"transduction medium") with or without 50% SCM. In the different cytokine combinations used, Flt-3 ligand (FL; R&D Systems, Wiesbaden, Germany), stem-cell factor (SCF; R&D Systems), and vascular endothelial growth factor (VEGF; R&D Systems) were added to yield final
concentrations of 100 ng/mL each. Thrombopoietin (TPO; R&D Systems) and
IL-6 (R&D Systems) were used at concentrations of 20 ng/mL each, and IL-3 (Novartis, Nürnberg, Germany) was used at a concentration of
50 ng/mL. In all experiments, mock transductions were performed over 96 hours at identical cell and growth-factor concentrations. After the
96-hour transduction period, transduced and mock transduced PBPC were
harvested, washed 3 times in phosphate-buffered saline (PBS; Gibco) and
resuspended in Iscove's modified Dulbecco's medium (IMDM) plus 10%
FCS (Stem Cell Technologies) at a concentration of
1 × 106 input of CD34+ PBPC/mL of medium. In
experiments 1 to 7, CD34+ PBPC samples were transduced in several
separate aliquots in each experiment. The aliquots of each experiment
were pooled after transduction for transplantation of cells from 1 patient into a given set of NOD/SCID mice. In experiments 8 to 10, the
individual transduction aliquots were transplanted into individual mice
(Table 1).
Generation of retroviral supernatants and supernatant transduction of CD34+ PBPC Retroviral supernatant was harvested from 90% confluent layers of GPenv+AM12/SF-MDR producer cells after a 16-hour cultivation period in-MEM supplemented with 10% FCS, 2 mol/L glutamine, and
1% penicillin/streptomycin. It was then filtered (0.45 µm) and kept
frozen until use. The viral titer of the supernatants was determined by
infecting a known number of A2780 cells with different volumes of viral
supernatant. The proportion of cells showing a rhodamine
(Rh)-123dull phenotype in the A2780 target cell population
was determined 48 hours after infection by using fluorescence-activated
cell-separation (FACS) analysis as described below. The titer was
calculated by multiplying the percentage of Rh-123dull
cells by the number of target cells plated and corrected for the amount
of viral supernatant applied. After thawing, viral titers ranged from
1 × 105/mL to 5 × 105/mL. Two
million CD34+ cells were prestimulated for 48 hours in 2 mL of
transduction medium with IL-3, IL-6, SCF, and FL, or FL (100 ng/mL),
SCF (100 ng/mL), and TPO (20 ng/mL). After precultivation, retroviral
transduction was done with cell-free viral supernatant twice during 48 hours. The prestimulated CD34+ cells were transferred to dishes coated
with CH-296 (20 µg/cm2) that contained 1 mL of virus
supernatant supplemented with either IL-3, IL-6, SCF, and FL, or FL,
SCF, and TPO. After a 4-hour retroviral infection period, the virus
supernatant was replaced with fresh cytokine-supplemented transduction
medium. After a total of 96 hours in culture, the cells were harvested
as described above.
Colony-forming cell (CFC) assays Semisolid CFU assays were done after the 96-hour transduction period. CD34+ cells were plated in duplicate at 5 × 102 cells/mL in 1 mL of complete methylcellulose medium (Methocult GF, H4434, Stem Cell Technologies) containing a mixture of recombinant human cytokines (SCF, IL-3, granulocyte-macrophage colony-stimulating factor [GM-CSF], and erythropoietin). After 12 to 14 days of incubation at 37°C, colony-forming units granulocyte-macrophage (CFU-GM) were enumerated. CFU-GM colonies were plucked and analyzed for the presence of the vector-derived MDR1 gene as described below. For detection of human progenitor cells in engrafted NOD/SCID mice, chimeric-mouse BM cells were resuspended in IMDM plus 10% FCS and incubated for 2 to 4 hours at 37°C in tissue culture dishes. The nonadherent cells were plated in duplicate at 5 × 105 cells/mL. BM cells from NOD/SCID mice that did not receive transplants served as controls in every experiment and did not produce CFC under these conditions. To select for MDR1-expressing human CFC, freshly thawed vincristine (Sigma) was added to yield a final concentration of 20 nmol/L.Liquid culture and Rh-123 efflux assay Sixty-thousand transduced or mock-transduced CD34+ PBPC cells were cultured for 10 days in a cytokine mixture containing 10 ng/mL each of SCF, IL-1 (IC-Chemikalien, Ismaning, Germany), IL-3, IL-6, G-CSF
(Amgen, Thousand Oaks, CA, USA), and GM-CSF (IC-Chemikalien). IMDM
containing 15% heat-inactivated FCS was used as the culture medium.
