|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 5 (March 1), 2000:
pp. 1797-1803
NEOPLASIA
Molecular analysis of immunoglobulin genes in diffuse large B-cell
lymphomas
I. S. Lossos,
C. Y. Okada,
R. Tibshirani,
R. Warnke,
J. M. Vose,
T. C. Greiner, and
R. Levy
Division of Oncology, Department of Medicine, Department of Health
Research and Policy, and Department of Pathology, Stanford University
Medical Center, Stanford, CA; Department of Internal Medicine and
Department of Pathology, University of Nebraska Medical Center, Omaha,
NE.
 |
Abstract |
Diffuse large B-cell lymphoma (DLBCL) is a common type of
non-Hodgkin's lymphoma (NHL) that is highly heterogeneous from both clinical and histopathologic viewpoints. The immunoglobulin (Ig) heavy
(H) chain variable region genes were examined in 71 patients with
untreated primary DLBCL. Fifty-eight potentially functional VH genes were detected in 53 DLBCL cases; VH
genes were nonfunctional in 9 cases and were not detected in an
additional 9 cases. The use of VH gene families by DLBCL
tumors was unbiased without overrepresentation of any particular
VH gene or gene family. Analysis of Ig mutations in
comparison to the most closely related germline gene disclosed mutated
VH genes in all but 1 DLBCL case. More than 2% difference from the most similar germline sequence was detected in 52 potentially functional and the 8 nonfunctional VH gene sequences,
whereas less than 2% difference from the germline sequence was
observed in 3 VH gene isolates. Only 3 VH gene
isolates were unmutated. No correlation was found between
VH gene use, mutation level, and International Prognostic
Index (IPI) or survival. Six of 8 tested tumors showed evidence of
ongoing somatic mutations. Evidence for positive or negative antigen
selection pressure was observed in 65% of mutated DLBCL cases. Our
findings indicate that the etiology and the driving forces for clonal
expansion are heterogeneous, which may explain the well-known clinical
and pathologic heterogeneity of DLBCL.
(Blood. 2000;95:1797-1803)
© 2000 by The American Society of Hematology.
| |
Introduction |
The immunoglobulin (Ig) heavy (H) chain variable region
is formed during normal B-cell ontogeny by an ordered process of Ig gene rearrangement leading to the assembly of distinct variable (V),
diversity (D), and joining (J) gene segments. This phenomenon is known
as VDJ recombination.1 A single VH gene is
chosen from the available VH repertoire consisting of
approximately 51 potentially functional genes that are grouped into 7 structurally related families on the basis of at least 80% nucleotide
sequence homology.2,3 The large diversity among the Ig H
chain variable regions is generated by combinatorial permutation of
different V, D, and J gene segments and by addition or deletion of
short coding sequences at the VD and DJ joints. An additional process of sequence diversification by somatic hypermutation following antigen
encounter occurs in B cells proliferating within the microenvironment of the germinal center (GC).4,5 Although the process of
somatic hypermutation has an element of randomness, antigen selection tends to result in a conservation of Ig framework regions (FR) and in a
clustering of replacement mutations within the complementary determining regions (CDR).6-8 Therefore, somatically
mutated variable region genes are a hallmark of GC B cells and their descendants.
The majority of B-cell lymphomas contain Ig gene rearrangements and
usually express a unique clonal surface Ig that provides a specific
tumor marker. Analysis of lymphoma variable region genes coding for the
variable region of tumor Ig may have important implications for tumor
diagnosis, monitoring, and treatment. Examination of variable region
mutations in B cell tumors may help to trace the developmental stage at
which neoplastic transformation has occurred and assign these cells to
their normal counterparts. Moreover, VH gene analysis may
reveal pathogenic aspects of B-cell lymphomas, including possible bias
in V-gene usage. For instance, preferential V-gene usage might
implicate a role for a superantigen, which by binding to surface Ig
receptor via unmutated FR may drive B-cell
proliferation.9,10
Several groups, including our own, have analyzed Ig H chain variable
region in small cohorts of patients with diffuse large B-cell lymphoma
(DLBCL).11-16 The results of these studies are inconsistent. Biased VH gene use with overrepresentation of
VH 4 gene family and particularly of VH 4-34 gene was observed in 3 of the 6 reported studies,11,14,15
whereas the other 3 studies12,13,16 reported an unbiased
VH gene use in DLBCL. Extensive somatic mutations in the
VH genes were observed in tumor samples from DLBCL patients in all these studies. However, the issue of ongoing somatic mutation in
DLBCL is controversial, some studies demonstrating no intraclonal variation 11,17-20 and others showing ongoing
hypermutation, similar to follicular lymphoma (FL).21-23
To further elucidate these issues VH gene sequences from
tumor samples were examined in a large cohort of untreated patients with DLBCL.
| |
Materials and methods |
Patient material
Tumor tissues were chosen randomly from the available fresh frozen
biopsy specimens of lymph nodes or extralymphatic lymphoid tissue from
untreated patients with a pathologic diagnosis of primary DLBCL
according to the REAL classification.24 Table 1 summarizes the biopsy sites from which
tissue samples were obtained. The tissue samples were embedded in
Tissue-Tek Optimal Cutting Temperature (OCT) compound 4583 (Miles Inc.,
Elkhart, IN) and preserved at  80°. Twenty-seven samples were
obtained from the University of Nebraska Medical Center and 44 samples from the Stanford University Medical Center. Clinical outcome data were
available for all samples.
