SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Matsuguchi, T. Articles by Yoshikai, Y. Search for Related Content PubMed PubMed Citation Articles by Matsuguchi, T. Articles by Yoshikai, Y. Related Collections Immunobiology Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 95 No. 4 (February 15), 2000: pp. 1378-1385 IMMUNOBIOLOGY Gene expressions of lipopolysaccharide receptors, toll-like receptors 2 and 4, are differently regulated in mouse T lymphocytes Tetsuya Matsuguchi, Kensuke Takagi, Tipayaratn Musikacharoen, and Yasunobu Yoshikai From the Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Nagoya, Japan.     Abstract Top Abstract Introduction Materials and methods Results Discussion References Toll-like receptors (TLRs) are a family of mammalian proteins homologous to Drosophila Toll. Human TLR2 was shown to mediate the responsiveness to lipopolysaccharide (LPS). On the other hand, gene mutations of mouse TLR4 (mTLR4) in LPS-hyporesponsive strains have suggested that mTLR4 is essential for LPS-signaling in mice, but the role of mTLR2 has not been explored. This report describes molecular cloning of the mTLR2 cDNA. Overexpression of mTLR2 and mouse CD14 conferred LPS-inducibility of c-Jun N-terminal kinase phosphorylation and nuclear factor-B activation to COS7 cells, suggesting that mTLR2 is a signaling receptor for LPS. Both mTLR2 and mTLR4 genes were expressed in T cells. Treatment with anti-CD3, PMA plus ionomycin, or interleukin-2 (IL-2)/IL-15 increased mTLR2 but not mTLR4 messenger RNA (mRNA) in some T cell lines. Specific inhibitors of mitogen-activated extracellular signal-regulated kinase and fusion protein 38 (p38) kinase inhibited mTLR2 mRNA up-regulation by PMA plus ionomycin. This suggests that extracellular signal-regulated kinase and p38 kinase pathways were involved. Additionally, LPS treatment of EL-4 cell line decreased IL-4 gene expression. Our results indicate that both mTLR2 and mTLR4 are involved in LPS signaling, but their expressions are regulated differently in T cells, and that LPS may directly affect T-cell functions by binding to TLRs. (Blood. 2000;95:1378-1385) © 2000 by The American Society of Hematology.     Introduction Top Abstract Introduction Materials and methods Results Discussion References Gram-negative bacteria represent a major group of pathogens causing serious infection, especially among the elderly and immunocompromised humans. A glycolipid known as endotoxin or lipopolysaccharide (LPS) is the principal bacterial constituent recognized by the innate immune system. LPS is a complex glycolipid composed of a hydrophilic polysaccharide portion and a hydrophobic domain known as lipid A.1 The conserved lipid A has been identified as responsible for LPS-induced biological effects.1 LPS stimulates host cells such as monocytes, macrophages, and B cells through the activation of transcription factors and protein kinases including NF-B,2,3 AP-1,3 extracellular signal-regulated kinases (ERKs),4,5 c-Jun N-terminal kinases (JNKs),6,7 and fusion protein 38 (p38) kinases.8,9 Although there are some lines of evidence that a significant fraction of T cells respond to LPS,10,11 its direct effects on T cells have not been fully elucidated. CD14 is involved in mediating LPS responses by binding LPS with high affinity.12 This binding requires a serum factor, LPS binding protein (LBP),13,14 which is a plasma lipid transfer protein that transfers LPS from the bacterial membrane to a binding site on CD14.15 In cells lacking CD14, the soluble form of CD14 (sCD14) in serum functionally replaces membrane-bound CD14.16,17 However, since CD14 is a glycosylphosphatidylinositol-anchored (GPI-anchored) protein, the existence of a signaling component was presumed in the LPS receptor complex. Toll, first identified as a protein-controlling dorsoventrad pattern formation in the early development of Drosophila,18 was shown to participate in antimicrobial immune responses.19 Toll has been shown to be conserved in various species, and it encodes a transmembrane protein with an intracellular portion that is homologous to that of the interleukin-1 (IL-1) receptor family proteins.18 Recently, several mammalian Toll homologues have been identified.20 In addition to their cytoplasmic portion, they share repeating leucine-rich motifs (LRRs) in their extracellular region. One of the human Toll homologues, Toll-like receptor 2 (TLR2), has been shown to be involved in LPS signaling by 2 groups.21,22 Cells transfected with the human TLR2 (hTLR2) complementary DNA (cDNA) acquired the capability for LPS-mediated signaling. There are 2 strains in mice (C3H/HeJ and C57BL10/ScCr) that exhibit an impaired ability to respond to LPS. Two recent studies found that the TLR4 gene in the chromosomal region was responsible for this defect (lps).23,24 These studies also found a missense mutation in the cytoplasmic domain of TLR4 in C3H/HeJ, which strongly suggests that TLR4 is the dominant receptor for at least some types of LPS. On the other hand, the role of mouse TLR2 (mTLR2) in LPS signaling has not been explored. In this paper we report the molecular cloning of mTLR2 cDNA. Exogenous expression of mTLR2 in cells mediates LPS-induced intracellular signals, which suggests that mTLR2 is also involved in LPS responsiveness in mice. Although both mTLR2 and mTLR4 genes are expressed in T cells, the gene expression of mTLR2 but not that of mTLR4 is significantly increased by stimuli such as TCR stimulation and cytokine treatment. This suggests that theexpressions of LPS receptors, mTLR2 and mTLR4, are differently regulated in T cells.     Materials and methods Top Abstract Introduction Materials and methods Results Discussion References Reagents and antibodies We used the following for the study: recombinant mouse IL-2 and human IL-15 (Peprotech, Seattle, WA); PD98 059, a specific inhibitor of mitogen-activated ERK kinase (MEK), and SB208 530, a specific inhibitor of p38 kinase (Calbiochem, San Diego, CA); LPS from Escherichia coli serotype B6: 026 and PMA (Sigma, St. Louis, MO); RPMI 1640 medium (Gibco BRL, Rockville, MD); and fetal calf serum (FCS) (Sigma). Antibodies included antimouse CD14 monoclonal antibody (mAb) (PharMingen, San Diego, CA); anti-Flag M2 mAb (Sigma Science); anti-phospho-JNK mAb (New England Biolabs, Beverly, MA); and anti-JNK1 polyclonal antibody (pAb) (Santa Cruz Biotechnology, Santa Cruz, CA), which recognizes JNK1, 2, and 3 isoforms. Cell lines All cell lines were grown in tissue culture flasks at 37°C in 5% carbon dioxide/95% air and passaged every 2 or 3 days to maintain logarithmic growth. Mouse T cell lines, EL-4 and S49.1 (American Type Culture Collection (ATCC), Rockville, MD), were maintained in RPMI 1640 medium with 10% FCS. A mouse T cell line, CTLL-2 (RIKEN Cell Bank, Tsukuba, Japan), was maintained in RPMI 1640 medium with 10% FCS and 10 ng/mL mouse IL-2. A Simian virus (SV)-40-transformed monkey kidney cell line, COS7 (ATCC), was maintained in Iscove's Modified Dulbecco's Medium (IMDM) supplemented with 10% FCS. Enrichment of splenic T cells T-cell enrichment was performed using nylon wool columns as previously described.25 Briefly, packed sterile nylon wool in a 10 mL syringe was equilibrated with complete medium. Then splenocytes suspended in complete medium were applied to the column. The cells were incubated for 1 hour at 37°C, and the nonadherent cells were obtained as a T-cell-enriched population by washing the column with 10 mL of complete medium. The obtained enriched cells that were more than 95% positive for CD3 by flow cytometry were used for the further study. Isolation of the full-length cDNA clone encoding mTLR2 In an effort to clone mTLR2 cDNA, 2 primers (TGCTGGAGCCCATTGAGAGGA and GGACTTTATTGCAGTTCTCAG) were prepared based on the sequence information of the 2 mouse expressed sequence tag (est) clones (accession numbers AI020 960 and AA863 729) homologous to hTLR2 cDNA. A partial cDNA was prepared by reverse transcriptase-polymerase chain reaction (RT-PCR) using these primers and the total RNA prepared from a mouse macrophage cell line, J774.1. The synthesized 0.9-kilobase (kb) cDNA fragment was 32P-labeled by random priming and used for screening a J774.1 cDNA library that was constructed in a cloning vector (Uni-Zap; Stratagene, La Jolla, CA) (gift of Dr H. Yagita, Juntendo University, Tokyo, Japan). Plaque hybridization was conducted as previously described.26 The inserts of the positive phage