Under these conditions, the cultured CD34+ cells differentiated into
Rh-123bright CD11b+/CD15+ and CD11b+/CD15 cells,
which have been shown to represent precursors and mature cells of the
granulomonocytic lineage.52 MDR1 gene expression in
these cells was determined by their ability to efflux Rh-123, resulting
in an Rh-123dull phenotype.43
Animals A breeding colony of NOD/SCID mice was established at the animal laboratory of the German Cancer Research Center (breeding stocks originally from Jackson Laboratories, Bar Harbor, ME). Mice were kept in isolators under pathogen-free conditions. Five to 24 hours before transplantation, 5- to 10-week-old female mice were conditioned by sublethal irradiation with a total dose of 3 Gy. Between 5 × 105 and 4 × 106 human CD34+ PBPC were transplanted intravenously in a volume of 300 µL of IMDM per mouse. Starting on the day of transplantation, animals received 1 to 2 µg of human IL-3 (Novartis) and 2 to 4 µg of human G-CSF (Amgen) 3 times per week subcutaneously. Additionally, all mice were treated with antiasialo GM1 (Wako Chemicals, Neuss, Germany). Immediately before transplantation, the mice received intraperitoneal injections of 250 µL of PBS (Gibco) containing 50 µL of antiasialo GM1; identical treatments were repeated on day 5 and day 11 after transplantation of CD34+ cells.Analysis of engraftment Mice were killed by cervical dislocation 5 to 13 weeks after transplantation of human cells. PB was aspirated from the heart. BM cells were flushed from the femurs of each mouse into IMDM, and spleen cells were obtained by homogenization. For lysis of erythrocytes, cells were treated with hemolytic buffer (150 mmol/L ammonium chloride, 12 mmol/L sodium bicarbonate, and 0.1 mmol/L EDTA) immediately after removal. Single-cell suspensions from BM, spleen, and PB were preincubated for 20 minutes at 4°C in staining medium (95% PBS, 4% FCS, and 1% 1 mol/L HEPES) containing 10% unconjugated human IgG (Endobulin; Immuno GmbH, Heidelberg, Germany). Cells (1 × 105-1 × 106 per reaction) were labeled with fluorochrome-conjugated antibodies for 30 minutes at 4°C, then washed and resuspended in 200 µL of staining medium.Enrichment of human cells from chimeric mice About 1 × 107 freshly isolated chimeric-mouse BM cells were cultivated overnight in IMDM supplemented with 10% FCS, 2 mmol/L glutamine, and 1% penicillin/streptomycin in the presence of FL/TPO/SCF (10 ng/mL of each cytokine) and subjected to Ficoll density-gradient centrifugation on the next day. Human cells were recovered from chimeric-mouse BM by first labeling the MNC fraction with a combination of paramagnetic microbeads conjugated to monoclonal antimouse antibodies (CD45 and TER119, Miltenyi Biotech) directed against all murine hematopoietic cells and subsequent magnetic cell separation on a depletion column (type AS; Miltenyi Biotech). The unlabeled human cells were recovered in the column flow-through, and specific enrichment of human cells was verified by dual staining of cell aliquots with a combination of PE-conjugated antihuman CD45 and FITC-labeled antimouse CD45 antibodies. The flow-through fraction contained on average 84.5% ± 0.9% human CD45+ cells (n = 5). The average recovery of human cells was 59.3% ± 6.5% (n = 5).Qualitative polymerase chain reaction (PCR) analysis CFU-GM grown in semisolid medium were individually plucked and lysed as described.43 Mouse BM cells (1 × 106) were separated by Ficoll density centrifugation (BM-Minificoll), and the interphase (MNC) and the cell-pellet fractions (granulocytes) were individually lysed. Genomic DNAs from mouse BM and spleen cells were isolated from 3-5 × 106 cells by using the QIAamp Blood Kit (Qiagen, Hilden, Germany) with elution of the purified DNAs in a final volume of 200 µL. Nested PCR for the selective detection of the retrovirally transduced MDR1 gene (MDR1 complementary DNA [cDNA]) was done with 10 µL of colony lysates or with 10 µL of each genomic DNA in a total volume of 50 µL by using the Taq PCR Master Mix Kit (Qiagen) supplemented with 20 pmol each of sense and antisense primers. In each PCR, a positive control was set up that used 10 µL of lysates of virus producer cells diluted 10 5-fold in provirus-negative cells (sensitivity
reached, 1 transduced cell in 105 negative cells). In both
PCR rounds, the sense primers were located in the leader sequence of
the SF-MDR retrovirus vector backbone, whereas the antisense primers
were complementary to the 5' end of the MDR1 gene. The
first PCR round yielded an 825-base pair (bp) DNA fragment with the
sense/antisense primers 5' CGGATCGCTCACAACCAGTC 3'/5'
ACACCAGCATCATGAGAGGAAGTC 3'. The second PCR round yielded a
565-bp DNA fragment with the sense/antisense primer combination 5' ACCTTTAACG-TCGGATGGC 3'/5' CTTCTTTGCTCCTCCATTGC
3'. Amplification conditions were as follows: 95°C for 2.5 minutes, then 30 cycles at 95°C for 45 seconds, 58°C for 30 seconds, and 72°C for 1 minute, followed by extension at 72°C
for 10 minutes (PTC-200; MJ Research, Watertown, MA). For assessment of
human colonies recovered from the BM of NOD/SCID mice that had
transplantation, an internal amplification control was performed on
each colony by using primers specific for the human 2-microglobulin
gene as described53 (5' CAGG-TTTACTCACGTCATCCAGC
3'; 5' TCACATGGTTCACACGGCAGGC 3'; 232-bp product) and
primers specific for the -actin gene of human and mouse
origin53 (5' GTGACGAGG-CCCAGAGCAAGAG 3';
5' ACGCAGCTCATTGTAGAAGGTGTGG 3'; 123-bp product).
Amplification conditions for 2-microglobulin PCR were as follows:
95°C for 1 minute, then 30 cycles at 95°C for 1 minute,
66°C for 20 seconds, and 72°C for 20 seconds, followed by
extension at 72°C for 10 minutes. Amplification conditions for
-actin PCR were identical, except that only 24 cycles of amplification were done. Ten microliters of each PCR product was separated by electrophoresis on a 2% agarose gel and visualized in
UV-light after staining with ethidium bromide.
