SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Lossos, I. S. Articles by Levy, R. Search for Related Content PubMed PubMed Citation Articles by Lossos, I. S. Articles by Levy, R. Related Collections Neoplasia Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 95 No. 5 (March 1), 2000: pp. 1797-1803 NEOPLASIA Molecular analysis of immunoglobulin genes in diffuse large B-cell lymphomas I. S. Lossos, C. Y. Okada, R. Tibshirani, R. Warnke, J. M. Vose, T. C. Greiner, and R. Levy Division of Oncology, Department of Medicine, Department of Health Research and Policy, and Department of Pathology, Stanford University Medical Center, Stanford, CA; Department of Internal Medicine and Department of Pathology, University of Nebraska Medical Center, Omaha, NE.     Abstract Top Abstract Introduction Materials and methods Results Discussion References Diffuse large B-cell lymphoma (DLBCL) is a common type of non-Hodgkin's lymphoma (NHL) that is highly heterogeneous from both clinical and histopathologic viewpoints. The immunoglobulin (Ig) heavy (H) chain variable region genes were examined in 71 patients with untreated primary DLBCL. Fifty-eight potentially functional VH genes were detected in 53 DLBCL cases; VH genes were nonfunctional in 9 cases and were not detected in an additional 9 cases. The use of VH gene families by DLBCL tumors was unbiased without overrepresentation of any particular VH gene or gene family. Analysis of Ig mutations in comparison to the most closely related germline gene disclosed mutated VH genes in all but 1 DLBCL case. More than 2% difference from the most similar germline sequence was detected in 52 potentially functional and the 8 nonfunctional VH gene sequences, whereas less than 2% difference from the germline sequence was observed in 3 VH gene isolates. Only 3 VH gene isolates were unmutated. No correlation was found between VH gene use, mutation level, and International Prognostic Index (IPI) or survival. Six of 8 tested tumors showed evidence of ongoing somatic mutations. Evidence for positive or negative antigen selection pressure was observed in 65% of mutated DLBCL cases. Our findings indicate that the etiology and the driving forces for clonal expansion are heterogeneous, which may explain the well-known clinical and pathologic heterogeneity of DLBCL. (Blood. 2000;95:1797-1803) © 2000 by The American Society of Hematology.     Introduction Top Abstract Introduction Materials and methods Results Discussion References The immunoglobulin (Ig) heavy (H) chain variable region is formed during normal B-cell ontogeny by an ordered process of Ig gene rearrangement leading to the assembly of distinct variable (V), diversity (D), and joining (J) gene segments. This phenomenon is known as VDJ recombination.1 A single VH gene is chosen from the available VH repertoire consisting of approximately 51 potentially functional genes that are grouped into 7 structurally related families on the basis of at least 80% nucleotide sequence homology.2,3 The large diversity among the Ig H chain variable regions is generated by combinatorial permutation of different V, D, and J gene segments and by addition or deletion of short coding sequences at the VD and DJ joints. An additional process of sequence diversification by somatic hypermutation following antigen encounter occurs in B cells proliferating within the microenvironment of the germinal center (GC).4,5 Although the process of somatic hypermutation has an element of randomness, antigen selection tends to result in a conservation of Ig framework regions (FR) and in a clustering of replacement mutations within the complementary determining regions (CDR).6-8 Therefore, somatically mutated variable region genes are a hallmark of GC B cells and their descendants. The majority of B-cell lymphomas contain Ig gene rearrangements and usually express a unique clonal surface Ig that provides a specific tumor marker. Analysis of lymphoma variable region genes coding for the variable region of tumor Ig may have important implications for tumor diagnosis, monitoring, and treatment. Examination of variable region mutations in B cell tumors may help to trace the developmental stage at which neoplastic transformation has occurred and assign these cells to their normal counterparts. Moreover, VH gene analysis may reveal pathogenic aspects of B-cell lymphomas, including possible bias in V-gene usage. For instance, preferential V-gene usage might implicate a role for a superantigen, which by binding to surface Ig receptor via unmutated