|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 5 (March 1), 2000:
pp. 1616-1625
HEMATOPOIESIS
A soluble form of human Delta-like-1 inhibits differentiation
of hematopoietic progenitor cells
Wei Han,
Qian Ye, and
Malcolm A. S. Moore
From the Laboratory of Developmental Hematopoiesis, Memorial
Sloan-Kettering Cancer Center, New York, NY.
 |
Abstract |
Two Notch ligand families, Delta and Serrate/Jagged, have been
identified in vertebrates. Members of the Jagged family have been shown
to affect in vitro hematopoiesis. To determine whether members of the
Delta family might play a similar role in hematopoiesis, we examined
the expression of mouse Delta-like-1 (mDll1). mDll1 protein was
detected in whole marrow and in a marrow stromal cell line MS-5. At the
RNA level, both mDll1 and Notch1 were seen in marrow
precursor, differentiated hematopoietic, marrow stromal, and MS-5
cells. We isolated a cDNA encoding the human homologue of mDll1,
designated human Delta-like-1 (hDll1). A soluble form of hDll1, hDll1NDSL, containing the DSL domain and the
N-terminal sequences, was expressed and purified from bacteria as a
glutathione S-transferase (GST) fusion protein. We observed that
hDll1NDSL delayed the acquisition of
differentiation markers by murine hematopoietic progenitor cells
(Lin ) cultured in vitro with cytokines. In addition, it
promoted greater expansion (more than 3 times) of the primitive
hematopoietic precursor cell population, measured in high-proliferative
potential colony assay and day 12 colony-forming unit spleen (CFU-S)
assay, than GST controls. We also observed that the percentage of
apoptotic cells decreased and that the number of cells in the S-phase
of the cell cycle increased in the cultures of Lin
cells with hDll1NDSL. The effects of
hDll1NDSL were blocked by antibody against the mouse
counterpart of hDll1NDSL, mDll1NDSL. These
observations demonstrate that hDll1 plays a role in mediating cell fate
decisions during hematopoiesis.
(Blood. 2000;95:1616-1625)
© 2000 by The American Society of Hematology.
| |
Introduction |
The development of multiple differentiated blood cell
populations from a single stem cell involves an intricate interplay of
cell proliferation, migration, growth, differentiation, and death.1-3 Recently, the Notch pathway has been implicated
in the regulation of hematopoiesis.4 Notch signaling is an
evolutionarily conserved mechanism that is used by metazoans to control
cell fate. Notch, first cloned in Drosophila, encodes a
receptor protein with 36 epidermal growth factor (EGF)-like repeats in
the extracellular domain, a single transmembrane domain, and 6 cdc10/ankyrin repeats in the intracellular domain.5,6 Four
Notch homologues have been identified in vertebrates: Notch 1, 2, 3, and 4.7-11 Studies in vertebrates and invertebrates
indicate that signals transmitted through the Notch receptor, in
combination with other cellular factors, influence differentiation,
proliferation, and apoptotic events at all stages of
development.12
Notch ligands have been identified, including Delta and Serrate in
Drosophila13,14 and Lag-2 and Apx-1 in
Caenorhabditis elegans.15-17 Two Notch ligand
families, Delta and Serrate/Jagged, have been identified in mammals,
including Delta-like-1, 3 in mouse for the Delta
family18,19 and Jagged-1, 2 in rat and human for the
Serrate/Jagged family.20-23 Like Notch, the ligands are
single-transmembrane proteins characterized by a conserved region in
Delta, Serrate, and Lag-2, referred to as the DSL domain.16 The DSL domain is a 45-amino acid sequence containing a unique spacing
of 6 cysteines and 3 glycines. It is required for DSL ligand binding to
the Notch receptors and activation of the Notch pathways.24,25 DSL ligands are thought to act as
transmembrane proteins that interact through their extracellular
domains with Notch receptors that are expressed on adjacent
cells.24,26 However, recent genetic and biochemical
evidence demonstrates that proteolytic processing of Delta produces a
secreted extracellular domain that is biologically active as a Notch
agonist.27 This secreted form of Delta was detected in the
culture medium from Delta-transfected cells and in
Drosophila embryos.27,28 These observations raise
the possibility of diffusible DSL ligands that could have physiological
roles in activating ectopic Notch receptors. Functional analysis in
C. elegans has revealed that the secreted forms of Lag-2 and
Apx-1, containing only the N-terminal region and the adjacent DSL
domain, are sufficient for ectopic receptor activation.25,29
Members of the Serrate/Jagged family have recently been shown to
influence the development of hematopoietic progenitor
cells.23,30-34 However, the roles of the Delta family in
the regulation of hematopoiesis is unknown. In this article, we
describe the identification and isolation of a human homologue of the
Delta family, human Delta-like-1 (hDll1), and the expression pattern of
the mouse counterpart, mDll1, in bone marrow. Using a soluble form of
hDll1 (hDll1NDSL) that includes the DSL domain and the
N-terminal sequences, we have demonstrated a function of hDll1 in the
regulation of hematopoiesis. At multiple stages of their development,
hDll1NDSL inhibited the differentiation of hematopoietic
progenitor cells. It also promoted ex vivo expansion of progenitor
cells and suppressed apoptosis of hematopoietic cells in cultures
supplemented with cytokines. This result may be attributed to Notch
activation blocking progenitor differentiation and promoting expansion
of primitive progenitor population.
| |
Materials and methods |
Isolation of the human Delta-like-1 (hDll1) cDNA and in
vitro transcription/translation of the gene
A human heart  uni-Zap XR cDNA library (Stratagene, La Jolla,
CA) was used to screen hDll1 cDNA using
32P-labeled mDll1 cDNA18 as a probe by
standard methods.35 DNA sequencing was performed at Cornell
University DNA Sequencing Center (Ithaca, NY) using custom
oligonucleotide primers from Gibco-BRL Life Science Technology (Grand
Island, NY). DNA and protein sequence analysis was performed using DNA
Strider software, and database searches were accomplished
by using the BLAST network service at the National Center for
Biotechnology Information.36 The full-length hDll1
cDNA in pBluescript was in vitro translated in a coupled
transcription/translation reaction using the TNT-coupled reticulocyte
lysate system (Promega, Madison, WI).