Real-time quantitative PCR DNA purified by using the QIAamp Blood Kit was digested with 30 units of RNAse A (Sigma, Deisenhofen). Triplicate samples of 5 µL of each DNA were used as templates in a duplex PCR (Kühlcke et al, unpublished data) by using the ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems, Weiterstadt, Germany). In brief, primers mdr-f 5' AGAAAGCGAAGCAGTGGTTCA 3' and mdr-r 5' CGAACTGTAGACAAACGATG-AGCTA 3' amplified a 90-bp fragment from the MDR1 cDNA (reaction 1) that was detected by the FAM-labeled TaqMan probe mdr-p 5' TGGTCCGACCTTTTCTGGCCTTATCCA 3'. Primers hck-f 5' TATTAGCACCATCCATAGGAGGCTT 3' and hck-r 5' GTTAGGG-AAAGTGGAGCGGAAG 3' amplified a 80-bp fragment from exon1 of the human hematopoietic cell kinase 1 gene54 (reaction 2) that was detected by the VIC-labeled TaqMan probe hck-p 5' TAACGCGTCCACCAAGGATGCGAA 3'. Amplification conditions were as follows: 50°C for 2.0 minutes, 95°C for 10 minutes, then 45 cycles at 95°C for 15 seconds and 60°C for 60 seconds. For each of the 2 reactions, the PCR cycle number that generated the first fluorescence signal above a threshold (the threshold cycle [CT]) was determined. The difference between the CT of reaction 1 and the CT of reaction 2 (the CT value) was then used to quantitate the
percentage of MDR1-transduced human cells with the help of a
standard curve. To obtain a standard curve over 5 log, standards for
vector copy number per cell were prepared by sorting variable numbers
of MDR1-infected K562 cells that contained a single SF-MDR
vector copy into a defined number of noninfected K562 cells. DNA
isolated from these cell mixtures and from BM of engrafted mice were
analyzed in triplicate in the real-time duplex PCR.
Statistical analysis The Student t test was used to test for significance in each set of values, assuming equal variance. Mean values ± SE are given unless otherwise stated.
In 8 experiments (8 patient samples), retroviral transduction of CD34+ PBPC was done for 96 hours with or without SCM in the presence of either IL-3 alone, IL-3/FL, IL-3/IL-6/SCF/FL, FL/TPO/SCF, or FL/TPO/VEGF by Transwell cocultivation cultures containing SF-MDR virus producer cells in the insert. We evaluated viral supernatant infection of CD34+ PBPC in 2 additional experiments (2 patient samples) by using the cytokine combinations IL-3/IL-6/SCF/FL or FL/TPO/SCF. Gene transfer into clonogenic progenitors After Transwell transduction, the level of gene transfer into myeloid lineage-committed progenitors ranged from < 5% to 45% (mean, 22%) (Table 1). The proportion of Rh-123dull cells (MDR1-expressing cells) in the myelomonocytic progeny ranged from 0.1% to 7.1% (median, 4.3%). MDR1-transduced PBPC had a median 2-log reduction in the Rh-123 fluorescence intensity compared with mock-transduced control cells (example shown in Figure 1). Addition of the P-glycoprotein inhibitor cyclosporine blocked the Rh-123 efflux from transduced cells (Figure 1), confirming that the Rh-123dull events were due to MDR1 gene expression.
Human-cell engraftment in NOD/SCID mice The repopulating ability of CD34+ PBPC transduced by Transwell cocultivation was analyzed 5 to 13 weeks after transplantation in NOD/SCID mice. Cells recovered from the BM, spleen, and PB were analyzed for the presence of human CD45+ leukocytes. Mice with < 0.1% human CD45+ cells were considered to have nonengraftment.
Detection of SF-MDR-marked human cells in BM and spleen of
chimeric NOD/SCID mice
Quantification of in vivo gene-marked human cells
Recovery of transduced and drug-resistant human CFC from chimeric
NOD/SCID mice
Retroviral transduction on CH-296 with cell-free viral
supernatant
Analysis of gene expression in chimeric mice The proportion of human Rh-123dull (MDR1-expressing) cells in human CD45+ leukocytes in unseparated whole BM of chimeric NOD/SCID mice was assessed by flow cytometry (Figure 5A). In 23 of 36 analyzed engrafted mice that had received CD34+ PBPC transduced by either Transwell cocultivation or viral supernatant infection, Rh-123dull cells in the human-cell population were detectable at low levels; the range was from 0.2% to 3.1% above the level of human CD45+/Rh-123dull cells detected in the control mice given mock-transduced CD34+ cells. A paired analysis comparing the average proportion of human CD45+/Rh-123dull cells (0.5% ± 0.1%; n = 28) with the average proportion of vector-marked human cells (10.4% ± 2.6%; n = 28) revealed that, on average, 5% of the vector-marked human cells expressed the MDR1 transgene.
In this study, we showed engraftment in NOD/SCID mice of MDR1-transduced and P-glycoprotein-expressing PBPC from patients with cancer. We achieved gene-transfer efficiencies of up to 55% in clonogenic progenitors, values similar to those reported by other groups,58-60 either by Transwell cocultivation of CD34+ PBPC with vector-producing cells or by adding viral supernatant. To analyze the engraftment capacity of transduced CD34+ PBPC and to document gene transfer and expression in human cells with in vivo repopulating potential, sublethally irradiated NOD/SCID mice were given transplants of 0.5 × 106 to 4.0 × 106 input CD34+ cells. A cell dose-dependent multilineage engraftment of up to an average of 33% human leukocytes (Table 2 and Figure 2) was observed. Differences in BM cellularity and in the proportions of human CD45+ or CD33+/CD45+ leukocytes, respectively, were not observed in NOD/SCID mice given transplants of MDR1-transduced or mock-transduced CD34+ PBPC. These data suggest that the SF-MDR vector is not toxic to SRC and does not induce a myeloproliferative state under our culture conditions and observation period of 5 to 13 weeks.61
We are grateful to the continuing support of professors A. D. Ho, A. A. Fauser, and W. Ostertag. We thank James Bender and John P. Fruehauf, both of Irvine, CA, and Fred Koller, San Diego, CA, for critically reviewing the manuscript and for helpful suggestions. We gratefully acknowledge the technical assistance of Bernhard Berkus, Hans Jürgen Engel, and Sigrid Heil and the support of the clinical stem-cell transplantation laboratory and the animal facility team of the German Cancer Research Center. Eike Buss helped in collecting clinical characteristics of the patients. The FBMD-1 cell line was provided by R. E. Ploemacher, Erasmus University, Rotterdam, The Netherlands. IL-3 was provided by Dr Färber, Novartis, Nürnberg, Germany.