Tissue section analysis
The randomly chosen frozen tissue specimens were reviewed to confirm
the DLBCL diagnosis according to the REAL classification24 before RNA extraction. Samples derived from Stanford University Medical
Center were stained with anti-Ig heavy and light chain antibodies
(Becton Dickinson, San Jose, CA) and with the 9G4 antibody (generous
gift from Dr. F. Stevenson, Southhampton, UK), a rat IgG 2a antibody
directed to FR1 of VH 4-34.14
Frozen sections, 5 µ thick, were cut onto slides coated with
poly-L-lysin (Sigma, St. Louis, MO). Frozen sections for
staining with anti-Ig heavy and light chain antibodies were fixed in
cold (4°C) acetone for 10 minutes, air dried, and incubated with
mouse antihuman Ig µ,  , or  antibodies at 25°C for 30 minutes. Sections were then rinsed in 25°C phosphate-buffered
saline (PBS) and incubated with biotin-conjugated goat antimouse
antibody (Jackson Immuno Research, West Grove, PA) for 40 minutes at
25°C. Frozen sections for staining with the 9G4 antibody were fixed
in cold formalin for 10 minutes, washed in 25°C PBS, and stained
with the 9G4 antibody at 25°C for 30 minutes. The 9G4 antibody was
detected with biotin-conjugated goat antirat antibody (Jackson Immuno
Research) for 40 minutes at 25°C. Secondary antibody-stained
sections were rinsed in 25°C PBS and incubated with
streptavidin-conjugated horseradish peroxidase (Jackson Immuno
Research) for 40 minutes at 25°C. Sections were then rinsed twice
in PBS and reacted with 30 mg/mLl of diaminobenzidene (Sigma) in 0.01%
H2O2 in PBS for 5 minutes at 25°C. Sections
were rinsed in PBS and in water and incubated with CuSO4
(0.5% in 1 N NaCl) for 5 minutes at 25°C. Sections were then
rinsed once more in water, counterstained in 2% methylene blue for 20 minutes, and finally rinsed, dehydrated, and examined. Morphologically identified lymphoma cells were considered positive if a clear membrane
immunoperoxidase reaction product was seen.
RNA isolation and reverse transcription-polymerase chain
reaction (RT-PCR)
Total cellular RNA or messenger RNA was isolated from the
cryopreserved DLBCL specimens using the RNeasy kit (Qiagen, Valencia, CA) or FastTrack 2.0 kit (Invitrogen, Carlsbad, CA) according to the
manufacturer's instructions. The RNA was reverse transcribed with 15 u
AMV Reverse Transcriptase (Promega, Madison, WI) per 1µg of RNA at
45°C for 45 minutes in a 30-µL volume in a buffer containing 5 mM
MgCl2, 10 mM Tris-HCl pH 8.8, 50 mM KCl, 0.1% Triton
X-100, 1 mM of each dNTP, 1 U/µL Recombinant Rnasin Ribonuclease Inhibitor, 0.5 µg Oligo(dT)15 per 1 µg RNA and 1.5 µg
RNA. One thirtieth of a complementary DNA (cDNA) sample was amplified
by Taq DNA polymerase with a specific 5' primer corresponding to 1 of the 6 human variable H chain family leaders (VH1
through VH6) and a 3' antisense JH consensus
primer.25 In our hands the VH1 leader primer
also amplifies sequences from the closely related VH7
family. PCR was performed in a final volume of 50 µL
containing 0.5 µM of each primer, 20 mmol/L Tris-HCl (pH 8.4), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 200 µmol/L of each dNTP and
2.5 U Taq DNA polymerase (Gibco BRL, Grand Island, NY). The PCR
conditions were: 96°C for 5 minutes, 55°C for 1 minute,
72°C for 3 minutes, 1 cycle; 94°C for 30 seconds, 55°C for
30 seconds, 72°C for 30 seconds, 30 to 35 cycles; and 72°C for
5 minutes, 1 cycle. Beta-2-microglobulin ( 2 M) was amplified using
specific primers (5' 2M: ATCCAGCGTACTCCAAAGATT and
3'2M: CATGTCTCGATCCCACTTAAC) and served as a control of
RNA-cDNA integrity. For each PCR, a control with no added template was used to check for contamination. To control for potential PCR error,
all patient samples were evaluated by 2 independent PCR reactions and
sequencing, as described later. PCR products were analyzed by 2%
agarose gel electrophoresis and stained with ethidium bromide. Bands of
appropriate size were excised from the gels and purified by adsorption
to a silica matrix (QIAquick columns, Qiagen).