clones were excised (Rapid Excision Kit, Stratagene) according to the manufacturer's instructions to generate subclones in the plasmid (pBlueScript, Stratagene). DNA sequence analysis was performed on these plasmid clones using a DNA sequencer and a cycle sequencing kit (model 373A sequencer, Thermo Sequence; PE Biosystems, Forest City, CA). Expression plasmids The coding region of mouse CD14 was amplified by RT-PCR from total RNA isolated from J774.1 and inserted into a mammalian expression vector, pcDNA3.1(+) (Invitrogen, Carlsbad, CA). For the Flag-tagged mTLR2 expression plasmid, the coding region of mTLR2 was amplified by PCR from the isolated mTLR2 cDNA and cloned into the AscI site of the expression plasmid pEFBOS-Flag,27 which encodes a C-terminal Flag epitope. The coding region of a constitutively active MEK1,28 a dominant negative JNK1,29 and a dominant negative H-Ras30 were cloned into the pEGFP-C1 vector (Clontech, Palo Alto, CA). The structure of the constructs was confirmed by restriction enzyme mapping and DNA sequence analysis. Transient transfection COS7 cells were plated onto 60-mm plates at 1 × 106 cells/plate on the day before transfection. Combinations of expression plasmid DNAs (6 µg total/plate) were transfected (Lipofectamine, Gibco BRL) according to the manufacturer's instructions. Cells were harvested 48 hours later with PBS and used for further analyses. Flow cytometry COS7 cells were incubated with anti-mCD14 mAb. After washes with staining buffer, goat antirat immunoglobulin G fluorescein isothiocyanate (IgG-FITC) (PharMingen) was added. Cells were analyzed by a fluorescence-activated cell sorter (FACSCalibur; Becton Dickinson, San Jose, CA). Northern blot analysis Total cellular RNA was extracted (TRIZOL reagent; Gibco BRL, Rockville, MD) according to the manufacturer's instructions. Messenger RNA (mRNA) was extracted (QuickPrep Micro mRNA Purification Kit; Amersham Pharmacia Biotech, Piscataway, NJ) according to the manufacturer's instructions. We fractionated 10-µg aliquots of the total RNA or 5-µg aliquots of the total mRNA on a 1% agarose gel containing 20 mmol/L morpholinopropane sulfonic acid (MOPS), 5 mmol/L sodium acetate, 1 mmol/L EDTA (ethylenediaminetetraacetic acid, pH 7.0), and 6% (vol/vol) formaldehyde. The aliquots were then transferred to a nylon membrane. After ultraviolet-crosslinking (UV-crosslinking), membranes were soaked in prehybridization solution (6 × SSC [standard saline citrate], 5 × Denhardt's reagent, 0.5% SDS [sodium dodecyl sulfate], 100 mg/mL denatured salmon sperm DNA, and 50% formamide) for 3 hours at 42°C followed by incubation with a 32P-labeled probe in hybridization solution (6 × SSC, 0.5% SDS, 100 mg/mL denatured salmon sperm DNA, and 50% formamide) for 14 hours at 42°C. The membranes were washed twice in 2 × SSC and 0.1% SDS for 10 minutes at room temperature, washed twice in 0.1 × SSC and 0.1% SDS for 10 minutes at 50°C, and then exposed to film (Fuji RX-U films; Fuji Film, Tokyo, Japan). Reverse transcriptase-polymerase chain reaction Total cellular RNA was prepared (TRIZOL reagent, Gibco BRL). cDNA was synthesized from 2 µg of the total RNA by extension of random primers with 200 units (Superscript II, Gibco BRL). PCR of the cDNA was performed in a final volume of 50 µL containing 2.5 mmol/L magnesium dichloride (MgCl2), 2.5 units (AmpliTaq; Perkin-Elmer, Norwalk, CT), and 1 µmol/L specific primers (geneAmp 2400 PCR system, Perkin-Elmer). The synthesized PCR products were separated by electrophoresis on a 2% agarose gel and visualized by ethidium bromide staining. The primers were: mouse (m) -actin sense, TGGAATCCTGTGGCATCCATGAAAC; -actin antisense, TAAAACGCAGCTCAGTAACAGTCCG; mTLR2 sense, CAGCTTAAAGGGCGGGTCAGAG; mTLR2 antisense, TGGAGACGCCAGCTCTGGCTCA; mTLR4 sense, AGTGGGTCAAGGAACAGAAGCA; mTLR4 antisense, CTTTACCAGCTCATTTCTCACC; mIL-4 sense, CTAGCCTGAGTTCTCTTG; mIL-4 antisense, GAGTCAACATCTGCCTTCAC; mouse interferon  (mIFN) sense, CTTCAAGATACAAGTGACCG; and mIFN antisense, TTCGGTAATGGACTTGCACA. Isolation of S49.1 stable transfectants S49.1 cells were transfected with an electroporator using 20 µg plasmid DNA and a setting of 800 millifarad (mF) and 300 V. Transfectants were selected with G418 (1 mg/mL). Resistant clones were screened for green fluorescent protein (GFP) fusion protein expression by flow cytometry. The expression of the right-sized protein was confirmed by Western blot analysis. Extract preparation and immunoblotting Cells were lysed in the following phospholipase C (PLC) lysis buffer at 108 cells/mL: 50 mmol/L HEPES (4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid, pH 7.0), 150 mmol/L sodium chloride (NaCl), 10% glycerol, 1% Triton X-100, 1.5 mmol/L MgCl2, 1 mmol/L EGTA, 100 mmol/L sodium fluorine (NaF), 10 mmol/L NaPPi, 1 mmol/L Na3VO4, 1 mmol/L phenylmethanesulfonyl fluoride, 10 mg/mL aprotinin, and 10 mg/mL leupeptin. The lysates were separated on SDS-polyacrylamide gels, then electrotransferred to polyvinylidene difluoride membranes (Immobilon; Millipore Corporation, Bedford, MA). The membranes were blocked for 2 hours in 2% bovine serum albumin (BSA) TBST and 20 mmol/L tris(hydroxymethyl aminomethane hydrochloride (Tris-HCl [pH 7.6], 0.15 mol/L sodium chloride, 0.1% Tween 20), incubated with primary antibodies in TBST for 1 hour, washed 3 times with TBST, and incubated for 1 hour with horseradish peroxidase-conjugated antimouse or antirabbit Ig (Amersham Pharmacia Biotech) diluted 1:10 000 in TBST. After 3 washes in TBST, the blot was developed with the enhanced chemiluminescence system (Amersham Pharmacia Biotech) according to the manufacturer's instructions. Electrophoretic mobility shift assay A B oligonucleotide probe (Promega, Madison, WI) was phosphorylated with [32P]ATP using T4 polynucleotide kinase (Takara Biochemicals, Tokyo, Japan). Nuclear extracts were prepared as previously described.31 Specific binding of extract proteins to the B probe was assessed by incubation for 30 minutes at room temperature in a solution containing 10 mmol/L HEPES (pH 7.9), 50 mmol/L potassium chloride (KCl), 0.2 mmol/L EDTA, 0.25 mmol/L DTT, 10% glycerol, 0.05% NP-40, and 0.5 µg poly (dI-dC) and then separated by electrophoresis in a 6% polyacrylamide gel.     Results Top Abstract Introduction Materials and methods Results Discussion References Isolation of the full-length cDNA clone encoding the mTLR2 To clone mTLR2 cDNA, 2 primers were prepared based on the sequence information of the 2 mouse est clones (accession numbers AI020 960 and AA863 729) homologous to hTLR2 cDNA. A partial cDNA was prepared by RT-PCR using these primers, and the total RNA was prepared from a mouse macrophage cell line, J774.1, as a template. To isolate the complete mTLR2 cDNA, this 0.9-kb cDNA fragment was used as a probe for screening a J774.1 cDNA library. Altogether, we obtained 23 independent cDNA clones from 8 × 105 plaques, and DNA sequence analysis was performed on several of them. The longest cDNA clone was 3.0 kb and had an open reading frame of 784 codons (Figure 1). This sequence contains an in-frame stop codon at 108 bp upstream of the first methionine codon. It coded for a signal peptide of 18 amino acid residues and a single transmembrane domain (amino acids 588-608). View larger version (70K): [in this window] [in a new window]   Fig 1. Cloning of mTLR2 cDNA. The amino acid sequences of mTLR2 (GenBank accession number AF216289) and its human homologue, hTLR2. The signal peptide is indicated by a dotted underline, and the putative transmembrane domain is underlined. Amino acid identity is shown between the 2 sequences. A "+" represents similarity between the corresponding pair of amino acid residues. The isolated cDNA clone was 70% identical and 83% homologous with hTLR220 at the amino acid level, which suggests that we had isolated mTLR2. Interestingly, the amino acid identity between hTLR2 and mTLR2 was higher in the cytoplasmic domain (86%) than in the extracellular domain (65%), although most of the leucines in the extracellular domain were conserved. The remarkable similarity of the cytoplasmic domain strongly indicated that the intracellular signaling mechanism of TLR2 should be conserved well between the 2 species. In a recent publication, Heine et al32 reported on their study to clone mTLR2 cDNA. Their reported nucleotide sequence of the 5' untranslated region was different from ours, which may suggest the existence of an alternative splicing. Mouse TLR2 