Submitted December 22, 1998; accepted October 2, 1999.
Supported in part by grants 10-1018-Ze-I, 10-1294-Ze2, and 10-1063-Ba-I of the Deutsche Krebshilfe/Dr Mildred-Scheel-Stiftung and by the Herbert Daus Fund of the University of Heidelberg.
Reprints: Stefan Fruehauf, Department of Internal Medicine V, University of Heidelberg, Hospitalstr 3, 69115 Heidelberg, Germany; e-mail: stefan_fruehauf{at}med.uni-heidelberg.de.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1.
To LB, Haylock DN, Simmons PJ, Juttner CA.
The biology and clinical uses of blood stem cells.
Blood.
1997;89:2233 2. Savarese DM, Hsieh C, Stewart FM. Clinical impact of chemotherapy dose escalation in patients with hematological malignancies and solid tumors. J Clin Oncol. 1997;15:2981[Abstract].
3.
Sorrentino BP, Brandt SJ, Gottesman M, Pastan I, Cline A, Nienhuis AW.
Selection of drug-resistant bone marrow cells in vivo after retroviral transfer of the human MDR1.
Science.
1992;257:99
4.
Flasshove M, Banerjee D, Mineishi S, Li MX, Bertino JR, Moore MAS.
Ex vivo expansion and selection of human CD34+ peripheral blood progenitor cells after introduction of a mutated dihydrofolatereductase cDNA via retroviral gene transfer.
Blood.
1995;85:566
5.
Reese JS, Koc ON, Lee KM, et al.
Retroviral transduction of a mutant methylguanine DNA methyltransferase gene into human CD34 cells confers resistance to O6-benzylguanine plus 1,3-bis(2-chloroethyl)-1-nitrosourea.
Proc Natl Acad Sci U S A.
1996;93:14,088 6. Chaudhary PM, Roninson IB. Expression and activity of P-glycoprotein, a multidrug efflux pump, in human hematopoietic stem cells. Cell. 1991;66:85[Medline] [Order article via Infotrieve]. 7. Gottesman MM, Pastan I. Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu Rev Biochem. 1993;62:385[Medline] [Order article via Infotrieve]. 8. Boesen JJB, Nooter K, Valerio D. Circumvention of chemotherapy-induced myelosuppression by transfer of the mdr1 gene. Biotherapy. 1994;6:291.
9.
Mickisch GH, Aksentijevich I, Schoenlein PV, et al.
Transplantation of bone marrow cells from transgenic mice expressing the human MDR1 gene results in long-term protection against the myelosuppressive effect of chemotherapy in mice.
Blood.
1992;79:1087 10. Hanania EG, Fu S, Roninson I, Zu Z, Gottesman MM, Deisseroth AB. Resistance to Taxol chemotherapy produced in mouse marrow cells by safety-modified retroviruses containing a human MDR-1 transcription unit. Gene Ther. 1995;2:279[Medline] [Order article via Infotrieve]. 11. Kiem HP, Darovsky B, von Kalle C, et al. Long-term persistence of canine hematopoietic cells genetically marked by retrovirus vectors. Hum Gen Ther. 1995;7:89.
12.
Kiem HP, Heyward S, Winkler A, et al.
Comparison between amphotropic and gibbon ape leukemia virus pseudotyped retroviral vectors in a competitive repopulation assay in baboons.
Blood.
1997;90:4638 13. Van Beusechem VW, Valerio D. Gene transfer into hematopoietic stem cells of nonhuman primates. Hum Gene Ther. 1996;7:1649[Medline] [Order article via Infotrieve].
14.
Hesdorffer C, Ayello J, Ward M, et al.
Phase I clinical trial of retroviral-mediated transfer of the human MDR1 gene as marrow chemoprotection in patients undergoing high-dose chemotherapy and autologous stem-cell transplantation.
J Clin Oncol.
1998;16:165
15.
Deisseroth AB, Zu Z, Claxton D, et al.
Genetic marking shows that Ph+ cells present in autologous transplants of chronic myelogenous leukemia (CML) contribute to relapse after autologous bone marrow transplantation in CML.
Blood.
1994;83:3068
16.
Dunbar C, Cottler-Fox M, O'Shaughnessey JA, et al.
Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation.
Blood.
1995;85:3048
17.
Emmons RVB, Doren S, Zujewski J, et al.
Retroviral gene transduction of adult peripheral blood or marrow-derived CD34+ cells for six hours without growth factors or on autologous stroma does not improve marking efficiency assessed in vivo.
Blood.
1997;89:4040
18.
Miller DG, Adam MA, Miller AD.
Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection.
Mol Cell Biol.
1990;10:4239
19.
Lewis PF, Emerman M.
Passage through mitosis is required for oncoretroviruses but not for human immunodeficiency virus.
J Virol.
1994;68:510
20.
Challita P-M, Kohn DB.
Lack of expression from a retroviral vector after transduction of murine hematopoietic stem cells is associated with methylation in vivo.
Proc Natl Acad Sci U S A.
1994;91:2567 21. Lu M, Zhang N, Maruyama M, Hawley RG, Ho AD. Retrovirus-mediated gene expression in hematopoietic cells correlates inversely with growth factor stimulation. Hum Gene Ther. 1996;7:2263[Medline] [Order article via Infotrieve].
22.
Greiner DL, Hesselton RA, Shultz LD.
SCID mouse models of human stem cell engraftment.
Stem Cells.
1998;16:166
23.
Kamel-Reid S, Dick J.
Engraftment of immuno-deficient mice with human hematopoietic stem cells.
Science.
1988;242:1706
24.
Lapidot T, Pflumio F, Doedens CE, Murdoch B, Williams DE, Dick JE.