Sequencing and cloning of PCR products
Direct DNA sequencing of PCR amplicons was performed on an 373 automatic DNA sequencer (Applied Biosystems, Foster City, CA) using ABI
Prism Big Dye Terminator Kit (Perkin Elmer, Foster City, CA) as recommended by the manufacturer. The same primers
used for the PCR were used for sequencing. The sequence was defined as
clonal if identical CDR3 sequences were obtained from 2 independent PCR
reactions. If direct DNA sequencing attempt of the PCR amplicon failed
to recover an unambiguous sequence, the PCR amplicons were cloned into
a TA-PCR cloning vector (Invitrogen). After the transformation of
competent Escherichia coli (1 Shot INV  F', Invitrogen)
and plating on selective agar (50 µg/mL of kanamycin, 40 µL of the 40 µg/mL of the X-gal), 10 to 12 white colonies were picked per sample and used in a second round of PCR. Identity of the products was
established by restriction digest and 3 to 6 amplicons were selected
for sequencing.
To determine the RT-Taq polymerase error rate of our experimental
design, 26 clones of 2 mol/L were sequenced. These clones were
generated according to the same RT-PCR and cloning procedures as used
for the VH genes. Our RT-Taq error rate thus established is 0.09%,
which amounts to 0.36 mutations per VH clone.
Analysis of intraclonal heterogeneity
To evaluate for the presence of ongoing mutations in primary DLBCL,
8 specimens were examined by repeated cloning and sequencing of at
least 15 molecular clones from each specimen. For evaluation of
intraclonal heterogeneity, the following definitions were used: unconfirmed mutation a substitution mutation observed in only 1 of the
VH gene molecular clones from the same tumor specimen; confirmed
mutationa mutation observed more than once in the VH gene molecular
clones from the same tumor specimen.
Only the confirmed mutations were considered as evidence of intraclonal
heterogeneity; the unconfirmed mutations were disregarded because they
can be caused by Taq polymerase error.
Mutation analysis
Sequence analysis was done using programs MacVector and Assembly
Lign (Oxford Molecular Group, Campbell, CA). Sequences were aligned
with germline sequences derived from Vbase database and DNA plot on the
Internet. The VH gene sequences were compared with the
germline genes with the highest homology and, accordingly, the number
of somatic mutations was determined. Mutations at the last nucleotide
position of the sequenced fragment were excluded from the mutational
analysis because they might result from nucleotide deletion at the
joining sites. Percent of sequence identity was calculated from the
aligned sequences from the beginning of FR1 to the end of FR3.
The probability that an excess or scarcity of replacement (R) mutations
in VH CDRs or FRs occurred by chance was calculated by a
multinominal distribution model. The total number of mutations in each
VH gene is denoted by n = r1 +s1
+r2 + s2, in which r1 and
r2 are replacement mutations and s1 and
s2 are silent mutations in FR and CDR regions,
respectively. The theoretical probabilities for r1,
s1, r2, and s2 mutations are
denoted by p1, q1, p2, and q2, respectively. These probabilities are calculated by the
following equations: p1 = RfFR × LrFR; q1 = (1-RfFR) × LrFR; p2 = RfCDR × (1-LrFR) and q2 = (1-RfCDR) × (1-LrFR) in which LrFR is a relative size of the FR and RfFR and RfCDR are the
inherent susceptibility to R mutations of the FRs and CDRs,
respectively. RfFR and RfCDR were calculated
for each of the identified germline genes and are based on the chance
of the occurrence in each codon of an amino acid replacement given any
single nucleotide change not resulting in a termination codon.
The probability of observing r1 or fewer replacement
mutations in FR regions is then given by the multinominal tail
probability:
The sum is taken over values of k ranging from 0 to r1 and
all combinations of S1, R2, S2 such
that k+ S1 + R2 + S2 = n. To
compute the P value of an observed number r1, it is
customary to split the probability at r1: P
value = P (R1 < r1) + 0.5 × P
(R1 = r1). It should be noted that P
(R1 = r1) = P(R1  r1)-P(R1 r1-1), and P(R1
< r1) = P(R1 < r1)-P(R1 = r1).
The probability of observing r2 or more replacement
mutations in CDR regions is similarly computed by the following
equation:
And the P value is computed by P
value = P(R2 > r2) + 0.5 × P(R2 = r2). For both FR and CDR, 1-sided
P values were used.
The Chang and Casali equation26 was not applied because it
considers a binominal distribution of mutations while the distribution is multinominal and it does not consider all the combinatorial possibilities of mutations and results in less stringent analysis.
| |
Results |
VH gene use in DLBCL
Reverse transcriptase-PCR using VH leader and JH consensus primers
was performed in 71 patients with primary untreated DLBCL. In 3 (4.2%)
patients an Ig VH gene PCR product could not be detected despite successful amplification of 2M that served as a control for
RNA-cDNA integrity. In 6 (8.4%) patients, multiple nonclonal bands, as
determined by subcloning and sequencing, were detected. Most probably
these bands derive from polyclonal reactive B cells infiltrating these
tumors. The failure to detect monoclonal VH gene sequences
in these 9 cases may result from somatic mutations in the region to
which PCR primers used in this study are designed to hybridize, thus
leading to lower amplification efficiency and possible false-negative
results. Alternatively, absence of Ig rearrangement, as was previously
reported in rare DLBCL cases,16,27 may explain the absence
of monoclonal VH gene sequences in some of these cases.