FR may drive B-cell proliferation.9,10 Several groups, including our own, have analyzed Ig H chain variable region in small cohorts of patients with diffuse large B-cell lymphoma (DLBCL).11-16 The results of these studies are inconsistent. Biased VH gene use with overrepresentation of VH 4 gene family and particularly of VH 4-34 gene was observed in 3 of the 6 reported studies,11,14,15 whereas the other 3 studies12,13,16 reported an unbiased VH gene use in DLBCL. Extensive somatic mutations in the VH genes were observed in tumor samples from DLBCL patients in all these studies. However, the issue of ongoing somatic mutation in DLBCL is controversial, some studies demonstrating no intraclonal variation 11,17-20 and others showing ongoing hypermutation, similar to follicular lymphoma (FL).21-23 To further elucidate these issues VH gene sequences from tumor samples were examined in a large cohort of untreated patients with DLBCL.     Materials and methods Top Abstract Introduction Materials and methods Results Discussion References Patient material Tumor tissues were chosen randomly from the available fresh frozen biopsy specimens of lymph nodes or extralymphatic lymphoid tissue from untreated patients with a pathologic diagnosis of primary DLBCL according to the REAL classification.24 Table 1 summarizes the biopsy sites from which tissue samples were obtained. The tissue samples were embedded in Tissue-Tek Optimal Cutting Temperature (OCT) compound 4583 (Miles Inc., Elkhart, IN) and preserved at 80°. Twenty-seven samples were obtained from the University of Nebraska Medical Center and 44 samples from the Stanford University Medical Center. Clinical outcome data were available for all samples.                                View this table: [in this window] [in a new window]   Table 1. Diffuse large B-cell lymphoma biopsy tissue origin Tissue section analysis The randomly chosen frozen tissue specimens were reviewed to confirm the DLBCL diagnosis according to the REAL classification24 before RNA extraction. Samples derived from Stanford University Medical Center were stained with anti-Ig heavy and light chain antibodies (Becton Dickinson, San Jose, CA) and with the 9G4 antibody (generous gift from Dr. F. Stevenson, Southhampton, UK), a rat IgG 2a antibody directed to FR1 of VH 4-34.14 Frozen sections, 5 µ thick, were cut onto slides coated with poly-L-lysin (Sigma, St. Louis, MO). Frozen sections for staining with anti-Ig heavy and light chain antibodies were fixed in cold (4°C) acetone for 10 minutes, air dried, and incubated with mouse antihuman Ig µ, , or  antibodies at 25°C for 30 minutes. Sections were then rinsed in 25°C phosphate-buffered saline (PBS) and incubated with biotin-conjugated goat antimouse antibody (Jackson Immuno Research, West Grove, PA) for 40 minutes at 25°C. Frozen sections for staining with the 9G4 antibody were fixed in cold formalin for 10 minutes, washed in 25°C PBS, and stained with the 9G4 antibody at 25°C for 30 minutes. The 9G4 antibody was detected with biotin-conjugated goat antirat antibody (Jackson Immuno Research) for 40 minutes at 25°C. Secondary antibody-stained sections were rinsed in 25°C PBS and incubated with streptavidin-conjugated horseradish peroxidase (Jackson Immuno Research) for 40 minutes at 25°C. Sections were then rinsed twice in PBS and reacted with 30 mg/mLl of diaminobenzidene (Sigma) in 0.01% H2O2 in PBS for 5 minutes at 25°C. Sections were rinsed in PBS and in water and incubated with CuSO4 (0.5% in 1 N NaCl) for 5 minutes at 25°C. Sections were then rinsed once more in water, counterstained in 2% methylene blue for 20 minutes, and finally rinsed, dehydrated, and examined. Morphologically identified lymphoma cells were considered positive if a clear membrane immunoperoxidase reaction product was seen. RNA isolation and reverse transcription-polymerase chain reaction (RT-PCR) Total cellular RNA or messenger RNA was isolated from the cryopreserved DLBCL specimens using the RNeasy kit (Qiagen, Valencia, CA) or FastTrack 2.0 kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The RNA was reverse transcribed with 15 u AMV Reverse Transcriptase (Promega, Madison, WI) per 1µg of RNA at 45°C for 45 minutes in a 30-µL volume in a buffer containing 5 mM MgCl2, 10 mM Tris-HCl pH 8.8, 50 mM KCl, 0.1% Triton X-100, 1 mM of each dNTP, 1 U/µL Recombinant Rnasin Ribonuclease Inhibitor, 0.5 µg Oligo(dT)15 per 1 µg RNA and 1.5 µg RNA. One thirtieth of a complementary DNA (cDNA) sample was amplified by Taq DNA polymerase with a specific 5' primer