Cytokine stimulation of multilineage hematopoiesis from immature human cells engrafted in SCID mice.
Science.
1992;255:1137
25.
Larochelle A, Vormoor J, Lapidot T, et al.
Engraftment of immune-deficient mice with primitive hematopoietic cells from
26.
Nolta JA, Hanley MB, Kohn DB.
Sustained human hematopoiesis in immunodeficient mice by cotransplantation of marrow stroma expressing human interleukin-3: analysis of gene-transduction of long-lived progenitors.
Blood.
1994;83:3041
27.
McCune JM, Namikawa R, Kaneshima H, Shultz LD, Lieberman M, Weissman IL.
The SCID-hu mouse: murine model for the analysis of human hematolymphoid differentiation and function.
Science.
1988;241:1632
28.
Namikawa R, Weilbaecher KN, Kaneshima H, Yee EJ, McCune JM.
Long-term hematopoiesis in the SCID-hu mouse.
J Exp Med.
1990;172:1055
29.
Kyoizumi S, Baum CM, Kaneshima H, McCune JM, Yee EJ, Namikawa R.
Implantation and maintenance of functional human bone marrow in SCID-hu mice.
Blood.
1992;79:1704 30. Shultz LD, Schweitzer PA, Christianson SW, et al. Multiple defects in innate and adaptive immunologic function in NOD/LtSz-Scid mice. J Immunol. 1995;154:180[Abstract]. 31. Larochelle A, Vormoor J, Hanenberg H, et al. Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: implications for gene therapy. Nature Med. 1996;2:1329[Medline] [Order article via Infotrieve]. 32. Wermann K, Fruehauf S, Haas R, Zeller WJ. Human-mouse-xenografts in stem cell research. J Hematother. 1996;5:379[Medline] [Order article via Infotrieve].
33.
Cashman JD, Lapidot T, Wang JCY, et al.
Kinetic evidence of regeneration of multilineage hematopoiesis from primitive cells in normal human bone marrow transplanted into immunodeficient mice.
Blood.
1997;89:4307
34.
Bhatia M, Wang JCY, Kapp U, et al.
Purification of primitive human hematopoietic cells capable of repopulating immune-deficient mice.
Proc Natl Acad Sci U S A.
1997;94:5320
35.
Wang JCY, Doedens M, Dick JE.
Primitive human hematopoietic cells are enriched in cord blood compared with adult bone marrow or mobilized peripheral blood as measured by the quantitative in vivo SCID-repopulating cell assay.
Blood.
1997;89:3919
36.
Gan OI, Murdoch B, Larochelle A, Dick JE.
Differential maintenance of primitive human SCID-repopulating cells, clonogenic progenitors, and long-term culture-initiating cells after incubation on human bone marrow stromal cells.
Blood.
1997;90:641
37.
Hao QL, Thiemann FT, Petersen D, Smogorzewska EM, Crooks GM.
Extended long-term culture reveals a highly quiescent and primitive human hematopoietic progenitor population.
Blood.
1996;88:3306
38.
Gothot A, van der Loo JCM, Clapp DW, Srour EF.
Cell-cycle related changes in repopulating capacity of human mobilized peripheral blood CD34+ cells in non-obese diabetic/severe combined immune-deficient mice.
Blood.
1998;92:2641
39.
Dao MA, Shah AJ, Crooks GM, Nolta JA.
Engraftment and retroviral marking of CD34+ and CD34+CD38
40.
Xu LC, Kluepfel-Stahl S, Blanco M, Schiffman R, Dunbar C, Carlsson S.
Growth factors and stromal support generate very efficient retroviral transduction of peripheral blood CD34 cells from Gaucher patients.
Blood.
1995;86:141 41. Ward M, Piolo P, Ayello J, et al. Retroviral transfer and expression of the human multidrug resistance (MDR) gene in peripheral blood progenitor cells. Clin Cancer Res. 1996;2:873[Abstract].
42.
Bertolini F, Battaglia M, Corsini C, et al.
Engineered stromal layers and continuous flow culture enhance multidrug resistance gene transfer in hematopoietic progenitors.
Cancer Res.
1996;56:2566 43. Fruehauf S, Breems DA, Knaän-Shanzer, et al. Frequency analysis of multidrug resistance-1 gene transfer into human primitive hematopoietic progenitor cells using the cobblestone area-forming cell assay and detection of vector-mediated P-glycoprotein expression by rhodamine-123. Hum Gene Ther. 1996;7:1219[Medline] [Order article via Infotrieve]. 44. Baum C, Hegewisch-Becker S, Eckert HG, Stocking C, Ostertag W. Novel retroviral vectors for efficient expression of the multidrug resistance (mdr-1) gene in early hematopoietic cells. J Virol. 1995;69:7541[Abstract].
45.
Eckert HG, Stockschläder M, Just U, et al.
High-dose multidrug resistance in primary human hematopoietic progenitor cells transduced with optimized retroviral vectors.
Blood.
1996;88:3407
46.
Nolta JA, Smogorzewska EM, Kohn DB.
Analysis of optimal conditions for retroviral-mediated transduction of primitive human hematopoietic cells.
Blood.
1995;86:101 47. Wells S, Malik P, Ruscero M, Kohn DD, Nolta JA. The presence of autologous stromal cell layer increases glucocerebrosidase gene transduction of long-term culture-initiating cells (LTCIC's) from the bone marrow of a patient with Gaucher disease. Gene Ther. 1995;2:512[Medline] [Order article via Infotrieve]. 48. Breems DA, Blokland EAW, Neben S, Ploemacher RE. Frequency analysis of human primitive hematopoietic stem cell subsets using a cobblestone area forming cell assay. Leukemia. 1994;8:1095[Medline] [Order article via Infotrieve]. 49. Hanenberg H, Xiao XL, Dilloo D, Hashinao K, Williams DA. Colocalization of retrovirus and target cells on specific fibronectin fragments increases genetic transduction of mammalian cells. Nature Med. 1996;2:876[Medline] [Order article via Infotrieve].