Seventy clonal VH gene sequences were detected in 62 patients (2 clonal sequences in 6 patients and 3 clonal sequences in 1 patient). In 43 (69%) cases the PCR product could be sequenced directly, whereas in 19 (31%) cases PCR amplicons had to be subcloned to identify the VH gene. In 4 of these cases, the clonal
product amplified by the VH3 leader primer had 200 bp or larger
substitution inserts located between the leader and the JH regions,
substituting part of the natural VH gene sequence and
resulting in open reading frame sequences in 2 samples. The presence of
these inserts was verified by repeated PCR and cloning. A search in the
GenBank data library could not identify similar sequences. These
VH genes were excluded from analysis.
Among the remaining 66 clonal VH gene sequences, 58 were
potentially functional and 8 were rendered nonfunctional by
out-of-frame rearrangement (5 sequences) or by somatic mutations
leading to the introduction of stop codons in the V region (3 sequences). The nonfunctional sequences were derived from the following
VH genes: VH1-08, VH1-46, VH2-05, VH3-23, VH3-07, VH3-09,
VH4-61, and VH4-30-4. Three of these nonfunctional sequences derived
from tumors that had an additional potentially functional
VH gene sequence, whereas in 5 cases the nonfunctional
sequence was the solitary VH gene isolate found in the
tumor cells.
Fifty-eight potentially functional VH gene sequences were
detected in 53 DLBCL cases (Table
2). In 5 cases, 2 potentially functional VH genes were found (in one of these, an
additional nonfunctional clonal VH gene was also detected).
The multiplicity of potentially functional VH genes in the
same tumor may be attributed to: (1) lack of allelic exclusion, as was
previously reported in the B-cell chronic lymphocytic leukemia
(CLL)28; (2) numerical chromosomal aberrations that are
reported in 91% of DLBCL29; gain of an additional
chromosome 14 may result in the presence of 3 rearranged Ig genes in
the tumor cells; or (3) biclonal B cell tumor with 2 different clonal
VH genes.30
The 58 potentially functional VH genes used by these 53 DLBCL cases were derived from 6 of the 7 human VH gene
families in the following distribution: VH1,12.1%; VH2,10.3%; VH3,
44.8%; VH4, 25.9%; VH5, 5.2%; and VH7, 1.7% (Table
3). This VH family distribution
is comparable with the relative complexity of functional germline
VH genes within each family and to the use of
VH families in peripheral and lymph node lymphocytes in
healthy donors, as was previously established by various techniques
(see Table 3).2,31-34 Thus, VH gene family use
by untreated primary DLBCL is random and unbiased.
The most frequently encountered genes were VH3-23 (n = 6), VH3-33
(n = 5), VH4-34 (n = 5), VH4-39 (n = 5), VH3-48 (n = 4), and
VH2-05 (n = 4), which represent 10.3%, 8.6%, 8.6%, 8.6%, 6.9%, and 6.9%, respectively, of all the potentially functional
VH genes identified in this study. Some of these genes,
including VH3-23, VH4-34, and VH4-39, are also found at higher than
expected frequency in normal individuals.33,35-37
No correlation between VH gene family use and the IPI or
patient's survival was detected (data not shown).
Immunohistochemistry
Forty-four tumor samples derived from Stanford University Medical
Center were stained with anti-Ig and 9G4 antibodies. The staining
results were interpreted blindly, without the knowledge of sequencing
results. Staining with 9G4 antibody, directed to the VH4-34 gene, was
positive in 5 cases, identifying all the VH4-34 DLBCL cases determined
by molecular analysis without false-positive or false-negative results.
Staining with anti-Ig antibodies was positive in 19 (42.3%) cases and
negative in 25 (56.8%). Both lower (17%)38 and higher (> 60%)39 prevalence of anti-Ig-stained negative DLBCL
cohorts are reported in the literature. All the tumors that reacted
with anti-Ig antibodies had potentially functional Ig VH
gene PCR product. Among the 25 tumors that lacked staining with
anti-Ig antibodies, 8 had solitary nonfunctional VH gene
sequences, including the 4 cases with the insertions described above
and 4 cases in which monoclonal VH genes were not found.
However, in 13 cases that did not stain with anti-Ig antibodies, a
potentially functional monoclonal VH gene sequence was
detected. The discrepancy between the PCR sequencing and the staining
results may stem from a posttranscriptional effect on Ig expression by
the requirement of proper Ig protein folding, that could be impaired in
these cases by replacement somatic mutations. Moreover, the light chain
sequences, which are required for Ig stabilization and expression, were
not analyzed. The presence of nonfunctional rearranged light
chain may explain the observed disconcordance between the staining and
the PCR sequencing results. Noticeably, all the cases that did not
stain with anti-Ig antibodies while harboring a potentially functional
monoclonal VH gene sequence also did not stain with
anti- or anti- chain antibodies.
A similar VH gene family use was found in the cases that
stained or did not stain with anti-Ig antibodies (data not shown).