mediates LPS signals in the presence of CD14 To determine if mTLR2 mediates LPS signals the same as hTLR2, we inserted the coding region of mTLR2 cDNA into a mammalian expression plasmid, pEFBOS, with a C-terminal Flag tag. The Flag-tagged mTLR2 was transiently expressed in a monkey kidney cell line, COS7, by itself or in combination with mouse CD14 (mCD14). The expression of the Flag-tagged mTLR2 and mCD14 was confirmed by Western blot analysis and flow cytometry, respectively (Figure 2A and B). Because LPS is known to induce JNK phosphorylation,6,7 we monitored LPS signals using an antibody specific to phosphorylated forms of JNK. Phosphorylation of p46JNK could not be analyzed due to the comigrating nonspecific band recognized by this antibody; therefore we examined the LPS-induced phosphorylation of p54JNK. Transfection of either the control vector or the CD14 expression plasmid did not mediate LPS-induced p54JNK phosphorylation (Figure 2C, lanes 1, 2, 5, and 6), which indicates that the parental COS7 cells were hyporesponsive to LPS. View larger version (50K): [in this window] [in a new window]   Fig 2. Effects of mTLR2 and mCD14 on LPS-induced JNK and NF-B activation. (A) Expression of the Flag-tagged mTLR2 in COS7 cells. COS7 cells were transiently transfected with the following: the vector alone, an expression plasmid of the Flag-tagged mTLR2, an expression plasmid of mCD14, or a combination of mTLR2/Flag and mCD14 expression plasmids. Flag-tagged mTLR2 expression was detected by immunoblotting with anti-Flag mAb. (B) Surface expression of mCD14 on COS7 cells. COS7 cells transiently transfected with expression plasmids as in (A) were stained with a control mAb (dotted line) or an anti-mCD14 mAb (solid line) followed by FITC-conjugated antirat IgG mAb. Flow cytometric analyses of COS7 cells transiently transfected with only vector and with Flag-tagged mTLR2 plus mCD14 are shown. A similar amount of mCD14 surface expression seen in double transfection was also observed in mCD14-transfected COS7 cells (data not shown). (C) LPS-induced JNK phosphorylation by mTLR2 and mCD14. Cytoplasmic cell extracts were prepared from COS7 cells transiently transfected as in (A), which were either left untreated or stimulated with 10 µg/mL LPS for 20 minutes. JNK phosphorylation was detected by Western blot analysis using an mAb specific for the phosphorylated form of JNK. Nonspecific 46-kd bands recognized by this mAb are indicated by a dotted arrow. The same filter was reblotted with an anti-JNK1 pAb. (D) LPS-mediated NF-B DNA-binding activation is dependent on both mTLR2 and mCD14. Nuclear cell extracts were prepared from COS7 cells transiently transfected as in (A), which were either left untreated or stimulated with 10 µg/mL LPS for 20 minutes. EMSA was performed with a radio-labeled double-stranded probe containing a NF-B binding site. NC represents negative control without nuclear extract. Overexpression of mTLR2 constitutively mediated slight phosphorylation of JNK, which was not strengthened further by LPS stimulation (Figure 2C, lanes 3 and 4). When mTLR2 was coexpressed with CD14, LPS significantly increased JNK phosphorylation (Figure 2C, lanes 7 and 8). Thus, mTLR2 mediates LPS responsiveness in a CD14-dependent fashion. Using electrophoretic mobility shift assay (EMSA), we also examined NF-B activation, which is a well-known downstream event of the LPS signal (Figure 2D). COS7 cells expressing mTLR2 constitutively showed slightly increased NF-B DNA-binding activity. Coexpression of mCD14 with mTLR4 conferred LPS inducibility of NF-B activation. Tissue distribution of mTLR2 gene expression Northern blot analysis was performed on total RNA isolated from various mouse tissues (Figure 3). The gene expression of mTLR2 was detected in every tissue examined, and the highest expressions were observed in the spleen and the lung. Mouse TLR2 mRNA expression was also enriched in the brain and the thymus. We were particularly interested in mTLR2 expression in the thymus because the role of LPS signaling in T cells has not been fully established. We therefore investigated the regulation of mTLR2 gene expression in T cells. View larger version (75K): [in this window] [in a new window]   Fig 3. Expression of mTLR2 in mouse tissues. Total RNAs from indicated mouse tissues were resolved by formaldehyde gel electrophoresis, transferred to a nitrocellulose membrane, and hybridized with an mTLR2 cDNA probe. A picture of the ethidium bromide-stained gel is also shown. Mouse TLR2 gene expression in T cells To elucidate the regulatory mechanisms for mTLR2 gene expression in T cells, purified mouse T cells from the thymus and the spleen were stimulated with immobilized anti-CD3 mAb for 2 hours, and total RNA was isolated. Although the mTLR2 gene was constantly expressed in unstimulated T cells, as assessed by semiquantitative RT-PCR, triggering by anti-CD3 mAb resulted in a substantial increase of the mTLR2 gene expression (Figure 4A). In contrast, mTLR4 gene expression, which was also detected in unstimulated T cells, remained constant after anti-CD3 treatment (Figure 4A). View larger version (53K): [in this window] [in a new window]   Fig 4. Mouse TLR2 and TLR4 gene expressions in mouse T cells. (A) Mouse T cells purified from thymuses and spleens were either unstimulated or stimulated with immobilized anti-CD3 mAb for 2 hours. Total RNAs were extracted, and mTLR2 and mTLR4 expressions were analyzed by semiquantitative RT-PCR. (B) S49.1 and EL4 cells were either unstimulated or stimulated with 100 ng/mL PMA plus 1 µg/mL ionomycin for 2 hours. We isolated 5 µg mRNA from the cells and analyzed them by Northern blot analysis using mTLR2 and mTLR4 cDNA probes. (C) CTLL-2 cells were starved overnight without factors and either left unstimulated or stimulated with 10 ng/mL mIL-2 or 10 ng/mL hIL-15 for the indicated time. To exclude the possibility that the positive RT-PCR products were due to a small number of contaminating macrophages or B cells, using Northern blot analysis, we tested TLR gene expressions in several mouse T cell lines (EL4, S49.1, and CTLL-2). Gene expression of mTLR4 was easily detected in these 3 cell lines (Figure 4B and C). When compared with mTLR4, mTLR2 gene expression was relatively lower in S49.1 cells (Figure 4B). When this T cell line was stimulated with the combination of PMA and ionomycin, which mimics TCR stimulation, mTLR2 gene expression increased. On the other hand, mTLR4 expression remained constant after PMA plus ionomycin treatment in S49.1 cells (Figure 4B). Next, we examined the effect of cytokine stimulation on mTLR2 gene expression in CTLL-2 cells that are responsive to IL-2 and IL-15. The 2 cytokines share IL-2R and c for their signal transduction.33 Both IL-2 and IL-15 treatment significantly increased mTLR2 gene expression, whereas no remarkable change was detected in the mTLR4 mRNA level (Figure 4C). ERK and p38 kinase pathways are involved in mTLR2 mRNA induction in mouse T cells Both cytokine stimulation and anti-CD3 mAb treatment of T cells are known to activate MAP kinase pathways including ERK, JNK, and p38 kinase.34 To investigate whether ERK and p38 kinase pathways are involved in mTLR2 mRNA up-regulation, we pretreated S49.1 cells with specific inhibitors of ERK (PD98 059) and p38 kinase (SB208 530) pathways followed by stimulation with PMA plus ionomycin. Pretreatment with each of these MAP kinase inhibitors abrogated the increase of mTLR2 mRNA at 10 µmol/L, as assessed by semiquantitative RT-PCR (Figure 5A). We next examined S49.1 cells that constitutively expressed a dominant negative form of JNK1 (JNKDN), which has 2 amino acid substitutions of the phosphorylation sites of JNK1. Although JNK activation by PMA plus ionomycin was markedly inhibited by the expression of JNKDN in this transfectant (data not shown), mRNA up-regulation of mTLR2 by PMA plus ionomycin treatment was comparable to that of parental S49.1 cells (Figure 5A). Additionally, UV treatment, which is a potent activator of JNK, did not induce significant increase of mTLR2 gene expression (Figure 5A). Therefore, JNK activation may not be necessary for mTLR2 mRNA up-regulation by PMA plus ionomycin in S49.1 cells. View larger version (36K): [in this window] [in a new window]   Fig 5. Involvement of MAP kinase pathways in mTLR2 induction in S49.1 cells. (A) S49.1 cells were either untreated or treated with PMA plus ionomycin for 2 hours with or without