corresponding to 1 of the 6 human variable H chain family leaders (VH1 through VH6) and a 3' antisense JH consensus primer.25 In our hands the VH1 leader primer also amplifies sequences from the closely related VH7 family. PCR was performed in a final volume of 50 µL containing 0.5 µM of each primer, 20 mmol/L Tris-HCl (pH 8.4), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 200 µmol/L of each dNTP and 2.5 U Taq DNA polymerase (Gibco BRL, Grand Island, NY). The PCR conditions were: 96°C for 5 minutes, 55°C for 1 minute, 72°C for 3 minutes, 1 cycle; 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, 30 to 35 cycles; and 72°C for 5 minutes, 1 cycle. Beta-2-microglobulin (2 M) was amplified using specific primers (5' 2M: ATCCAGCGTACTCCAAAGATT and 3'2M: CATGTCTCGATCCCACTTAAC) and served as a control of RNA-cDNA integrity. For each PCR, a control with no added template was used to check for contamination. To control for potential PCR error, all patient samples were evaluated by 2 independent PCR reactions and sequencing, as described later. PCR products were analyzed by 2% agarose gel electrophoresis and stained with ethidium bromide. Bands of appropriate size were excised from the gels and purified by adsorption to a silica matrix (QIAquick columns, Qiagen). Sequencing and cloning of PCR products Direct DNA sequencing of PCR amplicons was performed on an 373 automatic DNA sequencer (Applied Biosystems, Foster City, CA) using ABI Prism Big Dye Terminator Kit (Perkin Elmer, Foster City, CA) as recommended by the manufacturer. The same primers used for the PCR were used for sequencing. The sequence was defined as clonal if identical CDR3 sequences were obtained from 2 independent PCR reactions. If direct DNA sequencing attempt of the PCR amplicon failed to recover an unambiguous sequence, the PCR amplicons were cloned into a TA-PCR cloning vector (Invitrogen). After the transformation of competent Escherichia coli (1 Shot INV F', Invitrogen) and plating on selective agar (50 µg/mL of kanamycin, 40 µL of the 40 µg/mL of the X-gal), 10 to 12 white colonies were picked per sample and used in a second round of PCR. Identity of the products was established by restriction digest and 3 to 6 amplicons were selected for sequencing. To determine the RT-Taq polymerase error rate of our experimental design, 26 clones of 2 mol/L were sequenced. These clones were generated according to the same RT-PCR and cloning procedures as used for the VH genes. Our RT-Taq error rate thus established is 0.09%, which amounts to 0.36 mutations per VH clone. Analysis of intraclonal heterogeneity To evaluate for the presence of ongoing mutations in primary DLBCL, 8 specimens were examined by repeated cloning and sequencing of at least 15 molecular clones from each specimen. For evaluation of intraclonal heterogeneity, the following definitions were used: unconfirmed mutationa substitution mutation observed in only 1 of the VH gene molecular clones from the same tumor specimen; confirmed mutationa mutation observed more than once in the VH gene molecular clones from the same tumor specimen. Only the confirmed mutations were considered as evidence of intraclonal heterogeneity; the unconfirmed mutations were disregarded because they can be caused by Taq polymerase error. Mutation analysis Sequence analysis was done using programs MacVector and Assembly Lign (Oxford Molecular Group, Campbell, CA). Sequences were aligned with germline sequences derived from Vbase database and DNA plot on the Internet. The VH gene sequences were compared with the germline genes with the highest homology and, accordingly, the number of somatic mutations was determined. Mutations at the last nucleotide position of the sequenced fragment were excluded from the mutational analysis because they might result from nucleotide deletion at the joining sites. Percent of sequence identity was calculated from the aligned sequences from the beginning of FR1 to the end of FR3. The probability that an excess or scarcity of replacement (R) mutations in VH CDRs or FRs occurred by chance was calculated by a multinominal distribution model. The total number of mutations in each VH gene is denoted by n = r1 +s1 +r2 + s2, in which r1 and r2 are replacement mutations and s1 and s2 are silent mutations in FR and CDR regions, respectively. The theoretical probabilities for r1, s1, r2, and s2 mutations are denoted by p1, q1, p2, and q2, respectively. These probabilities are calculated by the following equations: p1 = RfFR × LrFR; q1 = (1-RfFR) × LrFR; p2 = RfCDR × (1-LrFR) and q2 = (1-RfCDR) × (1-LrFR) in which LrFR is a relative size of the FR and RfFR and RfCDR are the inherent susceptibility to R mutations of the FRs and CDRs, respectively. RfFR and RfCDR were calculated for each of the identified germline genes and are based on the chance of the occurrence in each codon of an amino acid replacement given any single nucleotide change not resulting in a termination codon. The probability of observing r1 or fewer replacement mutations in FR regions is then given by the multinominal tail probability: The sum is taken over values of k ranging from 0 to r1 and all combinations of S1, R2, S2 such that k+ S1 + R2 + S2 = n. To compute the P value of an observed number r1, it is customary to split the probability at r1: P value = P (R1 < r1) + 0.5 × P (R1 = r1). It should be noted that P (R1 = r1) = P(R1  r1)-P(R1  r1-1), and P(R1 < r1) = P(R1 < r1)-P(R1 = r1). The probability of observing r2 or more replacement mutations in CDR regions is similarly computed by the following equation: And the P value is computed by P value = P(R2 > r2) + 0.5 × P(R2 = r2). For both FR and CDR, 1-sided P values were used. The Chang and Casali equation26 was not applied because it considers a binominal distribution of mutations while the distribution is multinominal and it does not consider all the combinatorial possibilities of mutations and results in less stringent analysis.     Results Top Abstract Introduction Materials and methods Results Discussion References VH gene use in DLBCL Reverse transcriptase-PCR using VH leader and JH consensus primers was performed in 71 patients with primary untreated DLBCL. In 3 (4.2%) patients an Ig VH gene PCR product could not be detected despite successful amplification of 2M that served as a control for RNA-cDNA integrity. In 6 (8.4%) patients, multiple nonclonal bands, as determined by subcloning and sequencing, were detected. Most probably these bands derive from polyclonal reactive B cells infiltrating these tumors. The failure to detect monoclonal VH gene sequences in these 9 cases may result from somatic mutations in the region to which PCR primers used in this study are designed to hybridize, thus leading to lower amplification efficiency and possible false-negative results. Alternatively, absence of Ig rearrangement, as was previously reported in rare DLBCL cases,16,27 may explain the absence of monoclonal VH gene sequences in some of these cases. Seventy clonal VH gene sequences were detected in 62 patients (2 clonal sequences in 6 patients and 3 clonal sequences in 1 patient). In 43 (69%) cases the PCR product could be sequenced directly, whereas in 19 (31%) cases PCR amplicons had to be subcloned to identify the VH gene. In 4 of these cases, the clonal product amplified by the VH3 leader primer had 200 bp or larger substitution inserts located between the leader and the JH regions, substituting part of the natural VH gene sequence and resulting in open reading frame sequences in 2 samples. The presence of these inserts was verified by repeated PCR and cloning. A search in the GenBank data library could not identify similar sequences. These VH genes were excluded from analysis. Among the remaining 66 clonal VH gene sequences, 58 were potentially functional and 8 were rendered nonfunctional by out-of-frame rearrangement (5 sequences) or by somatic mutations leading to the introduction of stop codons in the V region (3 sequences). The nonfunctional sequences were derived from the following VH genes: VH1-08, VH1-46, VH2-05, VH3-23, VH3-07, VH3-09, VH4-61, and VH4-30-4. Three of these nonfunctional sequences derived from tumors that had an additional potentially functional VH gene sequence, whereas in 5 cases the nonfunctional sequence was the solitary VH gene isolate found in the tumor cells. Fifty-eight potentially functional VH gene sequences were detected in 53 DLBCL cases (Table 2). In 5 cases, 2 potentially functional VH genes were found (in one of these, an additional nonfunctional clonal VH gene was also detected). The multiplicity of potentially functional VH genes in the same tumor may be attributed to: (1) lack of allelic exclusion, as was previously reported in the B-cell chronic lymphocytic leukemia (CLL)28; (2) numerical chromosomal aberrations that are reported in 91% of DLBCL29; gain of an additional chromosome 14 may result in the presence of 3 rearranged Ig genes in the tumor cells; or (3) biclonal B cell tumor with 2 different clonal VH genes.30                                View this