50.
Moritz T, Dutt P, Xiao X, et al.
Fibronectin improves transduction of reconstituting hematopoietic stem cells by retroviral vectors: evidence for direct viral binding to chymotryptic carboxy-terminal fragments.
Blood.
1996;88:855 51. Moritz T, Patel VP, Williams DA. Bone marrow extracellular matrix molecules improve gene transfer into human hematopoietic cells via retroviral vectors. J Clin Invest. 1994;93:1451. 52. Smith SL, Bender JG, Maples PB, et al. Expansion of neutrophil precursors and progenitors in suspension cultures of CD34+ cells enriched from human bone marrow. Exp Hematol. 1993;21:870[Medline] [Order article via Infotrieve].
53.
Schwarzenberger P, Spence S, Lohrey N, et al.
Gene transfer of multidrug resistance into a factor-dependent human hematopoietic progenitor cell line: in vivo model for genetically transferred chemoprotection.
Blood.
1996;87:2723 54. Lichtenberg U, Quintrell N, Bishop JM. Human protein-tyrosine kinase gene HCK: expression and structural analysis of the promotor region. Oncogene 1992;7:849[Medline] [Order article via Infotrieve].
55.
Van Beusechem VW, Kukler A, Heidt PJ, Valerio D.
Long-term expression of human adenosine deaminase in rhesus monkeys transplanted with retrovirus-infected bone-marrow cells.
Proc Natl Acad Sci U S A.
1992;89:7640
56.
Klimecki WT, Futscher BW, Grogan TM, Dalton WS.
P-glycoprotein expression and function in circulating blood cells from normal donor volunteers.
Blood.
1994;83:2451
57.
Chaudhary PM, Mechetner EB, Roninson IB.
Expression and activity of the multidrug resistant P-glycoprotein in human peripheral blood lymphocytes.
Blood.
1992;80:2735 58. Cassel A, Cottler-Fox M, Doren S, Dunbar CE. Retroviral-mediated gene transfer into CD34-enriched human peripheral blood stem cells. Exp Hematol. 1993;21:585[Medline] [Order article via Infotrieve]. 59. Lu M, Maruyama M, Zhang N, Levine F, Friedman T, Ho AD. High efficiency retroviral-mediated gene transduction into CD34+ cells purified from peripheral blood of breast cancer patients primed with chemotherapy and granulocyte-macrophage colony-stimulating factor. Hum Gene Ther. 1994;5:203[Medline] [Order article via Infotrieve].
60.
Elwood NJ, Zogos H, Willson T, Begley CG.
Retroviral transduction of human progenitor cells. Use of granulocyte colony-stimulating factor plus stem cell factor to mobilize progenitor cells in vivo and stimulation by Flt3/Flk-2 ligand in vitro.
Blood.
1996;88:4452
61.
Bunting KD, Galipeau J, Topham D, Benaim E, Sorrentino B.
Transduction of murine bone marrow cells with an MDR1 vector enables ex vivo stem cell expansion, but these expanded grafts cause a myeloproliferative syndrome in transplanted mice.
Blood.
1998;92:2269 62. Hogan CJ, Shpall EJ, McNiece I, Keller G. Multilineage engraftment in NOD/LtSz-sic/scid mice from mobilized human CD34+ peripheral blood progenitor cells. Biol Blood Marrow Transplant. 1997;3:236[Medline] [Order article via Infotrieve].
63.
van der Loo JCM, Hanenberg H, Cooper RJ, Luo FY, Lazaridis EN, Williams DA.
Nonobese diabetic/severe combined immunodeficiency (NOD/SCID) mouse as a model system to study the engraftment and mobilization of human peripheral stem cells.
Blood.
1998;92:2556
64.
Vormoor J, Lapidot T, Pflumio F, et al.
Immature human cord blood progenitors engraft and proliferate to high levels in severe combined immunodeficient mice.
Blood.
1994;83:2489
65.
Hogan CJ, Shpall EJ, McNuley O, et al.
Engraftment and development of human CD34+-enriched cells from umbilical cord blood in NOD/Ltz-scid/scid mice.
Blood.
1997;90:85
66.
Bertolini F, Battaglia M, Lanza A, et al.
Multilineage long-term engraftment potential of drug-resistant hematopoietic progenitors.
Blood.
1997;90:3027
67.
Goan SR, Fichtner I, Just U, et al.
The severe combined immunodeficient-human peripheral blood stem cell (SCID-huPBSC) mouse: a xenotransplant model for huPBSC-initiated hematopoiesis.
Blood.
1995;86:89
68.
Schilz AJ, Brouns G, Knoss H, et al.
High efficiency gene transfer to human hematopoietic SCID-repopulating cells under serum-free conditions.
Blood.
1998;92:3163
69.
Van Hennik PB, Verstegen MMA, Bierhuizen MF, et al.
Highly efficient transduction of the green fluorescent protein in human umbilical cord blood stem cells capable of cobblestone formation in long-term cultures and multilineage engraftment of immunodeficient mice.
Blood.
1998;92:4013
70.
Cheng L, Du C, Lavau C, et al.
Sustained gene expression in retrovirally transduced, engrafting human stem cells and their lympho-myeloid progeny.
Blood.
1998;92:83 71. Fruehauf S, Wermann K, Buss EC, et al. Protection of hematopoietic stem cells from chemotherapy-induced toxicity by multidrug resistance 1 gene transfer. Recent Results Cancer Res. 1998;144:93[Medline] [Order article via Infotrieve].
72.
Conneally E, Cashman J, Petzer A, Eaves C.