the pretreatment of 10 µmol/L PD98 059 or SB208 530 for 30 minutes. S49.1 cells were also treated with UV irradiation (40 J/m2) and left for 1 hour at 37°C. In some experiments, S49.1 cells constitutively expressing a dominant negative form of JNK1 or H-Ras were treated with PMA plus ionomycin for 2 hours. Total RNAs were extracted, and the expression of mTLR2, mTLR4, and -actin was examined by semiquantitative RT-PCR. (B) S49.1 cells were pretreated with a series of concentrations of PD98 059 or SB208 530 for 30 minutes followed by treatment with PMA plus ionomycin for 2 hours. Total RNAs were extracted, and the expressions of mTLR2, mTLR4, and -actin were examined by semiquantitative RT-PCR. (C) Total RNAs were extracted from S49.1 cells transfected with pEGFP-C1 or pEGFP-MEK1A. Expression of mTLR2 and -actin was examined by semiquantitative RT-PCR. On the other hand, a dominant negative form of H-Ras (N17) only partially blocked mTLR2 mRNA increase (Figure 5A), which suggests that either the stimulation by PMA plus ionomycin works on downstream molecules of Ras or there is an alternative Ras-independent pathway for the induction of mTLR2 mRNA. Furthermore, when a series of concentrations of PD98 059 and SB208 530 was tested, both of them effectively inhibited mTLR2 mRNA up-regulation at concentrations as low as 0.1 µmol/L, which suggests that the inhibition by these chemicals was specific (Figure 5B). Next, to test if constitutive activation of the ERK pathway is sufficient to induce mTLR2, S49.1 cells were transfected with an expression plasmid encoding a constitutively activated form of MEK1 (MEK1A), an upstream activator of ERK. The mRNA levels of mTLR2 in 3 independently isolated S49.1 cell lines overexpressing the active mutant of MEK1 were constitutively higher than that of the parental S49.1 cells. (A typical result is shown in Figure 5C.) Thus, mTLR2 induction by PMA plus ionomycin treatment is dependent on both ERK and p38 kinase activation, whereas continuous activation of the ERK pathway seems sufficient to induce mTLR2 gene expression in S49.1 cells. LPS treatment directly affects the cytokine expression of the EL4 cell line It has recently been reported that LPS and lipid A directly inhibit IL-4 production by mouse T helper cell 2 (Th2) clones.10 The EL4 cell line, which constitutively expresses both mTLR2 and mTLR4 (Figure 4B), is known to have a Th2-like phenotype and to produce IL-4.35 To investigate the direct effects of LPS on the cytokine production of EL4 cells, we treated EL4 cells with serial dilutions of LPS and analyzed IL-4 and IFN mRNA expression by semiquantitative RT-PCR (Figure 6). The gene expression of IFN was weakly induced at 0.1 µg/mL LPS, but it was undetectable at higher concentrations of LPS. In contrast, IL-4 mRNA was constitutively detectable and decreased in the presence of 10 µg/mL of LPS. Thus, LPS directly affects the cytokine expression profile of the EL4 cell line. View larger version (39K): [in this window] [in a new window]   Fig 6. LPS inhibits IL-4 gene expression in EL4 cells. EL-4 cells were either untreated or treated with 0.1, 1, or 10 µg/mL of LPS for 6 hours. Total RNAs were extracted, and IL-4 and IFN gene expressions were examined by semiquantitative RT-PCR.     Discussion Top Abstract Introduction Materials and methods Results Discussion References In this study, we describe the isolation and cloning of mTLR2, which mediates LPS-induced cellular signals similar to its human counterpart.21,22 We also show that mTLR2, as well as another putative LPS receptor, mTLR4, is expressed in mouse T cells, and that the gene expression of mTLR2 is differently regulated from that of mTLR4. In addition, LPS directly inhibited IL-4 expression in a Th2-type cell line, EL-4, which expresses both mTLR2 and mTLR4. LPS may thus directly affect T-cell functions through TLR-mediated signal pathways. The extracellular segments of TLR proteins are distinctively composed of 24-28 amino acid leucine-rich repeats (LRRs).20 LRRs are also found in the Drosophila homologues, Toll and 18 Wheeler (18w).36,37 Although amino acid sequence homology between hTLR2 and mTLR2 is higher in the cytoplasmic domain, the LRR structure is conserved well, suggesting that it plays a critical role in their biological functions. CD14, which binds LPS with high affinity, also contains 10 copies of the LRR motif. However, LRRs of CD14 are not necessary for LPS binding, as shown by mapping studies.38,39 Human TLR2 has been reported to bind LPS by itself, but the Kd is low and may not be physiologically important.21 We have not tested the binding affinity of mTLR2 for LPS. However, it is unlikely that mTLR2 reacts to physiological concentrations of LPS by itself because COS7 cells expressing mTLR2 alone did not show a detectable response to 10 µg/mL LPS in either JNK or NF-B activation (Figure 2). It is noteworthy that the cytoplasmic domain is conserved well at the amino acid level between hTLR2 and mTLR2. TLRs 1-5 share a highly significant homology called the Toll-homology (TH) domain.20 The TH domain was first discovered as a resemblance of a cytoplasmic domain between Toll and IL-1 receptor type I (IL-1RI).18,40 It was later shown that the TH domain was also shared by numerous proteins including plant disease-resistance proteins,41 an intracellular myeloid differentiation marker (MyD88),42,43 ST2,43 IL-1Racp,44 and IL-1RrP/IL-18R.45 The TH domain contains 10 conserved blocks consisting of 5 alternating -strands and -helices,20 and all the blocks are conserved in mTLR2 as well as in hTLR2 (Figure 1). Since both Toll and IL-1R mediate signaling by similar Rel-type transcription factors,18,40 the TH domain presumably plays an important role in the activation of the NF-B pathway. In assays using carboxy-terminal truncations of hTLR2, deletions of carboxy-terminal 13 or 15 amino acid markedly impaired the LPS-mediated NF-B activation by hTLR2.21,22 These deletions remove only the last block of -helices, which suggests that the complete conformation of the TH domain is necessary for proper signaling. This finding is consistent with the fact that all 10 blocks of TH are conserved between mTLR2 and hTLR2 (Figure 1). Our results have demonstrated that overexpression of mTLR2 in combination with mCD14 confers responsiveness to LPS stimulation in COS7 cells. Although hTLR2 was shown to mediate LPS signaling,21,22 the role of mTLR2 in LPS signaling remains questionable. Two recent studies examined a single autosomal locus (lps), which is responsible for the LPS hyporesponsiveness (lpsd) of 2 mouse strains (C3H/HeJ and C57BL10/ScCr).23,24 The mTLR4 gene was found in the lps locus and mutations in the mTLR4 gene in both strains were identified. This strongly suggests that a defective mTLR4 is responsible for the LPS-hyporesponsiveness of these mice. More recently, mice lacking the mTLR4 gene have been generated, and these mice show LPS-hyporesponsiveness very similar to that in the 2 lpsd mouse strains.46 These findings are consistent with the idea that the mTLR4 gene is essential in LPS signaling. Then what is the role of mTLR2 in LPS responsiveness? There are four possible explanations. First, it is possible that mTLR2 works as an alternative to mTLR4. Lpsd mice are hyporesponsive but not unresponsive to LPS. They show LPS-induced gene expressions in the presence of a larger dose of LPS,47 which suggests that there is some redundancy in LPS signaling. Our present data, which confirm that mTLR2 mediates LPS signals, may indicate that mTLR2 works to back up mTLR4. Another explanation is that mTLR2 and mTLR4 may respond to different types of LPS. Cells from C3H/HeJ mice are as sensitive as their normal counterparts to certain types of LPS (eg, Porphyromonas gingivalis LPS).48 There is divergence in LPS structure among Gram-negative bacteria, and it is presumable that mTLR4 responds to certain types of LPS better than mTLR2, while mTLR2 responds better to others. The third possibility is that mTLR2 and mTLR4 may cooperate to respond to LPS. It has not been shown how TLRs are involved in the formation of the LPS receptor complex, and it is possible that mTLR2 associates with mTLR4 to form a dimer or oligomer. Further studies, including a study of mice lacking the mTLR2 gene, need to be done to fully understand the involvement of mTLR2 in the LPS receptor complex. The fourth possibility is based on the inducibility of mTLR2 expression (Figures 4 