Production of thioredoxin-mDll1NDSL fusion protein
and generation of anti-mDll1NDSL antibody
The pTrx/mDll1NDSL plasmid was constructed by subcloning
the polymerase chain reaction (PCR)-amplified mDll1NDSL
region of the mDll1 cDNA into an Escherichia coli
expression vector pTrxFus (Invitrogen, San Diego, CA). The PCR was
carried out with 5' primer (5'- GATCTCTAGACCTCCATACAGACTCT), 3'
primer (5'-GATCGTCGACAGATTGGGTCAGTGCA), and mDll1
cDNA template.18 The mDll1NDSL
includes the DSL domain and its adjacent N-terminal 50 amino acids. The
fusion protein recovered in the soluble fraction of a liter of bacteria
culture was purified by gel filtration chromatography and separated
further by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE). The fusion protein was used to immunize chickens. The
IgY antibodies were purified from the egg yolk and by the
thioredoxin-mDll1NDSL affinity column.
Western blots analysis and immunohistochemical staining
Western blot analysis was performed using the ECL luminescence
detection method (Amersham Life Science, Arlington Heights, IL).
Fifteen micrograms protein was analyzed for each sample. The
affinity-purified anti-mDll1NDSL antibody was used at 1:100
dilution. Horseradish peroxidase-labeled rabbit antichicken IgY was
then used at 1:5000 dilution. The MS-5 cell line was fixed with cold
acetone and incubated with avidin D and biotin blocking solutions
(Vector Laboratories, Burlingame, CA), which all contained
2% chicken serum, 1:50 dilution of IgY, and 1:50 dilution of
anti-thioredoxin-mNotch1 antibody raised in chicken. Biotinylated
anti-mDll1NDSL antibody was used at 50 µg/mL.
Biotinylated IgY was used as negative control. The detection system was
carried out using a Vectastain ABC-AP kit (Vector Laboratories).
Production of recombinant GST-hDll1NDSL and
hDll1NDSL proteins
The hDll1NDSL region includes the DSL domain and its
adjacent N-terminal 50 amino acids (aa 127-225). The cDNA fragment
encoding this region was amplified by PCR and was subcloned into the
expression vector pGEX-2T to create pGEX-hDll1NDSL. The PCR
was carried out with 5'-primer (5'-CGGGATCCCTCCACACAGATTCTCCTG), 3'-primer (5'-CGGAA TTCTTAGATCGGCTCTGTGCAGTAG), and
hDll1 cDNA template. pGEX-hDll1NDSL and pGEX-2T
were induced to express the GST-hDll1NDSL fusion protein
and GST on IPTG induction, respectively.
Bacterial pellet fractions containing GST-hDll1NDSL were
resuspended in 8 mol/L urea buffer A (50 mmol/L Tris/HCl,
pH 8, 1 mmol/L EDTA, 50 mmol/L NaCl, and 0.1 mmol/L
phenylmethylsulfonyl fluoride) and were renatured by dilution to
alkaline buffer without urea. Both GST and the renatured fusion protein
were purified through a DEAE Sepharose CL-6B column (Pharmacia Biotech,
Piscataway, NJ) with a bed volume of 90 mL. The column was washed by
buffer A and eluted with NaCl gradient buffer A (50-500 mmol/L). GST or
GST-hDll1NDSL in the positive DEAE fractions was further
purified with affinity chromatography using a glutathione Sepharose 4B
column (Pharmacia Biotech). To release hDll1NDSL
from the fusion protein, GST-hDll1NDSL in the DEAE
fractions was bound to the glutathione Sepharose 4B column. The column
was washed with 4-column volumes of buffer B (50 mmol/L Tris-HCl, pH
8.3, 150 mmol/L NaCl) and then with 2.5 mmol/L CaCl2
in buffer B. Thrombin protease (Pharmacia Biotech) was added at
1 U/100 µg fusion proteins. After digestion overnight, the
hDll1NDSL was recovered from the glutathione column.
The protein preparations of GST, GST-hDll1NDSL, and
hDll1NDSL were dialyzed in phosphate-buffered saline (PBS)
and filtered through 0.2-µmol/L filters. Protein concentrations were
assayed with the Bio-Rad protein assay solution (Bio-Rad, Hercules,
CA). Endotoxin levels in the final protein preparations were measured
using an endotoxin kit (Sigma, St Louis, MO).
Isolation and culture of mouse progenitor cells
A StemSep system (Stem Cell Technologies, Vancouver, Canada) was
used to isolate bone marrow progenitor cells from the Balb/C mice.
Monoclonal antibodies to the following murine cell-surface antigens
were included: T lymphocytes (CD5), B lymphocytes (CD45R), macrophages
(Mac-1), granulocytes (Gr-1), and erythroid (TER 119). The purity of
the cells was verified by fluorescence-activated cell sorting (FACS) of
Gr-1 and Mac-1 expression, which was less than 5%.
Lin cells were cultured in serum-free medium
(Ex-vivo 15; Biowhittaker, San Diego, CA) supplemented with cytokine
cocktails. The cytokines used in this study included interleukin-3
(IL-3; 10 ng/mL), c-kit ligand (KL; 20 ng/mL), GM-CSF (1000 U/mL), IL-11 (100 ng/mL), Flt3 ligand (FL; 100 ng/mL), G-CSF (1000 U/mL), IL-1 (100 U/mL), IL-6 (20 ng/mL), and erythropoietin (Epo; 10 U/mL). Cytokine cocktails, GST, and GST-hDll1NDSL proteins
were added to the cultures according to individual experiments (see
"Results"). Cultures were incubated for 7 to 12 days at
37°C in a fully humidified 5% CO2
atmosphere.