Intraclonal heterogeneity
Intraclonal variation was assessed by extensive molecular cloning in
8 potentially functional VH gene isolates from 8 tumor specimens obtained from various biopsy sites (Table
4). These specimens were selected randomly
and included 7 samples whose clonal Ig sequence was established by
direct sequencing of the PCR product and 1 sample in which the
VH gene sequence was established after molecular cloning
from the PCR product. In 2 of the tested samples, the extensively
mutated clonal VH gene isolates did not show intraclonal
heterogeneity. In 6 samples intraclonal heterogeneity was detected. In
these cases molecular clones harboring confirmed mutations not observed
in the most abundant clonal VH gene sequence were found.
The extent of the intraclonal heterogeneity varied between DLBCL
samples, 3 specimens (DLBCL no. 4, 34, and 41) demonstrated a
limited number of additional mutations, whereas others (DLBCL no. 15, 20, and 43) exhibited extensive variations between tumor VH
gene subclones, similar in prevalence to that typically observed in
FL.40-42
Analysis of mutation pattern
Only 3 VH gene sequences had less than 2% difference
from the most similar germline gene and an additional 3 VH
gene isolates had a germline unmutated sequence. More than 2%
difference from the most similar germline sequence was detected in the
remaining 52 potentially functional and the 8 nonfunctional
VH gene sequences. No significant difference in the
mutation level was observed between the nonfunctional and potentially
functional VH gene isolates, thus suggesting that the
mutational process was active on both allele products. Forty (68.9%)
of the potentially functional VH gene isolates differed by
more than 5% from the most similar germline counterpart and 24 (41.4%) differed by more than 10%. In the 5 cases with 2 potentially
functional VH gene isolates, 3 had a similar level of
mutation in both identified VH genes, whereas in 2, only 1 isolate was mutated while the second was unmutated. No correlation
between the level of mutation and VH gene family use was observed.
Analysis of the distribution of the R versus S mutations demonstrated
that 33 of the 55 potentially functional mutated VH genes
contained a significantly lower number of R mutations in the FRs (see
Table 2) than would be expected if mutations had occurred by chance
alone without selective forces. Thus, in these genes a selective force
to conserve FR sequences and maintain binding to an antigen can be
inferred. In most of the mutated sequences the CDRs R/S ratio values
were higher than those within FRs of the corresponding VH
genes. However, in only 13 potentially functional sequences was the
presence of the positive selective forces observed, as demonstrated by
an excess of R mutations in the CDRs, exceeding that expected to occur
by chance (see Table 2). In 12 DLBCL cases concomitant scarcity of R
mutations in FRs and excess of R mutations in CDRs were observed. We
performed a search for similar R mutations within the CDRs of isolates
belonging to the same VH genes. Recurrent amino acid
changes were not observed in the tumor samples tested in this study.
| |
Discussion |
The present study was undertaken to clarify the issues of
VH gene use and somatic mutation in DLBCL. For this
purpose, molecular analysis of the Ig VH region was performed in 71 untreated primary DLBCL patientsthe largest cohort studied to date.
This study demonstrates an unbiased VH gene use in DLBCL.
The VH3, the largest family, was used most often, followed by VH4, VH1,
VH2, VH5, and VH7, an ordering that is similar to the number of
functional genes within each family.2,3 The VH
gene use in DLBCL is also similar to the previously reported use of
VH families in peripheral and lymph node lymphocytes in
normal individuals (see Table 3).2,31-34 VH4-34 gene was
used in 5 (8.6%) potentially functional VH sequences
similar to its use in normal individuals.36,37
Previous studies evaluating VH gene use in DLBCL reported
disconcordant results. Daley et al12 evaluated
VH gene use in 10 DLBCL cell lines and reported random
VH family use that mirrors VH family complexity
and VH family use in normal B cells. Rosenquist et
al16 studied 35 DLBCL samples by PCR and found an unbiased VH family use. However, sequencing or cloning analysis of
VH genes to verify clonality and to exclude amplification
of Ig genes derived from infiltrating reactive B cells was not
performed in that study. Kuppers et al13 examined 19 DLBCL
tumors and reported unbiased VH family use.
In contrast, biased VH family use with overrepresentation
of VH4-34 gene was reported in other DLBCL studies. Stevenson et al14 evaluated the use of VH4-34 gene in NHL by
immunostaining with 9G4 antibody, which recognizes the A-V-Y amino acid
sequence within FR1 of VH4-34. Five of the 28 intermediate and
high-grade NHL used VH4-34; however, it was not clear which of these
cases were DLBCL. Funkhouser and Warnke15 found VH4-34 gene
use in 6 of 20 DLBCL cases by using the same antibody. In none of these studies was the clinical status of evaluated cases reported, making it
unclear if these cases were evaluated at presentation, before therapy,
or at the time of lymphoma relapse. In a previous study performed in
our laboratory,11 biased VH family use in DLBCL was found, with 14 of 17 cases using VH4 family genes, 11 of which were
VH4-34. This study group mostly included samples acquired from patients
at the time of lymphoma relapse. None of these cases was included in
the present study. In addition, we have reexamined these cases by our
current methods and reconfirmed the previously published results. The
reason for the discrepancy in the reported use of VH
families in DLBCL is unclear, but it may be caused by the inclusion of
untreated and relapsed DLBCL cases in different studies and the
relatively small size of the previous study cohorts. Analysis of a
large group of untreated DLBCL specimens, as was done in the present
study, should put to rest the issue of VH gene use in this tumor.