and 5). In our current study we have shown that in some T cell lines, the expression level of mTLR2 is very low, but it significantly increases after stimulation with anti-CD3 mAb, PMA plus ionomycin, and IL-2/IL-15. However, no change is detected in mTLR4 expression after such treatments (Figure 4). Also, mTLR2 is significantly up-regulated in macrophages by stimulation with LPS and IFN (T. Matsuguchi, unpublished data, June 1999). Interestingly, the sensitivity of lpsd mice is restored by treatment with IFN or BCG,49-52 and the expression level of mTLR2 in immune cells is likely to be higher after these treatments in lpsd mice. All these findings may suggest that immune-component cells react to LPS mainly with TLR4 at first, and TLR2 is the second LPS receptor boosting the immune response by the host. This hypothesis explains well why mTLR4 is essential in LPS responsiveness. It is of note that the coexpression of mCD14 with mTLR2 was necessary for the proper activation of JNK and NF-B by LPS in COS7 cells. In contrast, in 2 earlier reports using hTLR2, 293 cells transfected with only hTLR2 increased the transcription of NF-B-dependent reporter genes in response to LPS.21,22 The exact reason for this discrepancy is unknown. It is possible that mTLR2 and hTLR2 respond differently to LPS in the absence of CD14. It is also possible that the discrepancy is due to the difference of the cell lines used for the transfection. The parental COS7 cells that we used in our experiments did not show any CD14 surface expression (Figure 2B). The 293 cells tested in the earlier reports might contain a small amount of endogenous CD14, which worked with the exogenous TLR2. It has recently been reported that hTLR4 needs a small molecule called MD-2 for proper transduction of the LPS signal.53 Therefore, it is also possible that COS7 and 293 may in different ways express an unknown coactivator protein, similar to MD-2, which is necessary for proper TLR2 function. We have also shown that both mTLR2 and mTLR4 mRNAs are expressed in mouse T cells and some T cell lines. Although we could not show the protein expressions due to the lack of appropriate mAbs, LPS directly inhibited IL-4 expression in a mouse Th2-type cell line, EL4, suggesting the surface expression of LPS receptors on this T cell line. In spite of great interest, the direct effects of LPS on T cells have not been fully understood. Because it is now known that both TLR2 and TLR4 are expressed on T cells, it is reasonable to presume that LPS can directly affect some of the T-cell functions. To support our findings, it has recently been reported that both LPS and lipid A decrease IL-4 production from purified mouse CD4+ T cells and Th2 clones, indicating that LPS directly modulates cytokine expressions by T cells.10 Additionally, an earlier report showed the activation and subsequent apoptosis of T cells in LPS-treated mice.11 Although T cells usually do not express CD14, a soluble form of CD14 (sCD14) in the serum has been shown to bind LPS and induce signals in cells lacking CD14.16,17 It has also recently been shown that CD11c/CD18, which is expressed on some T cells,54 may work as a component of the LPS receptor.55,56 In the present study, we have shown that a low concentration (0.1 µg/mL) of LPS induces weak expression of IFN mRNA in EL4 cells (Figure 6). The same result was repeatedly observed in different sets of experiments (data not shown). Recent reports have shown that both JNK1 and JNK2 are involved in the development of Th1 cells producing IFN.57,58 Our results have revealed that mTLR2 is a potent inducer of JNK phosphorylation (Figure 2C). Therefore, it is a reasonable to presume that LPS induces signal pathways promoting Th1 cell development. Interestingly, the up-regulation of IFN mRNA was not observed at higher concentrations of LPS (Figure 6). The reason for this phenomenon is not clear. It was not due to the increased cell death because LPS as high as 100 µg/mL did not affect the viability of EL4 cells (data not shown). LPS treatment of this cell line might activate different downstream signals in a concentration-dependent manner. The LPS-binding affinities for TLR2 and TLR4 have not been clearly shown, and it is interesting to presume that either TLR2 or TLR4 works preferably at the low concentration of LPS, thereby mediating better IFN expression. EL4 cells constitutively express both TLR2 and TLR4 (Figure 4B). The expression level of mTLR2 but not that of mTLR4 increases in T cells with the stimulation by immobilized anti-CD3 mAb, PMA plus ionomycin, IL-2, and IL-15. All of these stimulators are known to activate both ERK and p38 kinase,59-64 and our data indicate that mTLR2 mRNA up-regulation by PMA plus ionomycin is dependent on both ERK and p38 kinase pathways (Figure 5). It is becoming evident that the binding of MAP kinases to transcription factors is a critical determinant of their specificity. ERK is specifically targeted to the ets domain transcription factors, Elk-1 and Lin-1, while p38 has recently been shown to be targeted to the MADS-box transcription factors, MEF2A and MEF2C.65 Mouse TLR2 gene may be under the regulation of multiple transcription factors that are activated by different MAP kinases, ERK, and p38 kinase. Collaboration between ERK and p38 kinase has also been reported for the induction of cytokine and iNOS synthesis in macrophages.66,67 However, the overexpression of a constitutively active mutant of MEK1 increased mTLR2 mRNA (Figure 5C), which suggests that the continuous activation of the ERK pathway is sufficient to induce the mTLR2 gene expression. Lastly, it is interesting that mTLR2 is induced by IL-15 in some T cells. Since LPS is a potent inducer of IL-15 production from macrophages,68 these findings may suggest that at least a significant fraction of T cells responds to LPS in a 2-step manner: first by using constitutively expressed mTLR4, then by using mTLR2, which is induced later by cytokines like IL-15. It is interesting to speculate that mTLR2 and mTLR4 induce different intracellular signals; as a result, the same T-cell population might respond differently to LPS during the course of Gram-negative bacterial infection. In conclusion, the present study has shown that both mTLR2 and mTLR4 are able to mediate LPS signaling. The expression of these proteins in mouse T cells indicates that LPS may have direct effects on T-cell activity during Gram-negative bacterial infection.     Acknowledgments We thank Ms K. Itano, Ms A. Kato, and Ms A. Nishikawa for their technical assistance. We also thank Dr H. Yagita for providing a mouse cDNA library.     Footnotes Submitted August 16, 1999; accepted October 16, 1999. Supported in part by grants from the Ono Pharmaceutical Company (Japan; T.M.); the Yokoyama Research Foundation for Clinical Pharmacology (Japan; Y.Y.); the Center of Excellence; and the Core Research for Evolutional Science and Technology (CREST) Project and by grant JSPS-RFTF97L00703 from the Ministry of Education, Science and Culture of the Japanese Government. Reprints: T. Matsuguchi, Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550, Japan; e-mail: tmatsugu{at}med.nagoya-u.ac.jp. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.     References Top Abstract Introduction Materials and methods Results Discussion References 1. Schletter J, Heine H, Ulmer AJ, Rietschel ET. Molecular mechanisms of endotoxin activity. Arch Microbiol. 1995;164:383-389[Medline] [Order article via Infotrieve]. 2. Vincenti MP, Burrell TA, Taffet SM. Regulation of NF-kappa B activity in murine macrophages: effect of bacterial lipopolysaccharide and phorbol ester. J Cell Physiol. 1992;150:204-213[Medline] [Order article via Infotrieve]. 3. Mackman N, Brand K, Edgington TS. Lipopolysaccharide-mediated transcriptional activation of the human tissue factor gene in THP-1 monocytic cells requires both activator protein 1 and nuclear factor kappa B binding sites. J Exp Med. 1991;174:1517-1526[Abstract/Free Full Text]. 4. Liu MK, Herrera-Velit P, Brownsey RW, Reiner NE. CD14-dependent activation of protein kinase C and mitogen-activated protein kinases (p42 and p44) in human monocytes treated with bacterial lipopolysaccharide. J Immunol. 1994;153:2642-2652[Abstract]. 5. Hambleton J, McMahon M, DeFranco AL. Activation of Raf-1 and mitogen-activated protein kinase in murine macrophages partially mimics lipopolysaccharide-induced signaling events. J Exp Med. 1995;182:147-154[Abstract/Free Full Text]. 