Flow cytometry analysis
Hematopoietic cells were washed with 2% fetal calf serum (FCS) in
PBS at 4°C. The cells were resuspended in 0.1 mL 2% FCS in PBS
with 1 µL Fc blocker (Pharmingen, San Diego, CA). Antibodies used
were fluorescein isothiocyanate (FITC)-conjugated rat antimouse Mac-1
and antimouse Gr-1 (Pharmingen). One microliter antibody was added to
the cells. After 30 minutes of incubation, the cells were washed twice
in 2% FCS/PBS and fixed in 1% formalin/PBS.
Cell-cycle analysis was performed using DNA binding dye propidium
iodide (PI). Hematopoietic cells were fixed in 50% ethanol and
resuspended to 0.2 mL of 10 mg/mL RNAaseA and 50 µg/mL PI. Hematopoietic cells stained with PI in the sub-G1 phase of
the cell cycle represented the apoptotic bodies and were measured as
apoptosis events by the method of Fraker et al..37 Analysis of Mac-1/Gr-1 expression and cell-cycle kinetics was performed by our
Institute Core Facility using the FACSCalibur flow cytometer (Becton
Dickinson, San Jose, CA).
Progenitor assay
Cells were plated in 1 mL IMDM medium containing 1.2% (wt/vol)
methylcellulose, 30% FCS, 2 mmol/L glutamine, 0.1 mmol/L
2-mercaptoethanol, and 4 mmol/L hemin plus cytokines (IL-3, GM-CSF, KL,
and Epo). Triplicate cultures were incubated for 7 days at 37°C in
a fully humidified 5% CO2 atmosphere, and
colonies were counted under a microscope. CFU-S was measured by the
injection of progenitor cells into irradiated Balb/C mice at 5 mice/group. Spleen colonies were counted after 12 days as
CFU-Sday12.
Statistical analysis
Results are presented as the mean ± standard error (SE).
Significance was determined using the two-tailed paired Student
t-test.
| |
Results |
Isolation, sequencing, and analysis of hDll1 cDNA
To clone a human Delta homologue, full-length mouse
Delta-like-1 (mDll1) cDNA, generously provided by A. Gossler,18 was used as a probe to screen a human heart cDNA
library (Stratagene). Six positive clones were isolated after the
tertiary screening. The sequences of these clones showed the highest
similarity to mDll1. We concluded that these clones contained
partial cDNA fragments of the human homologue of mDll1
(hDll1). A 2.1-kb clone was found to contain the 3' end of
hDll1 with 848 bp of untranslated region and 1252 bp of coding
region by sequence analysis. The other 1.2-kb clone contained 511 bp of
5' untranslated region and 689 bp of 5' coding region. There was a
gap of 228 bp between the two clones. To obtain a complete cDNA clone
of hDll1, primers were designed according to the sequences from
the two clones, and RT-PCR was performed using total mRNA isolated from
human bone marrow endothelial cells, generously provided by S. Raffi
(Weil Medical College, Cornell University). A cDNA fragment of 1080 bp
was obtained and cloned into plasmid pBluescript. A full-length cDNA of
hDll1 (3039 bp) was assembled by combining the PCR fragment and
the 2.1-kb clone.
This cDNA had one open reading frame of 2169 bp and was predicted to
encode a protein product having 723 amino acids (Fig. 1). The full-length cDNA was successfully
translated in vitro to produce a 79-kd protein at the predicted
molecular weight (Fig. 2D). Analysis of the
amino acid sequence indicated that hDll1 is a transmembrane protein
with a large extracellular domain (aa 1-543) and a short intracellular
domain (aa 573-723). The hDll1 protein shares more structural features
with the Delta family than with the Serrate/Jagged family, including a
DSL motif and 8 EGF-like repeats within the extracellular domain.
View larger version (59K):
[in this window]
[in a new window]
| Fig 1.
Predicted amino acid sequence of human Delta-like-1.
Alignment of amino-acid sequences between human Delta-like-1 (hDll1)
and mouse Delta-like-1 (mDll1). The secretion signal peptide (aa 1-25),
the EGF-like repeats (aa 225-516), and the transmembrane domain (aa
543-572) are shown in bold type. The DSL domain (aa 177-221) is
underlined. The Genbank accession number for hDll1 is AF196571.
|
|
View larger version (41K):
[in this window]
[in a new window]
| Fig 2.
Delta-like-1 protein expression.
(A) Western blot with chicken isotype IgY control. No signal was
observed at the position of 79 kd. (B,C) Western blot with
affinity-purified anti-mDll1NDSL antibody.
mDll1 protein (79 kd was detected in adult mouse tissues, including
lung, thymus, small intestine, brain, spleen, liver, and bone marrow.
hDll1 protein (79 kd was also detected with the same antibody in human
umbilical vein endothelial cells (HUVEC), HUVEC treated with IFN- b
and IL-1 (IL-1). (D) In vitro transcription and translation of the
hDll1 cDNA. The full-length hDll1 cDNA was in vitro
translated into a 79-kd protein. Autoradiograph of the
35S-labeled protein product separated by 10% SDS-PAGE was
shown.
|
|
Figure 1 also shows the alignment of the amino acid sequences of hDll1
and mDll1. The hDll1 protein has 90% overall amino acid identity with
mDll1, and it is longer than mDll1 by 1 amino acid. The extracellular
domains have higher degrees of conservation (89%) than the
intracellular domain (82%), and the N-terminal plus DSL sequences show
the highest conservation (95%). In addition, comparison of hDll1 with
Drosophila Delta shows that the best-matched sequences are in
the extracellular domain, with 48% amino acid identity. However, there
was only 41% identity when hDll1 was compared with human Jagged1, a
member of Serrate/Jagged family, even in the most conserved
extracellular domain. It is clear that members of the same Notch ligand
family, ie, Delta or Serrate/Jagged family, in different species, share
higher sequence identity than the members of the ligands in different
families in the same species.
mDll1 is expressed in bone marrow hematopoietic cells and in
stromal cells
To assess the expression of Dll1 proteins, cell extracts prepared
from multiple tissues were analyzed by Western blot using a chicken
polyclonal antibody that was raised against mDll1NDSL. A
negative control was obtained using the preimmune antibody (Fig. 2A).