Intraclonal heterogeneity is a consistent finding in FL, which
represents a germinal center tumor prototype. However, contradicting results regarding the presence of intraclonal heterogeneity in DLBCL
were reported in the literature. Intraclonal heterogeneity was shown in
several untreated DLBCL cases,21,22 primary testicular lymphoma,23 and in some but not all the specimens of
primary DLBCL of the brain43 and stomach.44
Absence of intraclonal variation in DLBCL was previously reported in
relapsed DLBCL cases11 and in DLBCL of the
skin19 and in patients with acquired immunodeficiency syndrome.18 The extent of the molecular cloning may account for the observed discrepancy. Evaluation of insufficient number of
molecular clones may fail to discriminate between real mutations and
Taq errors and fail to detect a low level of intraclonal heterogeneity. Indeed, our initial examination of a small number of clones in 19 specimens in this study failed to reveal intraclonal heterogeneity, whereas evaluation of a larger number of molecular clones disclosed its
presence. The present study extensively cloned 8 untreated DLBCL
specimens from different tissues. The results suggest the presence of 2 DLBCL subgroups based on the presence of intraclonal heterogeneity: a
large DLBCL subgroup showing evidence of ongoing mutations, which is a
hallmark of GC microenvironment, and a smaller subgroup without
intraclonal heterogeneity. Whether these subgroups represent DLBCL
cases originating from GC and post-GC cells, respectively, or whether
the transforming events may render the cell independent from the
influence of GC microenvironment is presently unclear. Further studies
elucidating these issues and correlating the presence of intraclonal
heterogeneity with tumor immunophenotype are necessary.
Analysis of mutations in VH genes can provide insights
regarding the role of antigen prior to or during DLBCL clonal
outgrowth.6,7 In 24% of the potentially functional mutated
VH genes there was evidence for positive selection as
demonstrated by analysis of R mutations in CDRs. Scarcity of R
mutations in FRs was observed in 60% of mutated sequences, thus
suggesting selection for functional Ig in these tumors. It is possible
that in some DLBCL CDRs of germline VH genes possess
sufficient antigen-binding affinity and the antigen provides negative
selective pressure by selecting against FR R mutations to maintain Ig
function. However, presently the identity of possible antigens involved
in DLBCL clonal selection is unknown. Alternatively, it is possible
that superantigens that bind Ig receptor via FR regions may be involved
in stimulation of lymphoma cells, thus providing negative selection
pressure on FR region without positive selection pressure on CDR
regions. No evidence of antigen selective pressure was evident in 35%
of mutated DLBCL cases, thus suggesting antigen independent tumor evolution. Furthermore, in contrast to normal B cells and most cases of
FL, which usually express surface antigen receptors, DLBCL cells may
propagate without surface antigen receptor expression, as demonstrated
by negative Ig immunostaining and finding of solitary nonfunctional
VH genes in a significant proportion of DLBCL tumors.
In conclusion, the present study results revealed a random use of
VH genes by DLBCL cells. In a substantial number of DLBCL cases a clonal VH gene sequence was not detected.
Functional VH genes were commonly mutated and only a small
number of unmutated germline VH gene isolates were found.
Ongoing somatic mutations were observed in the majority of cases.
Positive and or negative antigen selection pressure was observed in
65% of mutated DLBCL cases. These findings indicate a heterogeneous
pathobiology of DLBCL.
| |
Footnotes |
Supported by grants CA33399 and CA34233 from the USPHS-NIH.
R.L. is an American Cancer Society Clinical Research Professor.
Reprints: Ronald Levy, Stanford University School of Medicine,
Division of Oncology, M207, Stanford, CA 94305-5306.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Rajewsky K.
Clonal selection and learning in the antibody system.
Nature.
1996;381:751-758[Medline]
[Order article via Infotrieve].
2.
Cook GP, Tomlinson IM.
The human immunoglobulin VH repertoire.
Immunol Today.
1995;16:237-242[Medline]
[Order article via Infotrieve].
3.
Cook GP, Tomlinson IM, Walter G, et al.
A map of the human immunoglobulin VH locus completed by analysis of the telomeric region of chromosome 14q.
Nat Genet.
1994;7:162-168[Medline]
[Order article via Infotrieve].
4.
Berek C.
The development of B cells and the B-cell repertoire in the microenvironment of the germinal center.
Immunol Rev.
1992;126:5-19[Medline]
[Order article via Infotrieve].
5.
Klein U, Goossens T, Fischer M, et al.
Somatic hypermutation in normal and transformed human B cells.
Immunol Rev.
1998;162:261-280[Medline]
[Order article via Infotrieve].
6.