6. Swantek JL, Cobb MH, Geppert TD. Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK) is required for lipopolysaccharide stimulation of tumor necrosis factor alpha (TNF-alpha) translation: glucocorticoids inhibit TNF-alpha translation by blocking JNK/SAPK. Mol Cell Biol. 1997;17:6274-6282[Abstract]. 7. Hambleton J, Weinstein SL, Lem L, DeFranco AL. Activation of c-Jun N-terminal kinase in bacterial lipopolysaccharide-stimulated macrophages. Proc Natl Acad Sci U S A. 1996;93:2774-2778[Abstract/Free Full Text]. 8. Han J, Lee JD, Bibbs L, Ulevitch RJ. A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science. 1994;265:808-811[Abstract/Free Full Text]. 9. Nick JA, Avdi NJ, Gerwins P, Johnson GL, Worthen GS. Activation of a p38 mitogen-activated protein kinase in human neutrophils by lipopolysaccharide. J Immunol. 1996;156:4867-4875[Abstract]. 10. Watanabe T, Inoue T, Ochi H, Terashima M, Asano Y, Nakatani T. Lipid A directly inhibits IL-4 production by murine Th2 cells but does not inhibit IFN-gamma production by Th1 cells. Eur J Immunol. 1999;29:413-418[Medline] [Order article via Infotrieve]. 11. Castro A, Bemer V, Nobrega A, Coutinho A, Truffa-Bachi P. Administration to mouse of endotoxin from gram-negative bacteria leads to activation and apoptosis of T lymphocytes. Eur J Immunol. 1999;28:488-495. 12. Wright SD, Ramos RA, Tobias PS, Ulevitch RJ, Mathison JC. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein [see comments]. Science. 1990;249:1431-1433[Abstract/Free Full Text]. 13. Schumann RR, Leong SR, Flaggs GW, et al. Structure and function of lipopolysaccharide binding protein. Science. 1990;249:1429-1431[Abstract/Free Full Text]. 14. Wright SD, Tobias PS, Ulevitch RJ, Ramos RA. Lipopolysaccharide (LPS) binding protein opsonizes LPS-bearing particles for recognition by a novel receptor on macrophages. J Exp Med. 1989;170:1231-1241[Abstract/Free Full Text]. 15. Hailman E, Lichenstein HS, Wurfel MM, et al. Lipopolysaccharide (LPS)-binding protein accelerates the binding of LPS to CD14. J Exp Med. 1994;179:269-277[Abstract/Free Full Text]. 16. Frey EA, Miller DS, Jahr TG, et al. Soluble CD14 participates in the response of cells to lipopolysaccharide. J Exp Med. 1992;176:1665-1671[Abstract/Free Full Text]. 17. Pugin J, Schurer-Maly CC, Leturcq D, Moriarty A, Ulevitch RJ, Tobias PS. Lipopolysaccharide activation of human endothelial and epithelial cells is mediated by lipopolysaccharide-binding protein and soluble CD14. Proc Natl Acad Sci U S A. 1993;90:2744-2748[Abstract/Free Full Text]. 18. Belvin MP, Anderson KV. A conserved signaling pathway: the Drosophila toll-dorsal pathway. Annu Rev Cell Dev Biol. 1996;12:393-416[Medline] [Order article via Infotrieve]. 19. Lemaitre B, Nicolas E, Michaut L, Reichhart JM, Hoffmann JA. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell. 1996;86:973-983[Medline] [Order article via Infotrieve]. 20. Rock FL, Hardiman G, Timans JC, Kastelein RA, Bazan JF. A family of human receptors structurally related to Drosophila Toll. Proc Natl Acad Sci U S A. 1998;95:588-593[Abstract/Free Full Text]. 21. Yang RB, Mark MR, Gray A, et al. Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signalling [see comments]. Nature. 1998;395:284-288[Medline] [Order article via Infotrieve]. 22. Kirschning CJ, Wesche H, Merrill Ayres T, Rothe M. Human Toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide. J Exp Med. 1998;188:2091-2097[Abstract/Free Full Text]. 23. Poltorak A, He X, Smirnova I, et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in tlr4 gene [In Process Citation]. Science. 1998;282:2085-2088[Abstract/Free Full Text]. 24. Qureshi ST, Lariviere L, Leveque G, et al. Endotoxin-tolerant mice have mutations in toll-like receptor 4 (Tlr4) [In Process Citation]. J Exp Med. 1999;189:615-625[Abstract/Free Full Text]. 25. Hathcock KS. T cell enrichment by non-adherence to nylon. In: Coligan JE,Kruisbeek AM,Margulies DH,Shevach EM,Strober W, eds. Current Protocols in Immunology. New York, NY: John Wiley & Sons; 1994:3.2.1. 26. Matsuguchi T, Okamura S, Aso T, Sata T, Niho Y. Molecular cloning of the cDNA coding for proline-rich protein (PRP): identity of PRP as C4b-binding protein. Biochem Biophys Res Commun. 1989;165:138-144[Medline] [Order article via Infotrieve]. 27. Matsuguchi T, Kraft AS. Regulation of myeloid cell growth by distinct effectors of Ras. Oncogene. 1998;17:2701-2709[Medline] [Order article via Infotrieve]. 28. Franklin CC, Kraft AS. Constitutively active MAP kinase (MEK1) stimulates SAP kinase and c-Jun transcriptional activity in U937 human leukemic cells. Oncogene. 1995;11:2365-2374[Medline] [Order article via Infotrieve]. 29. Gupta S, Campbell D, Derijard B, Davis RJ. Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science. 1995;267:389-393[Abstract/Free Full Text]. 30. Feig LA, Cooper GM. Inhibition of NIH 3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP. Mol Cell Biol. 1988;8:3235-3243[Abstract/Free Full Text]. 31. Andrews NC, Faller DV. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 1991;19:2499[Free Full Text]. 32. Heine H, Kirschning CJ, Lien E, Monks BG, Rothe M, Golenbock DT. Cutting edge: cells that carry a null allele for toll-like receptor 2 are capable of responding to endotoxin. J Immunol. 1999;162:6971-6975[Abstract/Free Full Text]. 33. Giri JG, Kumaki S, Ahdieh M, et al. Identification and cloning of a novel IL-15 binding protein that is structurally related to the alpha chain of the IL-2 receptor. EMBO J. 1995;14:3654-3663[Medline] [Order article via Infotrieve]. 34. Hardy K, Chaudhri G. Activation and signal transduction via mitogen-activated protein (MAP) kinases in T lymphocytes. Immunol Cell Biol. 1997;75:528-545[Medline] [Order article via Infotrieve]. 35. Bruhn KW, Nelms K, Boulay JL, Paul WE, Lenardo MJ. Molecular dissection of the mouse interleukin-4 promoter. Proc Natl Acad Sci U S A. 1993;90:9707-9711[Abstract/Free Full Text]. 36. Chiang C, Beachy PA. Expression of a novel Toll-like gene spans the parasegment boundary and contributes to hedgehog function in the adult eye of Drosophila. Mech Dev. 1994;47:225-239[Medline] [Order article via Infotrieve]. 37. Eldon E, Kooyer S, D'Evelyn D, et al. The Drosophila 18 wheeler is required for morphogenesis and has striking similarities to Toll. Development. 1994;120:885-899[Abstract]. 38. Juan TS, Kelley MJ, Johnson DA, et al. Soluble CD14 truncated at amino acid 152 binds lipopolysaccharide (LPS) and enables cellular response to LPS. J Biol Chem. 1995;270:1382-1387[Abstract/Free Full Text]. 39. Juan TS, Hailman E, Kelley MJ, et al. Identification of a lipopolysaccharide binding domain in CD14 between amino acids 57 and 64. J Biol Chem. 1995;270:5219-5224[Abstract/Free Full Text]. 40. Wasserman SA. A conserved signal transduction pathway regulating the activity of the rel-like proteins dorsal and NF-kappa B. Mol Biol Cell. 1993;4:767-771[Medline] [Order article via Infotrieve]. 41. Wilson I, Vogel J, Somerville S. Signalling pathways: a common theme in plants and animals? Curr Biol. 1997;7:R175-R178[Medline] [Order article via Infotrieve]. 42. Hardiman G, Rock FL, Balasubramanian S, Kastelein RA, Bazan JF. Molecular characterization and modular analysis of human MyD88. Oncogene. 1996;13:2467-2475[Medline] [Order article via Infotrieve]. 43. Mitcham JL, Parnet P, Bonnert TP, et al. T1/ST2 signaling establishes it as a member of an expanding interleukin-1 receptor family. J Biol Chem. 1996;271:5777-5783[Abstract/Free Full Text]. 44. Huang J, Gao X, Li S, Cao Z. Recruitment of IRAK to the interleukin 1 receptor complex requires interleukin 1 receptor accessory protein. Proc Natl Acad Sci U S A. 1997;94:12,829-12,832[Abstract/Free Full Text]. 45. Torigoe K, Ushio S, Okura T, et al. Purification and characterization of the human interleukin-18 receptor. J Biol Chem. 1997;272:25,737-25,742[Abstract/Free Full Text]. 46. Hoshino K, Takeuchi O, Kawai T, et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 1999;162:3749-3752[Abstract/Free Full Text]. 47. Rosenstreich DL. Genetic control of endotoxin response: C3H/HeJ mice. In: Berry LJ, ed. Handbook of Endotoxin. Vol 3. New York, NY: Elsevier Science Publishers; 1985:82-122. 48. Tanamoto K, Azumi S, Haishima Y, Kumada H, Umemoto T. The lipid A moiety of Porphyromonas gingivalis lipopolysaccharide specifically mediates the activation of C3H/HeJ mice. J Immunol. 1997;158:4430-4436[Abstract]. 