No signals were seen in this blot in the predicted position of mDll1. A
major band of molecular weight 79 kd, the correct molecular weight for
mDll1 and hDll1, was detected in the blot with anti-mDll1 antibody
(Figs. 2B, 2C). It is expressed at high levels in the mouse lung,
thymus, and bone marrow and at lower levels in small intestine, brain,
spleen, and liver (Fig. 2B). Because hDll1 shares high homology with
mDll1 (95% identity in the region used to raise the antibody; Fig.
4A), the antibody also detected the protein in human umbilical vein
endothelial cells (HUVEC) and in HUVEC treated with interferon- and
IL-1 for 24 hours (Fig. 2C). No major difference was observed in the expression of hDll1 in untreated HUVEC versus cytokine-activated HUVEC.
The sizes of mDll1 and hDll1, detected by the Western blot, matched the
size of the in vitro translated hDll1 protein (Fig. 2D).
We examined the expression of mDll1 in MS-5 stromal cell line and
primary stromal cells using immunohistochemical staining with our
biotinylated anti-mDll1NDSL antibody. MS-5 is a mouse bone
marrow stromal derived fibroblast cell line that supports both mouse
and human long-term hematopoiesis in vitro.38,39 mDll1 was
detected in the MS-5 cells (Fig. 3B), whereas no staining was observed with the biotinylated isotype IgY
control (Fig. 3A). To confirm the specificity of the staining, the
anti-mDll1NDSL antibody raised against
thioredoxin-mDll1NDSL was preabsorbed with
GST-hDll1NDSL-coupled agarose and also with the control GST
agarose. We found that the anti-mDll1NDSL antibody staining
in MS-5 cells was completely abolished with the
GST-hDll1NDSL preabsorbed antibodies (Fig. 3C). We also
detected mDll1 expression using a similar approach in primary bone
marrow stromal cells cultured for 2 weeks in 20% FCS in RPMI medium
(Figs. 3E, 3F), whereas no staining was observed in the negative
control (Fig. 3D). The mDll1 staining appeared mostly in the cytoplasm,
with stronger staining in the perinuclear areas of the cells but not in
the nuclei (Fig. 3E). We concluded that mDll1 was expressed in a
stromal-derived fibroblast cell line and in primary bone marrow stromal
cells.
View larger version (85K):
[in this window]
[in a new window]
| Fig 3.
Immunohistochemical analysis of mDll1 protein expression.
The expression of mDll1 was detected using the affinity-purified
anti-mDll1NDSL antibody conjugated with biotin. Avidin
mediates the detection system through alkaline phosphatase
(AP)-conjugated biotin. New fuscin substrate of AP-stained the cells
expressing mDll1 red. Hematoxylin-stained the nucleus brown. (A) MS-5
cells stained with isotype IgY-biotin control and hematoxylin. The
cells show no staining in the cytoplasm and brown staining in the
nucleus. (B) MS-5 cells stained with anti-mDll1NDSL-biotin
and hematoxylin. The cells show reddish cytoplasmic and brownish
nuclear staining. (C) MS-5 cells stained with preabsorbed
anti-mDll1NDSL-biotin and hematoxylin. The cells show no
staining in the cytoplasm and brownish staining in the nucleus. (D)
Bone marrow stromal cells stained with isotype IgY-biotin control. The
cells show no cytoplasmic or nuclear staining. (E) Bone marrow stromal
cells stained with anti-mDll1NDSL-biotin. The cells show
reddish cytoplasmic and no nuclear staining. (F) Bone marrow cells
stained with anti-mDll1NDSL-biotin and hematoxylin. The
cells show reddish cytoplasmic and brownish nuclear staining.
|
|
Generation of recombinant soluble hDll1NDSL and
GST-hDll1NDSL proteins
We initially created a thioredoxin-mDll1NDSL protein
containing the DSL domain of mDll1 and its adjacent N-terminal 50 amino
acids using a pTrxFusion vector-mediated expression system. We observed that the fusion protein enhanced the expansion of primitive
hematopoietic precursors, inhibited differentiation of myeloid
progenitor cells, and suppressed apoptosis of hematopoietic cells (data
not shown). However, the control thioredoxin protein showed inhibitory
effects in the colony formation by progenitor cells, which might have compromised the function of the fusion protein. We, therefore, made a
GST-hDll1NDSL fusion protein containing the DSL domain of
hDll1 and its adjacent N-terminal 50 amino acids (Fig.
4A). GST-hDll1NDSL was
expressed and purified from the E. coli lysate. The fusion protein was estimated to be more than 95% pure by Coomassie-blue staining after purification by DEAE- and glutathione-affinity columns.
View larger version (38K):
[in this window]
[in a new window]
| Fig 4.
Production of soluble hDll1NDSL and
GST-hDll1NDSL recombinant proteins.
(A) Amino acid sequences of hDll1 and mDll1 containing the N-terminal
and DSL regions are termed hDll1NDSL and
mDll1NDSL. The two sequences are highly conserved with 92%
identity and 97% similarity in amino acid sequences. The cDNA
sequences encoding hDll1NDSL was subcloned into pGEX-2T
vector to create GST-hDll1NDSL fusion protein.