Shlomchik M, Mascelli M, Shan H, et al.
Anti-DNA antibodies from autoimmune mice arise by clonal expansion and somatic mutation.
J Exp Med.
1990;171:265-292[Abstract/Free Full Text].
7.
Bahler DW, Levy R.
Clonal evolution of a follicular lymphoma: evidence for antigen selection.
Proc Natl Acad Sci U S A.
1992;89:6770-6774[Abstract/Free Full Text].
8.
Bahler DW, Zelenetz AD, Chen TT, Levy R.
Antigen selection in human lymphomagenesis.
Cancer Res.
1992;52:5547s-5551s[Medline]
[Order article via Infotrieve].
9.
Li Y, Spellerberg MB, Stevenson FK, Capra JD, Potter KN.
The I binding specificity of human VH 4-34 (VH 4-21) encoded antibodies is determined by both VH framework region 1 and complementarity determining region 3.
J Mol Biol.
1996;256:577-589[Medline]
[Order article via Infotrieve].
10.
Silverman GJ.
Human antibody responses to bacterial antigens: studies of a model conventional antigen and a proposed model B cell superantigen.
Int Rev Immunol.
1992;9:57-78[Medline]
[Order article via Infotrieve].
11.
Hsu FJ, Levy R.
Preferential use of the VH4 Ig gene family by diffuse large-cell lymphoma.
Blood.
1995;86:3072-3082[Abstract/Free Full Text].
12.
Daley MD, Berinstein NL, Siminovitch KA.
Immunoglobulin heavy chain variable gene utilization in human large cell and Burkitt's lymphoma cell lines.
Clin Invest Med.
1994;17:522-530[Medline]
[Order article via Infotrieve].
13.
Kuppers R, Rajewsky K, Hansmann ML.
Diffuse large cell lymphomas are derived from mature B cells carrying V region genes with a high load of somatic mutation and evidence of selection for antibody expression.
Eur J Immunol.
1997;27:1398-1405[Medline]
[Order article via Infotrieve].
14.
Stevenson FK, Spellerberg MB, Treasure J, et al.
Differential usage of an Ig heavy chain variable region gene by human B-cell tumors.
Blood.
1993;82:224-230[Abstract/Free Full Text].
15.
Funkhouser WK, Warnke RA.
Preferential IgH V4-34 gene segment usage in particular subtypes of B-cell lymphoma detected by antibody 9G4.
Hum Pathol.
1998;29:1317-1321[Medline]
[Order article via Infotrieve].
16.
Rosenquist R, Lindstrom A, Holmberg D, Lindh J, Roos G.
V(H) gene family utilization in different B-cell lymphoma subgroups.
Eur J Haematol.
1999;62:123-128[Medline]
[Order article via Infotrieve].
17.
Taniguchi M, Oka K, Hiasa A, et al.
De novo CD5+ diffuse large B-cell lymphomas express VH genes with somatic mutation.
Blood.
1998;91:1145-1151[Abstract/Free Full Text].
18.
Delecluse HJ, Hummel M, Marafioti T, Anagnostopoulos I, Stein H.
Common and HIV-related diffuse large B-cell lymphomas differ in their immunoglobulin gene mutation pattern.
J Pathol.
1999;188:133-138[Medline]
[Order article via Infotrieve].
19.
Gellrich S, Golembowski S, Audring H, Jahn S, Sterry W.
Molecular analysis of the immunoglobulin VH gene rearrangement in a primary cutaneous immunoblastic B-cell lymphoma by micromanipulation and single-cell PCR.
J Invest Dermatol.
1997;109:541-545[Medline]
[Order article via Infotrieve].
20.
Stiernholm N, Kuzniar B, Berinstein NL.
Absence of immunoglobulin variable region hypermutation in a large cell lymphoma after in vivo and in vitro propagation.
Blood.
1992;80:738-743[Abstract/Free Full Text].
21.
Ottensmeier CH, Thompsett AR, Zhu D, Wilkins BS, Sweetenham JW, Stevenson FK.
Analysis of VH genes in follicular and diffuse lymphoma shows ongoing somatic mutation and multiple isotype transcripts in early disease with changes during disease progression.
Blood.
1998;91:4292-4299[Abstract/Free Full Text].
22.
van Belzen N, Hupkes PE, Doekharan D, Hoogeveen-Westerveld M, Dorssers LC, van't Veer MB.
Detection of minimal disease using rearranged immunoglobulin heavy chain genes from intermediate- and high-grade malignant B cell non-Hodgkin's lymphoma.
Leukemia.
1997;11:1742-1752[Medline]
[Order article via Infotrieve].
23.
Hyland J, Lasota J, Jasinski M, Petersen RO, Nordling S, Miettinen M.
Molecular pathological analysis of testicular diffuse large cell lymphomas.
Hum Pathol.
1998;29:1231-1239[Medline]
[Order article via Infotrieve].
24.
Harris NL, Jaffe ES, Stein H, et al.
A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group [see comments].
Blood.
1994;84:1361-1392[Free Full Text].
25.
Campbell MJ, Zelenetz AD, Levy S, Levy R.