49. Katschinski T, Galanos C, Coumbos A, Freudenberg MA. Gamma interferon mediates Propionibacterium acnes-induced hypersensitivity to lipopolysaccharide in mice. Infect Immun. 1992;60:1994-2001[Abstract/Free Full Text]. 50. Beutler B, Tkacenko V, Milsark I, Krochin N, Cerami A. Effect of gamma interferon on cachectin expression by mononuclear phagocytes. Reversal of the lpsd (endotoxin resistance) phenotype. J Exp Med. 1986;164:1791-1796[Abstract/Free Full Text]. 51. Vogel SN, Moore RN, Sipe JD, Rosenstreich DL. BCG-induced enhancement of endotoxin sensitivity in C3H/HeJ mice. I. In vivo studies. J Immunol. 1980;124:2004-2009[Abstract]. 52. Vogel SN, Weedon LL, Wahl LM, Rosenstreich DL. BCG-induced enhancement of endotoxin sensitivity in C3H/HeJ mice. II. T cell modulation of macrophage sensitivity to LPS in vitro. Immunobiology. 1982;160:479-493[Medline] [Order article via Infotrieve]. 53. Shimazu R, Akashi S, Ogata H, et al. MD-2, a molecule that confers lipopolysaccharide responsiveness on toll-like receptor 4 [In Process Citation]. J Exp Med. 1999;189:1777-1782[Abstract/Free Full Text]. 54. Miller LJ, Schwarting R, Springer TA. Regulated expression of the Mac-1, LFA-1, p150,95 glycoprotein family during leukocyte differentiation. J Immunol. 1986;137:2891-2900[Abstract]. 55. Ingalls RR, Golenbock DT. CD11c/CD18, a transmembrane signaling receptor for lipopolysaccharide. J Exp Med. 1995;181:1473-1479[Abstract/Free Full Text]. 56. Ingalls RR, Monks BG, Savedra R Jr. CD11/CD18 and CD14 share a common lipid A signaling pathway. J Immunol. 1998;161:5413-5420[Abstract/Free Full Text]. 57. Dong C, Yang DD, Wysk M, Whitmarsh AJ, Davis RJ, Flavell RA. Defective T cell differentiation in the absence of Jnk1. Science. 1998;282:2092-2095[Abstract/Free Full Text]. 58. Yang DD, Conze D, Whitmarsh AJ, et al. Differentiation of CD4+ T cells to Th1 cells requires MAP kinase JNK2. Immunity. 1998;9:575-585[Medline] [Order article via Infotrieve]. 59. Morley SJ. Signalling through either the p38 or ERK mitogen-activated protein (MAP) kinase pathway is obligatory for phorbol ester and T cell receptor complex (TCR-CD3)-stimulated phosphorylation of initiation factor (eIF) 4E in Jurkat T cells. FEBS Lett. 1997;418:327-332[Medline] [Order article via Infotrieve]. 60. Ettehadieh E, Sanghera JS, Pelech SL, et al. Tyrosyl phosphorylation and activation of MAP kinases by p56lck. Science. 1992;255:853-855[Abstract/Free Full Text]. 61. Nel AE, Hanekom C, Rheeder A, et al. Stimulation of MAP-2 kinase activity in T lymphocytes by anti-CD3 or anti-Ti monoclonal antibody is partially dependent on protein kinase C. J Immunol. 1990;144:2683-2689[Abstract]. 62. Crawley JB, Rawlinson L, Lali FV, Page TH, Saklatvala J, Foxwell BM. T cell proliferation in response to interleukins 2 and 7 requires p38MAP kinase activation. J Biol Chem. 1997;272:15,023-15,027[Abstract/Free Full Text]. 63. Minami Y, Oishi I, Liu ZJ, Nakagawa S, Miyazaki T, Taniguchi T. Signal transduction mediated by the reconstituted IL-2 receptor. Evidence for a cell type-specific function of IL-2 receptor beta-chain. J Immunol. 1994;152:5680-5690[Abstract]. 64. Adunyah SE, Wheeler BJ, Cooper RS. Evidence for the involvement of LCK and MAP kinase (ERK-1) in the signal transduction mechanism of interleukin-15. Biochem Biophys Res Commun. 1997;232:754-758[Medline] [Order article via Infotrieve]. 65. Yang SH, Galanis A, Sharrocks AD. Targeting of p38 mitogen-activated protein kinases to MEF2 transcription factors. Mol Cell Biol. 1999;19:4028-4038[Abstract/Free Full Text]. 66. Ajizian SJ, English BK, Meals EA. Specific inhibitors of p38 and extracellular signal-regulated kinase mitogen-activated protein kinase pathways block inducible nitric oxide synthase and tumor necrosis factor accumulation in murine macrophages stimulated with lipopolysaccharide and interferon-gamma. J Infect Dis. 1999;179:939-944[Medline] [Order article via Infotrieve]. 67. Carter AB, Monick MM, Hunninghake GW. Both Erk and p38 kinases are necessary for cytokine gene transcription. Am J Respir Cell Mol Biol. 1999;20:751-758[Abstract/Free Full Text]. 68. Doherty TM, Seder RA, Sher A. Induction and regulation of IL-15 expression in murine macrophages. J Immunol. 1996;156:735-741[Abstract]. © 2000 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: N. Asprodites, L. Zheng, D. Geng, C. Velasco-Gonzalez, L. Sanchez-Perez, and E. Davila Engagement of Toll-like receptor-2 on cytotoxic T-lymphocytes occurs in vivo and augments antitumor activity FASEB J, October 1, 2008; 22(10): 3628 - 3637. [Abstract] [Full Text] [PDF] G. Matute-Bello, C. W. Frevert, and T. R. Martin Animal models of acute lung injury Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L379 - L399. [Abstract] [Full Text] [PDF] L. Zheng, N. Asprodites, A. H. Keene, P. Rodriguez, K. D. Brown, and E. Davila TLR9 engagement on CD4 T lymphocytes represses {gamma}-radiation-induced apoptosis through activation of checkpoint kinase response elements Blood, March 1, 2008; 111(5): 2704 - 2713. [Abstract] [Full Text] [PDF] M. Inada, C. Matsumoto, S. Uematsu, S. Akira, and C. Miyaura Membrane-Bound Prostaglandin E Synthase-1-Mediated Prostaglandin E2 Production by Osteoblast Plays a Critical Role in Lipopolysaccharide-Induced Bone Loss Associated with Inflammation J. Immunol., August 1, 2006; 177(3): 1879 - 1885. [Abstract] [Full Text] [PDF] K. M. Anderson, S. J. Czinn, R. W. Redline, and T. G. Blanchard Induction of CTLA-4-Mediated Anergy Contributes to Persistent Colonization in the Murine Model of Gastric Helicobacter pylori Infection J. Immunol., May 1, 2006; 176(9): 5306 - 5313. [Abstract] [Full Text] [PDF] R. Higgs, P. Cormican, S. Cahalane, B. Allan, A. T. Lloyd, K. Meade, T. James, D. J. Lynn, L. A. Babiuk, and C. O'Farrelly Induction of a Novel Chicken Toll-Like Receptor following Salmonella enterica Serovar Typhimurium Infection Infect. Immun., March 1, 2006; 74(3): 1692 - 1698. [Abstract] [Full Text] [PDF] Z. Guo, S. Garg, K. M. Hill, L. Jayashankar, M. R. Mooney, M. Hoelscher, J. M. Katz, J. M. Boss, and S. Sambhara A Distal Regulatory Region Is Required for Constitutive and IFN-{beta}-Induced Expression of Murine TLR9 Gene J. Immunol., December 1, 2005; 175(11): 7407 - 7418. [Abstract] [Full Text] [PDF] R. P. Gomariz, A. Arranz, C. Abad, M. Torroba, C. Martinez, F. Rosignoli, M. Garcia-Gomez, J. Leceta, and Y. Juarranz Time-course expression of Toll-like receptors 2 and 4 in inflammatory bowel disease and homeostatic effect of VIP J. Leukoc. Biol., August 1, 2005; 78(2): 491 - 502. [Abstract] [Full Text] [PDF] S. Yang, N. Takahashi, T. Yamashita, N. Sato, M. Takahashi, M. Mogi, T. Uematsu, Y. Kobayashi, Y. Nakamichi, K. Takeda, et al. Muramyl Dipeptide Enhances Osteoclast Formation Induced by Lipopolysaccharide, IL-1{alpha}, and TNF-{alpha} through Nucleotide-Binding Oligomerization Domain 2-Mediated Signaling in Osteoblasts J. Immunol., August 1, 2005; 175(3): 1956 - 1964. [Abstract] [Full Text] [PDF] H. An, H. Xu, M. Zhang, J. Zhou, T. Feng, C. Qian, R. Qi, and X. Cao Src homology 2 domain-containing inositol-5-phosphatase 1 (SHIP1) negatively regulates TLR4-mediated LPS response primarily through a phosphatase activity- and PI-3K-independent mechanism Blood, June 15, 2005; 105(12): 4685 - 4692. [Abstract] [Full Text] [PDF] D. Aki, R. Mashima, K. Saeki, Y. Minoda, M. Yamauchi, and A. Yoshimura Modulation of TLR signalling by the C-terminal Src kinase (Csk) in macrophages Genes Cells, April 1, 2005; 10(4): 357 - 368. [Abstract] [Full Text] [PDF] F. Rharbaoui, A. Westendorf, C. Link, S. Felk, J. Buer, M. Gunzer, and C. A. Guzman The Mycoplasma-Derived Macrophage-Activating 2-Kilodalton Lipopeptide Triggers Global Immune Activation on Nasal Mucosa-Associated Lymphoid Tissues Infect. Immun., December 1, 2004; 72(12): 6978 - 6986. [Abstract] [Full Text] [PDF] R. J. Rossi, G. Muralimohan, J. R. Maxwell, and A. T. Vella Staphylococcal enterotoxins condition cells of the innate immune system for Toll-like receptor 4 stimulation Int. Immunol., December 1, 2004; 16(12): 1751 - 1760. [Abstract] [Full Text] [PDF] F Y Liew, M Komai-Koma, and D Xu A toll for T cell costimulation Ann Rheum Dis, November 1, 2004; 63(suppl_2): ii76 - ii78. [Full Text] [PDF] N. Nilsen, U. Nonstad, N. Khan, C. F. Knetter, S. Akira, A. Sundan, T. Espevik, and E. Lien Lipopolysaccharide and Double-stranded RNA Up-regulate Toll-like Receptor 2 Independently of Myeloid Differentiation Factor 88 J. Biol. Chem., September 17, 2004; 279(38): 39727 - 