(B) Production of hDll1NDSL by digestion of the fusion
protein with thrombin protease. Coomassie-blue staining of the protein
gel is shown. Five microliters DEAE fraction, DEAE column pass and wash
(fractions 1 and 2) before digestion, and column pass and elute after
digestion were analyzed by SDS-PAGE. 1, indicates the position of
GST-hDll1NDSL at 43-kd marker; 2, indicates GST at 26 kd;
3, indicates hDll1NDSL at 17 kd. (C). Western blot analysis
of the recombinant proteins. Monomeric forms of
thioredoxin-mDll1NDSL, GST-hDll1NDSL, and
hDll1NDSL were detected at positions 34 kd, 43 kd, and 17 kd, respectively by Western blot with anti-mDll1NDSL
antibody. Polymers of the two fusion proteins were also revealed. No
staining for GST was seen. A weak band in the hDll1-NDSL lane at
approximately 27 kd was detected. It is highly possible that the band
represented a degraded or partially digested product of GST-hDll1-NDSL
during overnight incubation with thrombin protease.
|
|
To remove GST from the fusion protein, the fusion protein bound to the
glutathione beads was digested with thrombin protease. The released
hDll1NDSL protein was recovered from the glutathione beads
with limited GST contamination (Fig. 4B). It was difficult to remove
the contaminated GST from hDll1NDSL even when the digested
protein was passed through the glutathione-affinity column twice,
suggesting that GST is probably in close association with
hDll1NDSL and that protein-protein interactions may help
to stabilize hDll1NDSL in solution.
The sequence of GST-hDll1NDSL in the
pGEX-2T vector was verified by DNA sequencing, and the nature of the
recombinant protein was examined in Western blot with
anti-mDll1NDSL antibody (Fig. 4C).
Thioredoxin-mDll1NDSL, GST-hDll1NDSL, GST, and
hDll1NDSL were separated by SDS-PAGE in a 12% nonreducing
polyacrylamide gel. Thioredoxin-mDll1 was detected as a 34-kd band,
GST-hDll1NDSL as a 43-kd band, and hDll1NDSL as
a 17-kd band. No band was detected in the GST lane. We noticed that
both thioredoxin-mDll1NDSL and GST-hDll1NDSL
formed polymers in solution, but not hDll1NDSL.
Effects of GST-hDll1NDSL in hematopoiesis
To test the function of the GST fusion protein, we first examined
the possible hematopoietic effects of GST. Hematopoietic progenitor
cells were isolated from adult mouse bone marrow by immunomagnetic
negative selection. Lineage-negative (Lin)
progenitor cells that had not bound the antibodies against the lineage-associated cell surface markers were isolated. More than 95%
of the isolated Lin cells were Mac-1 negative, the
marker for murine monocytes and granulocytes, as analyzed by flow
cytometry; 104 Lin cells/mL was cultured
in 24-well plates in serum-free medium supplemented with IL-3, IL-1,
and GM-CSF. Bovine serum albumin bovine serum albumin and GST were
added to the above cultures, as indicated in Table
1. After 7 days, the cultures were analyzed for their cellularity, total CFU, Mac-1 expression, and cell cycles. Data collected from three independent experiments were analyzed using
overall F test. The differences in the four parameters among 6 tested
protein groups were not statistically significant (Table 1). We
concluded that GST used at concentrations of up to 0.4 µmol/L in the
liquid culture of Lin cells with serum-free medium
was without effect on the hematopoietic cells.
To determine the effective dosage of GST-hDll1NDSL
in the regulation of hematopoietic differentiation, we titrated
the fusion protein in the hematopoietic assays. GST and the fusion
protein were added to the cytokine-supported cultures of
Lin cells at different concentrations, as indicated
in Figure 5. Cultures were analyzed for the
expression of Mac-1. Data from three independent experiments showed
that Mac-1 expression was inhibited by the addition of the fusion
proteins but not by the GST controls (Fig. 5). The inhibitory effect
was protein concentration dependent, with the most effective dosage at
0.3 µmol/L.
View larger version (22K):
[in this window]
[in a new window]
| Fig 5.
A dose-response of GST-hDll1NDSL in
inhibition of myeloid differentiation.
Mouse Lin bone marrow cells were cultured for 6 days
in the serum-free medium with IL-3, GM-CSF, and IL-1.
GST-hDll1NDSL or control GST was added to the cultures at
indicated concentrations at day 0. The cultures were initiated with
1 × 104 Lin cells in 1 mL
serum-free medium. All values represent mean ± SE from three
independent experiments. Mac-1+ cells were analyzed by FACS
after the cells were stained with anti-Mac-1-FITC antibodies.
|
|
To examine the hematopoietic effects of GST-hDll1NDSL, 3 × 104 Lin cells were added to a
single well of a 6-well plate containing 3 mL serum-free medium plus
cytokines (IL-3, GM-CSF, and IL-1). GST-hDll1NDSL and
control protein GST were added in 0.1 µmol/L every 3 days. After
culture for 7 days, the cells were evaluated for their Mac-1 and Gr-1
expression, progenitor cell expansion, apoptosis, and cell-cycle
kinetics. Data from five independent experiments are summarized in
Table 1 and Figure 6.
View larger version (3035K):
[in this window]
[in a new window]
| Fig 6.
Effects of
GST-hDll1NDSL in myelopoiesis.
Mouse Lin bone marrow cells were cultured for 7 days
in the serum-free medium with IL-3, GM-CSF, and IL-1.
GST-hDll1NDSL or control GST was added to the cultures at
0.1 µmol/L every 3 days. The cultures were initiated with
3 × 104 Lincells in 3 mL
serum-free medium. All values represent mean ± SE from five
independent experiments. (A) Differentiation analysis.
Lin cells cultured for 7 days with GST or
GST-hDll1NDSL were washed and labeled with
FITC- and phycoerythrin (PE)-conjugated mAbs directed to Mac-1 or Gr-1.
The top panel of fluorescence histograms shows the cells stained with
control isotype antibodies (IgG2b-FITC and
IgG2b-PE). The middle panel shows the cells cultured with
GST and stained with anti-Mac-1 or anti-Gr-1 antibodies. The bottom
panel shows the cells cultured with GST-hDll1NDSL and
stained with the above two antibodies. The x-axis represents log
fluorescence intensity, and the y-axis represents cell numbers.