Expansion in vitro of transplantable human cord blood stem cells demonstrated using a quantitative assay of their lympho-myeloid repopulating activity in nonobese diabetic-SCID/SCID mice.
Proc Natl Acad Sci U S A.
1997;94:9836
73.
Bhatia M, Bonnet D, Kapp U, Wang JCY, Murdoch B, Dick JE.
Quantitative analysis reveals expansion of human hematopoietic repopulating cells after short-term ex vivo culture.
J Exp Med.
1997;186:619
74.
Dao MA, Hannum CH, Kohn DB, Nolta JA.
FLT3 ligand preserves the ability of human CD34+ progenitors to sustain long-term hematopoiesis in immune-deficient mice after ex vivo retroviral-mediated transduction.
Blood.
1997;89:446
75.
Dao MA, Hashino K, Kato I, Nolta JA.
Adhesion to fibronectin maintains regenerative capacity during ex vivo culture and transduction of human hematopoietic stem and progenitor cells.
Blood.
1998;92:4612
76.
Lyman SD, Jacobsen SEW.
C-kit ligand and flt3 ligand, stem/progenitor cell factors with overlapping yet distinct activities.
Blood.
1998;91:1101
77.
Rebel VI, Tanaka M, Lee J-S.
One-day ex vivo culture allows effective gene transfer into nonobese diabetic/severe combined immune-deficient repopulating cells using high-titer vesicular stomatitis virus G pseudotyped retrovirus.
Blood.
1999;93:2217
78.
Tisdale JF, Hanazono Y, Seller SE, et al.
Ex vivo expansion of genetically marked rhesus peripheral blood progenitor cells results in diminished long-term repopulating ability.
Blood.
1998;92:1131
79.
Kiem HP, Andrews RG, Morris J, et al.
Improved gene transfer into baboon marrow repopulating cells using recombinant human fibronectin fragment CH-296 in combination with interleukin-6, stem cell factor, FLT-3 ligand, and megakaryocyte growth and development factor.
Blood.
1998;92:1878
80.
Conneally E, Eaves CJ, Humphries RK.
Efficient retroviral-mediated gene transfer to human cord blood stem cells with in vivo repopulating potential.
Blood.
1998;91:3487
81.
Luens KM, Travis MA, Chen BP, Hill BL, Scollay R, Murray LJ.
Thrombopoietin, kit ligand and flt2/flt3 ligand together induce increased numbers of primitive hematopoietic progenitors from human CD34+ Thy-1+ Lin 82. Naldini L, Blömer U, Gallay P, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 1996;272:263[Abstract].
83.
Reiser J, Harmison G, Kluepfel-Stahl S, Brady RO, Karlsson S, Schubert M.
Transduction of nondividing cells using pseudotyped defective high-titer HIV type 1 particles.
Proc Natl Acad Sci U S A.
1996;93:15,266
84.
Miyoshi H, Smith KA, Mosier DE, Verma IM, Torbett BE.
Transduction of human CD34+ cells that mediate long-term engraftment of NOD/SCID mice by HIV vectors.
Science.
1999;283:682
85.
Sorrentino BP, McDonagh KT, Woods D, Orlic D.
Expression of retroviral vectors containing the human multidrug resistance 1 cDNA in hematopoietic cells of transplanted mice.
Blood.
1995;86:491 86. Zaboikin MM, Schuening FG. Poor expression of MDR1 transgene in HeLa cells by bicistronic Moloney murine leukemia virus-based vector. Hum Gene Ther. 1998;9:2263[Medline] [Order article via Infotrieve]. 87. Hildinger M, Fehse B, Hegewisch-Becker S, et al. Dominant selection of hematopoietic progenitor cells with retroviral MDR1 co-expression vectors. Hum Gene Ther. 1998;9:33[Medline] [Order article via Infotrieve]. 88. Hawely RG, Lieu FHL, Fong AZC, Hawley TS. Versatile retroviral vectors for potential use in gene therapy. Gene Ther. 1994;1:136[Medline] [Order article via Infotrieve].
89.
Hildinger M, Abel KL, Ostertag W, Baum C.
Design of 5' untranslated sequences in retroviral vectors developed for medical use.
J Virol.
1999;73:4083
90.
Jiang G, Mathias LA, Xu D, Pepper K, Malik P.