39735. [Abstract] [Full Text] [PDF] K. A. Eaton, S. M. Logan, P. E. Baker, R. A. Peterson, M. A. Monteiro, and E. Altman Helicobacter pylori with a Truncated Lipopolysaccharide O Chain Fails To Induce Gastritis in SCID Mice Injected with Splenocytes from Wild-Type C57BL/6J Mice Infect. Immun., July 1, 2004; 72(7): 3925 - 3931. [Abstract] [Full Text] [PDF] S. Kato, Y. Yuzawa, N. Tsuboi, S. Maruyama, Y. Morita, T. Matsuguchi, and S. Matsuo Endotoxin-Induced Chemokine Expression in Murine Peritoneal Mesothelial Cells: The Role of Toll-Like Receptor 4 J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1289 - 1299. [Abstract] [Full Text] [PDF] M. Komai-Koma, L. Jones, G. S. Ogg, D. Xu, and F. Y. Liew TLR2 is expressed on activated T cells as a costimulatory receptor PNAS, March 2, 2004; 101(9): 3029 - 3034. [Abstract] [Full Text] [PDF] K. Saito, T. Yajima, H. Nishimura, K. Aiba, R. Ishimitsu, T. Matsuguchi, T. Fushimi, Y. Ohshima, Y. Tsukamoto, and Y. Yoshikai Soluble Branched {beta}-(1,4)Glucans from Acetobacter Species Show Strong Activities to Induce Interleukin-12 in Vitro and Inhibit T-helper 2 Cellular Response with Immunoglobulin E Production in Vivo J. Biol. Chem., October 3, 2003; 278(40): 38571 - 38578. [Abstract] [Full Text] [PDF] U. Deiters, M. Gumenscheimer, C. Galanos, and P. F. Muhlradt Toll-Like Receptor 2- and 6-Mediated Stimulation by Macrophage-Activating Lipopeptide 2 Induces Lipopolysaccharide (LPS) Cross Tolerance in Mice, Which Results in Protection from Tumor Necrosis Factor Alpha but in Only Partial Protection from Lethal LPS Doses Infect. Immun., August 1, 2003; 71(8): 4456 - 4462. [Abstract] [Full Text] [PDF] T. Matsuguchi, A. Takagi, T. Matsuzaki, M. Nagaoka, K. Ishikawa, T. Yokokura, and Y. Yoshikai Lipoteichoic Acids from Lactobacillus Strains Elicit Strong Tumor Necrosis Factor Alpha-Inducing Activities in Macrophages through Toll-Like Receptor 2 Clin. Vaccine Immunol., March 1, 2003; 10(2): 259 - 266. [Abstract] [Full Text] [PDF] I. Caramalho, T. Lopes-Carvalho, D. Ostler, S. Zelenay, M. Haury, and J. Demengeot Regulatory T Cells Selectively Express Toll-like Receptors and Are Activated by Lipopolysaccharide J. Exp. Med., February 17, 2003; 197(4): 403 - 411. [Abstract] [Full Text] [PDF] E. E. Putnins, A.-R. Sanaie, Q. Wu, and J. D. Firth Induction of Keratinocyte Growth Factor 1 Expression by Lipopolysaccharide Is Regulated by CD-14 and Toll-Like Receptors 2 and 4 Infect. Immun., December 1, 2002; 70(12): 6541 - 6548. [Abstract] [Full Text] [PDF] N. Tsuboi, Y. Yoshikai, S. Matsuo, T. Kikuchi, K.-I. Iwami, Y. Nagai, O. Takeuchi, S. Akira, and T. Matsuguchi Roles of Toll-Like Receptors in C-C Chemokine Production by Renal Tubular Epithelial Cells J. Immunol., August 15, 2002; 169(4): 2026 - 2033. [Abstract] [Full Text] [PDF] V. Haehnel, L. Schwarzfischer, M. J. Fenton, and M. Rehli Transcriptional Regulation of the Human Toll-Like Receptor 2 Gene in Monocytes and Macrophages J. Immunol., June 1, 2002; 168(11): 5629 - 5637. [Abstract] [Full Text] [PDF] H. Takano, R. Yanagisawa, T. Ichinose, K. Sadakane, S. Yoshino, T. Yoshikawa, and M. Morita Diesel Exhaust Particles Enhance Lung Injury Related to Bacterial Endotoxin through Expression of Proinflammatory Cytokines, Chemokines, and Intercellular Adhesion Molecule-1 Am. J. Respir. Crit. Care Med., May 1, 2002; 165(9): 1329 - 1335. [Abstract] [Full Text] [PDF] K. Dabbagh, M. E. Dahl, P. Stepick-Biek, and D. B. Lewis Toll-Like Receptor 4 Is Required for Optimal Development of Th2 Immune Responses: Role of Dendritic Cells J. Immunol., May 1, 2002; 168(9): 4524 - 4530. [Abstract] [Full Text] [PDF] P.-L. Wang and K. Ohura PORPHYROMONAS GINGIVALIS LIPOPOLYSACCHARIDE SIGNALING IN GINGIVAL FIBROBLASTS-CD14 AND TOLL-LIKE RECEPTORS Critical Reviews in Oral Biology & Medicine, March 1, 2002; 13(2): 132 - 142. [Abstract] [Full Text] [PDF] J. Ismaili, J. Rennesson, E. Aksoy, J. Vekemans, B. Vincart, Z. Amraoui, F. Van Laethem, M. Goldman, and P. M. Dubois Monophosphoryl Lipid A Activates Both Human Dendritic Cells and T Cells J. Immunol., January 15, 2002; 168(2): 926 - 932. [Abstract] [Full Text] [PDF] C. Li, Y. Wang, L. Gao, J. Zhang, J. Shao, S. Wang, W. Feng, X. Wang, M. Li, and Z. Chang Expression of Toll-like Receptors 2 and 4 and CD14 during Differentiation of HL-60 Cells Induced by Phorbol 12-Myristate 13-Acetate and 1{alpha}, 25-Dihydroxy-Vitamin D3 Cell Growth Differ., January 1, 2002; 13(1): 27 - 38. [Abstract] [Full Text] [PDF] T. Wang, W. P. Lafuse, and B. S. Zwilling NF{kappa}B and Sp1 Elements Are Necessary for Maximal Transcription of Toll-like Receptor 2 Induced by Mycobacterium avium J. Immunol., December 15, 2001; 167(12): 6924 - 6932. [Abstract] [Full Text] [PDF] D. Sun, A. R. Muthukumar, R. A. Lawrence, and G. Fernandes Effects of Calorie Restriction on Polymicrobial Peritonitis Induced by Cecum Ligation and Puncture in Young C57BL/6 Mice Clin. Vaccine Immunol., September 1, 2001; 8(5): 1003 - 1011. [Abstract] [Full Text] [PDF] G. M. Bahr, E. C. A. Darcissac, N. Casteran, C. Amiel, C. Cocude, M.-J. Truong, J. Dewulf, A. Capron, and Y. Mouton Selective Regulation of Human Immunodeficiency Virus-Infected CD4+ Lymphocytes by a Synthetic Immunomodulator Leads to Potent Virus Suppression In Vitro and in hu-PBL-SCID Mice J. Virol., August 1, 2001; 75(15): 6941 - 6952. [Abstract] [Full Text] J. E. Wang, A. Warris, E. A. Ellingsen, P. F. Jorgensen, T. H. Flo, T. Espevik, R. Solberg, P. E. Verweij, and A. O. Aasen Involvement of CD14 and Toll-Like Receptors in Activation of Human Monocytes by Aspergillus fumigatus Hyphae Infect. Immun., April 1, 2001; 69(4): 2402 - 2406. [Abstract] [Full Text] [PDF] T. Musikacharoen, T. Matsuguchi, T. Kikuchi, and Y. Yoshikai NF-{{kappa}}B and STAT5 Play Important Roles in the Regulation of Mouse Toll-Like Receptor 2 Gene Expression J. Immunol., April 1, 2001; 166(7): 4516 - 4524. [Abstract] [Full Text] [PDF] T. H. Flo, O. Halaas, S. Torp, L. Ryan, E. Lien, B. Dybdahl, A. Sundan, and T. Espevik Differential expression of Toll-like receptor 2 in human cells J. Leukoc. Biol., March 1, 2001; 69(3): 474 - 481. [Abstract] [Full Text] T. Kikuchi, T. Matsuguchi, N. Tsuboi, A. Mitani, S. Tanaka, M. Matsuoka, G. Yamamoto, T. Hishikawa, T. Noguchi, and Y. Yoshikai Gene Expression of Osteoclast Differentiation Factor Is Induced by Lipopolysaccharide in Mouse Osteoblasts Via Toll-Like Receptors J. Immunol., March 1, 2001; 166(5): 3574 - 3579. [Abstract] [Full Text] [PDF] R. Dziarski, Q. Wang, K. Miyake, C. J. Kirschning, and D. Gupta MD-2 Enables Toll-Like Receptor 2 (TLR2)-Mediated Responses to Lipopolysaccharide and Enhances TLR2-Mediated Responses to Gram-Positive and Gram-Negative Bacteria and Their Cell Wall Components J. Immunol., February 1, 2001; 166(3): 1938 - 1944. [Abstract] [Full Text] [PDF] K.-i. Iwami, T. Matsuguchi, A. Masuda, T. Kikuchi, T. Musikacharoen, and Y. Yoshikai Cutting Edge: Naturally Occurring Soluble Form of Mouse Toll-Like Receptor 4 Inhibits Lipopolysaccharide Signaling J. Immunol., December 15, 2000; 165(12): 6682 - 6686. [Abstract] [Full Text] [PDF] T. Wang, W. P. Lafuse, and B. S. Zwilling Regulation of Toll-Like Receptor 2 Expression by Macrophages Following Mycobacterium avium Infection J. Immunol., December 1, 2000; 165(11): 6308 - 6313. [Abstract] [Full Text] [PDF] T. Matsuguchi, T. Musikacharoen, T. Ogawa, and Y. Yoshikai Gene Expressions of Toll-Like Receptor 2, But Not Toll-Like Receptor 4, Is Induced by LPS and Inflammatory Cytokines in Mouse Macrophages J. Immunol., November 15, 2000; 165(10): 5767 - 5772. [Abstract] [Full Text] [PDF] R. Dziarski and D. Gupta Role of MD-2 in TLR2- and TLR4-mediated recognition of Gram-negative and Gram-positive bacteria and activation of chemokine genes Innate Immunity, October 1, 2000; 6(5): 401 - 405. [Abstract] [PDF] A. Lahti, M. Lähde, H. Kankaanranta, and E. Moilanen Inhibition of Extracellular Signal-Regulated Kinase Suppresses Endotoxin-Induced Nitric Oxide Synthesis in Mouse Macrophages and in Human Colon Epithelial Cells J. Pharmacol. Exp. Ther., September 1, 2000; 294(3): 1188 - 1194. [Abstract] [Full Text] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Matsuguchi, T. Articles by Yoshikai, Y. Search for Related Content PubMed PubMed Citation Articles by Matsuguchi, T. Articles by Yoshikai, Y. Related Collections Immunobiology Social Bookmarking                   What's this?

	Copyright © 2000 by American Society of Hematology         Online ISSN: 1528-0020