Percentages of Mac-1- or Gr-1-positive cells are indicated in
parentheses, and the MIF is shown for the corresponding M1 population
of cells. (B) Progenitor cell assay. Lin cells
before and after culture for 7 days with GST and
GST-hDll1NDSL were plated in triplicate in methylcellulose
supplemented with IL-3, GM-CSF, KL, and Epo. Colonies were scored under
microscope, including the CFU mix consisting of multiple lineages of at
least granulocyte/macrophage and erythroid clusters, CFU-GM,
burst-forming unit-erythrocyte (early BFU-E consisting of multiple
erythroid clusters and late BFU-E as a single compact erythroid colony
at day 7 of culture), and high-proliferation potential-CFU colonies
(larger than 0.5 mm in diameter). Columns represent fold expansion of
colonies formed by the progenitors. The fold expansion was calculated
as the number of colonies from the day 7 cultured cells divided by the
colonies from the cells before culture. Differences between the GST and
GST-hDll1NDSL groups are statistically significant for CFU
mix and early BFU-E (P = .02) and very significant for CFU-GM
(P = .02), late BFU-E (P = .01), and total CFU
(P = .001).
|
|
GST-hDll1NDSL increased the cell viability of
hematopoietic cells
Cells were counted using the trypan blue exclusion method. Live and
dead cells were counted separately after the Lin
cells were cultured for 7 days. Cellularity analysis from five independent experiments are summarized (Table
2). Progenitors cultured with
GST-hDll1NDSL gave rise to a similar number of total cells
compared with controls. The viable cells in the
GST-hDll1NDSL culture represented 82% of the
total cells compared with 67% in the controls (Table 2). Thus,
GST-hDll1NDSL appeared to inhibit cell death.
GST-hDll1NDSL inhibited the differentiation
of myeloid progenitors
Cell differentiation was examined by flow cytometry using anti-Mac-1
(detecting monocyte and granulocyte) and anti-Gr-1 (detecting granulocyte) antibodies. In the five independent experiments, Lin cells cultured with GST-hDll1NDSL
showed consistently lower percentages of cells expressing Mac-1 and
Gr-1. As shown in Table 2, the mean percentage of cells expressing Mac-1 at day 7 was 73% in the population cultured with
GST-hDll1NDSL versus 84% in the control
population. Similarly, the mean percentage of cells expressing Gr-1 was
50% versus 76%. These differences in expression of Mac-1 and Gr-1 are
statistically significant (P < .01). In addition, the
median intensity of fluorescence (MIF) of cells expressing Mac-1 and
Gr-1 was significantly decreased when the cells were treated with
GST-hDll1NDSL. A representative experiment is shown in
Figure 6A in which at day 7, 78% (MIF, 157) and 67% (MIF, 71) of the
cells exposed to GST-hDll1NDSL ligand expressed Mac-1 and
Gr-1 (bottom panel), respectively, compared with 92% (MIF, 253) and
88% (MIF, 1186) of control cells (middle panel).
GST-hDll1NDSL affects the cell cycle and apoptosis
of hematopoietic cells
Cell-cycle profiles were analyzed by cell sorting of the PI-stained
hematopoietic cells derived from the Lin cells
cultured for 7 days. In the five independent observations (Table 2),
Lin cells cultured with
GST-hDll1NDSL showed a significantly lower fraction of
cells in G0/G1 phase (73%) than control
GST-treated cells (86%, and a higher fraction of cells in S phase
(21%) than control cells (7%). The differences in cell cycles between
the two groups were statistically significant (P = .01).
Because GST-hDll1NDSL appeared to inhibit cell death (Table
2), the apoptotic cell population in the
sub-G0/G1 phase was analyzed during the process
of cell-cycle data collection. Cells treated with
GST-hDll1NDSL had a significantly reduced apoptotic cell
population (14%) compared with the control cells cultured with GST
(46%) (Table 2). The difference between the two groups was
statistically significant (P = .005).
GST-hDll1NDSL promotes expansion of primitive
hematopoietic progenitors
The effect of GST-hDll1NDSL on the expansion of
progenitor cells was analyzed by clonogenic assays. The number of
colonies generated after the Lin cells were cultured
for 7 days (day 7 CFU) was divided by the input colonies, giving the
fold expansion of the colony-forming progenitors during the culture.
Data from the five independent experiments are presented (Fig. 6B).
Lin cells cultured with GST-hDll1NDSL
showed significantly greater (3.3 fold) expansion of progenitors compared with the GST controls (Total CFU). In addition,
GST-hDll1NDSL promoted progenitor cell expansion in each
category of progenitors including CFU-mix (4.6 fold), CFU-GM (4.2 fold), early BFU-E (3.9 fold), and late BFU-E (3.2 fold) over the
control cultures with GST.
In summary, we investigated the phenotypic and functional changes of
Lin progenitor cells cultured with
GST-hDll1NDSL compared with the cells treated with GST in
conditions promoting myelopoiesis. Data from five independent
experiments demonstrated that GST-hDll1NDSL partially
suppressed differentiation and promoted expansion of myeloid progenitor
cells. We also observed that the fraction of cells in the S phase of
the cell cycle was increased and that the percentage of apoptotic cells
was decreased.
hDll1NDSL functions similarly to the
GST-hDll1NDSL fusion protein
To control the possibility that the effects of
GST-hDll1NDSL fusion protein were caused by the novel
fusion polypeptide rather than by the hDll1NDSL sequences,
we examined the function of hDll1NDSL released from the
fusion protein. hDll1NDSL was released by digestion of the
fusion protein bound to the GST-affinity beads with thrombin protease.
Because the free GST and thrombin were not totally removed from the
hDll1NDSL fraction (Fig. 4), 4 protein groups were
compared: (1) 0.1 µmol/L GST; (2) 0.1 µmol/L
GST-hDll1NDSL; (3) 0.1 µmol/L GST and 30 ng/mL thrombin
(the same amount used to digest the fusion protein); (4) 0.1 µmol/L
hDll1NDSL, 0.1 µmol/L GST, and 30 ng/mL thrombin. The
Lin cells were cultured for 7 days at 104
cells/mL (total of 3 ml per well in 6-well plates) in the
serum-free medium with a cytokine cocktail of IL-3, GM-CSF, and IL-1.