Hepatitis virus posttranscriptional RNA export element (HPRE) can increase expression from retroviral vectors and may improve the transport of intronless RNA of the normally intron-dependent
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  M. Schaich, L. Kestel, M. Pfirrmann, K. Robel, T. Illmer, M. Kramer, C. Dill, G. Ehninger, G. Schackert, and D. Krex A MDR1 (ABCB1) gene single nucleotide polymorphism predicts outcome of temozolomide treatment in glioblastoma patients Ann. Onc., January 1, 2009; 20(1): 175 - 181. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Bleier, P. Maier, H. Allgayer, F. Wenz, W. J. Zeller, S. Fruehauf, and S. Laufs Multiple Displacement Amplification Enables Large-Scale Clonal Analysis following Retroviral Gene Therapy J. Virol., March 1, 2008; 82(5): 2448 - 2455. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Bozorgmehr, S. Laufs, S. E. Sellers, I. Roeder, W. J. Zeller, C. E. Dunbar, and S. Fruehauf No Evidence of Clonal Dominance in Primates up to 4 Years Following Transplantation of Multidrug Resistance 1 Retrovirally Transduced Long-Term Repopulating Cells Stem Cells, October 1, 2007; 25(10): 2610 - 2618. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Wagner, S. Laufs, J. Blake, C. Schwager, X. Wu, J. W. Zeller, A. D. Ho, and S. Fruehauf Retroviral Integration Sites Correlate with Expressed Genes in Hematopoietic Stem Cells Stem Cells, September 1, 2005; 23(8): 1050 - 1058. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Wagner, A. Ansorge, U. Wirkner, V. Eckstein, C. Schwager, J. Blake, K. Miesala, J. Selig, R. Saffrich, W. Ansorge, et al. Molecular evidence for stem cell function of the slow-dividing fraction among human hematopoietic progenitor cells by genome-wide analysis Blood, August 1, 2004; 104(3): 675 - 686. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Z. Nagy, S. Laufs, B. Gentner, S. Naundorf, K. Kuehlcke, J. Topaly, E. C. Buss, W. J. Zeller, and S. Fruehauf Clonal Analysis of Individual Marrow-Repopulating Cells after Experimental Peripheral Blood Progenitor Cell Transplantation Stem Cells, July 1, 2004; 22(4): 570 - 579. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Steinbach, S. Wittig, G. Cario, S. Viehmann, A. Mueller, B. Gruhn, R. Haefer, F. Zintl, and A. Sauerbrey The multidrug resistance-associated protein 3 (MRP3) is associated with a poor outcome in childhood ALL and may account for the worse prognosis in male patients and T-cell immunophenotype Blood, December 15, 2003; 102(13): 4493 - 4498. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Brenner, N. L. Whiting-Theobald, G. F. Linton, K. L. Holmes, M. Anderson-Cohen, P. F. Kelly, E. F. Vanin, A. M. Pilon, D. M. Bodine, M. E. Horwitz, et al. Concentrated RD114-pseudotyped MFGS-gp91phox vector achieves high levels of functional correction of the chronic granulomatous disease oxidase defect in NOD/SCID/{beta}2-microglobulin-/- repopulating mobilized human peripheral blood CD34+ cells Blood, October 15, 2003; 102(8): 2789 - 2797. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Laufs, B. Gentner, K. Z. Nagy, A. Jauch, A. Benner, S. Naundorf, K. Kuehlcke, B. Schiedlmeier, A. D. Ho, W. J. Zeller, et al. Retroviral vector integration occurs in preferred genomic targets of human bone marrow-repopulating cells Blood, March 15, 2003; 101(6): 2191 - 2198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Roesler, S. Brenner, A. A. Bukovsky, N. Whiting-Theobald, T. Dull, M. Kelly, C. I. Civin, and H. L. Malech Third-generation, self-inactivating gp91phox lentivector corrects the oxidase defect in NOD/SCID mouse-repopulating peripheral blood-mobilized CD34+ cells from patients with X-linked chronic granulomatous disease Blood, December 15, 2002; 100(13): 4381 - 4390. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Illmer, U. S. Schuler, C. Thiede, U. I. Schwarz, R. B. Kim, S. Gotthard, D. Freund, U. Schakel, G. Ehninger, and M. Schaich MDR1 Gene Polymorphisms Affect Therapy Outcome in Acute Myeloid Leukemia Patients Cancer Res., September 1, 2002; 62(17): 4955 - 4962. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F Xue, T Takahara, Y Yata, M Minemura, C Y Morioka, S Takahara, E Yamato, K Dono, and A Watanabe Attenuated acute liver injury in mice by naked hepatocyte growth factor gene transfer into skeletal muscle with electroporation Gut, April 1, 2002; 50(4): 558 - 562. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Scherr, K. Battmer, U. Blomer, B. Schiedlmeier, A. Ganser, M. Grez, and M. Eder Lentiviral gene transfer into peripheral blood-derived CD34+ NOD/SCID-repopulating cells Blood, January 15, 2002; 99(2): 709 - 712. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Gatlin, M. W. Melkus, A. Padgett, P. F. Kelly, and J. V. Garcia Engraftment of NOD/SCID Mice with Human CD34+ Cells Transduced by Concentrated Oncoretroviral Vector Particles Pseudotyped with the Feline Endogenous Retrovirus (RD114) Envelope Protein J. Virol., October 15, 2001; 75(20): 9995 - 9999. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. S. An, S. K. P. Kung, A. Bonifacino, R. P. Wersto, M. E. Metzger, B. A. Agricola, S. H. Mao, I. S. Y. Chen, and R. E. Donahue Lentivirus Vector-Mediated Hematopoietic Stem Cell Gene Transfer of Common Gamma-Chain Cytokine Receptor in Rhesus Macaques J. Virol., April 15, 2001; 75(8): 3547 - 3555. [Abstract] [Full Text]
|
|
|
|
|
|
L. E. Perez, H. M. Rinder, C. Wang, J. B. Tracey, N. Maun, and D. S. Krause Xenotransplantation of immunodeficient mice with mobilized human blood CD34+ cells provides an in vivo model for human megakaryocytopoiesis and platelet production Blood, March 15, 2001; 97(6): 1635 - 1643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Rovira, M. De Angioletti, O. Camacho-Vanegas, D. Liu, V. Rosti, H. F. Gallardo, R. Notaro, M. Sadelain, and L. Luzzatto Stable in vivo expression of glucose-6-phosphate dehydrogenase (G6PD) and rescue of G6PD deficiency in stem cells by gene transfer Blood, December 15, 2000; 96(13): 4111 - 4117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. A. Williams, A. W. Nienhuis, R. G. Hawley, and F. O. Smith Gene Therapy 2000 Hematology, January 1, 2000; 2000(1): 376 - 393. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
), spleen (
), and peripheral blood (
) determined by
FACS are shown as mean ± SE values. In each experiment, normal
human PB and mice not given transplants were analyzed as controls.
Comparison of human-cell engraftment between mice injected
with 5 × 105 CD34+ cells after retroviral
transduction in the presence of IL-3 or IL-3/FL yielded
P = .01 (**). The 3 denotes IL-3; 6, IL-6; FL, Flt3-ligand;
T, thrombopoietin; S, stem-cell factor; and V, vascular epithelial
growth factor.
1 × 106 CD34+ PBPC per graft (Table
one amplicon from the vector-derived MDR1 cDNA and one
from the human hematopoietic cell kinase (HCK) gene