Use of family specific leader region primers for PCR amplification of the human heavy chain variable region gene repertoire.
Mol Immunol.
1992;29:193-203[Medline]
[Order article via Infotrieve].
26.
Chang B, Casali P.
The CDR1 sequences of a major proportion of human germline Ig VH genes are inherently susceptible to amino acid replacement.
Immunol Today.
1994;15:367-373[Medline]
[Order article via Infotrieve].
27.
Kneba M, Bergholz M, Bolz I, et al.
Heterogeneity of immunoglobulin gene rearrangements in B-cell lymphomas.
Int J Cancer.
1990;45:609-613[Medline]
[Order article via Infotrieve].
28.
Rassenti LZ, Kipps TJ.
Lack of allelic exclusion in B cell chronic lymphocytic leukemia.
J Exp Med.
1997;185:1435-1445[Abstract/Free Full Text].
29.
Monni O, Joensuu H, Franssila K, Knuutila S.
DNA copy number changes in diffuse large B-cell lymphomacomparative genomic hybridization study.
Blood.
1996;87:5269-5278[Abstract/Free Full Text].
30.
Sklar J, Cleary ML, Thielemans K, Gralow J, Warnke R, Levy R.
Biclonal B-cell lymphoma.
N Engl J Med.
1984;311:20-27[Abstract].
31.
Logtenberg T, Schutte ME, Inghirami G, et al.
Immunoglobulin VH gene expression in human B cell lines and tumors: biased VH gene expression in chronic lymphocytic leukemia.
Int Immunol.
1989;1:362-366[Abstract/Free Full Text].
32.
Guigou V, Cuisinier AM, Tonnelle C, Moinier D, Fougereau M, Fumoux F.
Human immunoglobulin VH and VK repertoire revealed by in situ hybridization.
Mol Immunol.
1990;27:935-940[Medline]
[Order article via Infotrieve].
33.
Brezinschek HP, Brezinschek RI, Lipsky PE.
Analysis of the heavy chain repertoire of human peripheral B cells using single-cell polymerase chain reaction.
J Immunol.
1995;155:190-202[Abstract].
34.
Bessudo A, Rassenti L, Havlir D, Richman D, Feigal E, Kipps TJ.
Aberrant and unstable expression of immunoglobulin genes in persons infected with human immunodeficiency virus.
Blood.
1998;92:1317-1323[Abstract/Free Full Text].
35.
Stewart AK, Huang C, Stollar BD, Schwartz RS.
High-frequency representation of a single VH gene in the expressed human B cell repertoire.
J Exp Med.
1993;177:1227[Free Full Text].
36.
Stevenson FK, Smith GJ, North J, Hamblin TJ, Glennie MJ.
Identification of normal B-cell counterparts of neoplastic cells which secrete cold agglutinins of anti-I and anti-i specificity.
Br J Haematol.
1989;72:9-15[Medline]
[Order article via Infotrieve].
37.
Kraj P, Friedman DF, Stevenson F, Silberstein LE.
Evidence for the overexpression of the VH4-34 (VH4.21) Ig gene segment in the normal adult human peripheral blood B cell repertoire.
J Immunol.
1995;154:6406-6420[Abstract].
38.
Nakamine H, Bagin RG, Vose JM, et al.
Prognostic significance of clinical and pathologic features in diffuse large B-cell lymphoma.
Cancer.
1993;71:3130-3137[Medline]
[Order article via Infotrieve].
39.
Frizzera G.
Non-Hodgkin lymphomas: pathologic features and clinical correlations. In:
Hoffman R, ed.
Hematology: Basic Principles and Practice. New York: Churchill Livingstone; 1995:1247-1278.
40.
Kon S, Levy S, Levy R.
Retention of an idiotypic determinant in a human B-cell lymphoma undergoing immunoglobulin variable-region mutation.
Proc Natl Acad Sci U S A.
1987;84:5053-5057[Abstract/Free Full Text].
41.
Cleary ML, Meeker TC, Levy S, et al.
Clustering of extensive somatic mutations in the variable region of an immunoglobulin heavy chain gene from a human B cell lymphoma.
Cell.
1986;44:97-106[Medline]
[Order article via Infotrieve].
42.
Bahler DW, Campbell MJ, Hart S, Miller RA, Levy S, Levy R.
Ig VH gene expression among human follicular lymphomas.
Blood.
1991;78:1561-1568[Abstract/Free Full Text].
43.
Thompsett AR, Ellison DW, Stevenson FK, Zhu D.
V(H) gene sequences from primary central nervous system lymphomas indicate derivation from highly mutated germinal center B cells with ongoing mutational activity.
Blood.
1999;94:1738-1746[Abstract/Free Full Text].
44.
Driessen A, Tierens A, Ectors N, et al.
Primary diffuse large B cell lymphoma of the stomach: analysis of somatic mutations in the rearranged immunoglobulin heavy chain variable genes indicates antigen selection.
Leukemia.
1999;13:1085-1092[Medline]
[Order article via Infotrieve].
 CiteULike  Connotea  Del.icio.us |
Top
Abstract
Introduction