Under these culture conditions, the 4 protein groups were added every 3 days. Cell proliferation, differentiation, and apoptosis of the
cultured cells were evaluated. Data from three independent experiments are summarized in Table 3. Essentially, the
hDll1NDSL effects were similar to those seen with the
GST-hDll1NDSL fusion protein. The numbers of live cells
were increased in the GST-hDll1NDSL and
hDll1NDSL group over the two control groups. The numbers of
progenitor cells detected as CFU were all significantly higher in the
GST-hDll1NDSL and hDll1NDSL groups than in the
controls. The hDll1NDSL group also showed consistently
lower percentages of cells expressing Mac-1 and Gr-1 than the control
GST/thrombin group. Like the fusion protein, the hDll1NDSL
group also showed a significantly lower fraction of cells in the
G0/G1 phase than the control
GST/thrombin-treated cells and a higher fraction of cells in the S
phase than the control cells. The differences between the
GST-hDll1NDSL and the GST groups and between the
hDll1NDSL and the GST/thrombin groups were statistically
significant. Those between the GST-hDll1NDSL and the
hDll1NDSL groups and between the GST and the GST/thrombin
groups were not statistically significant. In conclusion, the results
demonstrated that the GST-hDll1NDSL fusion protein retained
the function of hDll1NDSL in regulation of hematopoiesis.
The observed hematopoietic effects of the fusion protein reflected the
function of hDll1NDSL.
GST-hDll1NDSL promoted expansion of primitive
hematopoietic progenitor cells
After defining the role of GST-hDll1NDSL in the
regulation of Lin cells, a population that included
late-stage progenitors (44% of which are in the S phase of the cell
cycle) and stem cells, we extended the functional analysis of
GST-hDll1NDSL to the early-stage hematopoietic progenitors
and stem cells. These cells were enriched in Lin
cells isolated from 5-fluorouracil-treated mouse bone marrow. The
specificity of the GST-hDll1NDSL effects was also tested by
the use of the neutralizing anti-thioredoxin-mDll1NDSL
antibody (anti-mDll1). Five thousand cells were added to a single well
of 24-well plate containing 1 mL serum-free medium plus cytokines (IL-11, KL, and FL). Four protein groups were tested: (1) 0.1 µmol/L
GST; (2) 0.1 µmol/L GST-hDll1NDSL; (3) 0.1 µmol/L
GST-hDll1NDSL plus 5 µg/mL anti-mDll1; and (4) 0.1 µmol/L GST-hDll1NDSL plus 5 µg/mL preimmune serum.
Proteins were added to the cultures every 3 days. Cells were counted
after culture for 12 days, and CFU cells including HPP-CFC (colony
greater than 0.5 mm) and CFU-GM were measured in methylcellulose assay.
Early-stage progenitors in the suspension population of cells were read
out in standard CFU-Sday12 assay by injecting
the cultured cells into the irradiated mice. Twelve days later, the
spleen colonies were counted. Data from 3 independent experiments are
summarized in Table 4. Cells cultured with
GST-hDll1NDSL showed a 2.5-fold increase in HPP-CFC, a
1.6-fold increase in CFU-GM, and a 4-fold increase in
CFU-Sday12 compared with the control cells
cultured with GST. Furthermore, the GST-hDll1NDSL
effects were significantly blocked by the presence of anti-mDll1 antibody but not affected by the preimmune serum. The anti-mDll1 was raised against thioredoxin-mDll1NDSL, which showed 92%
identity with the corresponding region of hDll1 (Fig. 4A). Thus, the
data in Table 4 demonstrate that hDll1NDSL promoted the
expansion of noncycling primitive progenitors. The hDll1NDSL effect was blocked by the anti-mDll1 antibody,
which further confirmed that the function of the fusion protein was
hDll1NDSL sequence dependent.
View this table:
[in this window]
[in a new window]
|
Table 4.
GST-hDll1NDSL promotes the expansion of
primitive hematopoietic progenitor cells neutralized by
anti-mDll1NDSL antibodies
|
|
| |
Discussion |
In this article, we describe the isolation of a cDNA clone encoding
a human Delta ligand (hDll1) for Notch and the creation of a soluble
form of the ligand. A role for this soluble hDll1 in the regulation of
hematopoiesis in vitro was revealed. Although hDll1 shares all the
conserved features with other DSL proteins, it is most closely related
to mDll1. Expression of mDll1 was detected in a variety of adult mouse
tissues, including hematopoietic tissues of spleen and bone marrow.
Together with Jagged1 and Jagged223,30-32 then, 3 DSL
ligands are expressed by bone marrow stromal cells. Because Notch1 and
Notch2 were detected in hematopoietic cells,30,40 it is
likely that multiple DSL ligands and Notch receptors are involved in
the regulation of bone marrow hematopoiesis. Recently, Radtke et
al41 reported a conditional knock-out of Notch1 in mouse.
In a competitive repopulation experiment, Notch-1-deficient bone marrow
contributed normally to all hematopoietic lineages, but not to T cells.
These observations indicate the redundancy of Notch signaling, probably
caused by the expression of multiple members of Notch and its ligand in
the hematopoietic system.
We have taken a protein biochemical approach to address hDll1 function
by creating a soluble form of the newly identified Notch ligand. We
made a soluble hDll1 as a GST fusion protein, containing the DSL domain
and the adjacent N-terminal region, in a bacterial expression system.
Compared to the soluble form of Jagged1 produced in COS
cells,23,30 our production strategy achieved higher yield
and purity. Our method of ligand production may prove to be a useful
general strategy for the production of soluble receptor agonists using
other members of the Notch ligand family. In the culture of murine
Lin cells with GST-hDll1NDSL and
cytokines, we found decreased numbers of mature monocytes/macrophages and granulocytes and increased numbers of progenitor cells. We also
observed decreased numbers of apoptotic cells and increased numbers of
cells in the S-phase of the cell cycle. The function of hDll1 is thus
consistent with reports on the action of Jagged1 and Jagged2 in
hematopoiesis. In culture of primary human and mouse hematopoietic
progenitor cells, both Jagged1 and Jagged2 were shown to increase the
number of progenitors.30,31 Jagged2 also decreased the
number of mature myeloid cells as measured by the surface marker
expression of CD11b and CD14.31
We believe that the hDll1 effects, including increased numbers of
progenitor cells and cells in the S-phase of the cell cycle and
decreased numbers of apoptotic cells in cultures with
hDll1NDSL, result from the suppression of hematopoietic
progenitor differentiation. It is known that mature granulocytes
generated in culture readily undergo apoptosis within a day and that
progenitor cells exit the cell cycle as they mature. However, we cannot
rule out a mechanism by which hDll1 directly modulates the expansion,
apoptosis, and cell cycle of hematopoietic cells. Data supporting the
latter model have emerged recently. Jagged1 was shown to affect the
proliferation of hematopoietic cells as measured by thymidine
incorporation.32 The activated form of Notch1 expressed in
HL-60 cells has been shown to enhance cell progression through the G1
phase of the cell cycle, which is associated with Notch1-induced delay
of differentiation.31 It is also reported that an activated
form of Notch1 provides significant protection of T-cell lines from
TCR-mediated apoptosis.42
Most cytokines and their receptors have been identified at the
molecular level.43 Binding of cytokines to their receptors elicits both proliferation and differentiation signals. The receptor functional domains have been mapped.44 The
membrane-proximal domains of the Epo,45
GM-CSF,46 G-CSF,47 and
thrombopoietin48 receptors are sufficient for
mediating mitogenic signals, whereas the membrane-distal domains are
required only for generating differentiation signals. Cytokine-mediated
receptor oligomerization juxtaposes and activates JAK kinases
associated with the membrane-proximal box 1 and box 2 motifs of the
receptor. Activated JAKs then phosphorylate and induce nuclear
translocation of the STAT DNA-binding proteins.49 STATs
appear to be involved in functional differentiation (as opposed to
mitogenic) responses to cytokines.50 We speculate that the
activated Notch receptor could inhibit hematopoietic differentiation in
response to cytokine stimulation by interacting with molecules involved
in the cytokine differentiation pathways. Recently, Bigas et
al34 reported that mammalian Notch intracellular domain
contains a Notch cytokine response region (NCR). Notch1 and Notch2
contain different NCR and, therefore, respond to different cytokine signals.
The functional domain of the fusion protein is the region of hDll1
sequences. This is demonstrated by GST control protein having no
hematopoietic effect, antibodies against mDll1 blocking the
GST-hDll1NDSL function, and hDll1NDSL released
from the fusion proteins showing hematopoietic effects similar to those
of the fusion protein. The potential physiological role of the secreted
DSL proteins in vivo has recently been suggested because soluble forms
of Delta do exist in Drosophila embryos.27 Given
the general role of the Notch pathway in the inhibition of
hematopoietic progenitor cell differentiation, the availability of
soluble hDll1 ligand should facilitate the development of a new
strategy for the ex vivo expansion of hematopoietic stem/progenitor cells.
| |
Acknowledgments |
We thank Dr Achim Gossler for providing the mDll1 cDNA probe and Lisa
Wang for outstanding technical assistance.
| |
Footnotes |
Submitted August 12, 1999; accepted November 2, 1999.
Supported by grants from The Gar Reichman Fund of the Cancer
Research Institute, The Bernard Mendik Fund, the Public Health Service
(1-F32-HL10152-01), and the National Institutes of Health Cancer Center
(CA-08748).
Reprints: Malcolm A. S. Moore, Memorial Sloan-Kettering Cancer
Center, 1275 York Avenue Mailbox 101, New York, NY 10021; email:m-moore{at}ski.mskcc.org.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Shivdasani RA, Orkin SH.
The transcriptional control of hematopoiesis.
Blood.
1996;87:4025[Free Full Text].
2.
Morrison SJ, Shah NM, Anderson DJ.
Regulatory mechanisms in stem cell biology.
Cell.
1997;88:287[Medline]
[Order article via Infotrieve].
3.
Metcalf D.
Regulatory mechanisms controlling hematopoiesis: principles and problems.
Stem Cells.
1998;16(suppl 1):3.
4.
Milner L, Bigas A.
Notch as a mediator of cell fate determination in hematopoiesis: evidence and speculation.
Blood.
1999;93:2431[Free Full Text].
5.
Wharton K, Johansen KM, Xu T, Artavanis-Tsakonas S.
Nucleotide sequence from the neurogenic locus notch implies a gene product that shares homology with proteins containing EGF-like repeats.
Cell.
1985;43:567[Medline]
[Order article via Infotrieve].
6.
Kidd S, Kelley MR, Young MW.
Sequence of the Notch locus of Drosophila melanogaster: relationship of the encoded protein to mammalian clotting and growth factors.
Mol Cell Biol.
1986;6:3094[Abstract/Free Full Text].
7.
Ellisen LW, Bird J, West DC, et al.
TAN-1, the human homologue of the Drosophila Notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms.
Cell.
1991;66:649[Medline]
[Order article via Infotrieve].
8.
Weinmaster G, Roberts VJ, Lemke G.
A homologue of Drosophila notch expressed during mammalian development.
Development.
1991;113:199[Abstract].
9.
Weinmaster G, Roberts VJ, Lemke G.
Notch2: a second mammalian Notch gene.
Development.
1992;116:931[Abstract].
10.
Lardelli M, Dahlstrand J, Lendahl U.
The novel Notch homologue mouse Notch3 lacks specific epidermal growth factor-repeats and is expressed in proliferating neuroep |
Top
Abstract
Introduction