table: [in this window] [in a new window]   Table 2. Molecular analysis of potentially functional VH genes in diffuse large B-cell lymphoma (DLBCL) The 58 potentially functional VH genes used by these 53 DLBCL cases were derived from 6 of the 7 human VH gene families in the following distribution: VH1,12.1%; VH2,10.3%; VH3, 44.8%; VH4, 25.9%; VH5, 5.2%; and VH7, 1.7% (Table 3). This VH family distribution is comparable with the relative complexity of functional germline VH genes within each family and to the use of VH families in peripheral and lymph node lymphocytes in healthy donors, as was previously established by various techniques (see Table 3).2,31-34 Thus, VH gene family use by untreated primary DLBCL is random and unbiased.                                View this table: [in this window] [in a new window]   Table 3. VH gene family use in diffuse large B-cell lymphoma The most frequently encountered genes were VH3-23 (n = 6), VH3-33 (n = 5), VH4-34 (n = 5), VH4-39 (n = 5), VH3-48 (n = 4), and VH2-05 (n = 4), which represent 10.3%, 8.6%, 8.6%, 8.6%, 6.9%, and 6.9%, respectively, of all the potentially functional VH genes identified in this study. Some of these genes, including VH3-23, VH4-34, and VH4-39, are also found at higher than expected frequency in normal individuals.33,35-37 No correlation between VH gene family use and the IPI or patient's survival was detected (data not shown). Immunohistochemistry Forty-four tumor samples derived from Stanford University Medical Center were stained with anti-Ig and 9G4 antibodies. The staining results were interpreted blindly, without the knowledge of sequencing results. Staining with 9G4 antibody, directed to the VH4-34 gene, was positive in 5 cases, identifying all the VH4-34 DLBCL cases determined by molecular analysis without false-positive or false-negative results. Staining with anti-Ig antibodies was positive in 19 (42.3%) cases and negative in 25 (56.8%). Both lower (17%)38 and higher (> 60%)39 prevalence of anti-Ig-stained negative DLBCL cohorts are reported in the literature. All the tumors that reacted with anti-Ig antibodies had potentially functional Ig VH gene PCR product. Among the 25 tumors that lacked staining with anti-Ig antibodies, 8 had solitary nonfunctional VH gene sequences, including the 4 cases with the insertions described above and 4 cases in which monoclonal VH genes were not found. However, in 13 cases that did not stain with anti-Ig antibodies, a potentially functional monoclonal VH gene sequence was detected. The discrepancy between the PCR sequencing and the staining results may stem from a posttranscriptional effect on Ig expression by the requirement of proper Ig protein folding, that could be impaired in these cases by replacement somatic mutations. Moreover, the light chain sequences, which are required for Ig stabilization and expression, were not analyzed. The presence of nonfunctional rearranged light chain may explain the observed disconcordance between the staining and the PCR sequencing results. Noticeably, all the cases that did not stain with anti-Ig antibodies while harboring a potentially functional monoclonal VH gene sequence also did not stain with anti- or anti- chain antibodies. A similar VH gene family use was found in the cases that stained or did not stain with anti-Ig antibodies (data not shown). Intraclonal heterogeneity Intraclonal variation was assessed by extensive molecular cloning in 8 potentially functional VH gene isolates from 8 tumor specimens obtained from various biopsy sites (Table 4). These specimens were selected randomly and included 7 samples whose clonal Ig sequence was established by direct sequencing of the PCR product and 1 sample in which the VH gene sequence was established after molecular cloning from the PCR product. In 2 of the tested samples, the extensively mutated clonal VH gene isolates did not show intraclonal heterogeneity. In 6 samples intraclonal heterogeneity was detected. In these cases molecular clones harboring confirmed mutations not observed in the most abundant clonal VH gene sequence were found. The extent of the intraclonal heterogeneity varied between DLBCL samples, 3 specimens (DLBCL no. 4, 34, and 41) demonstrated a limited number of additional mutations, whereas others (DLBCL no. 15, 20, and 43) exhibited extensive variations between tumor VH gene subclones, similar in prevalence to that typically observed in FL.40-42                                View this table: [in this window] [in a new window]   Table 4. Analysis of ongoing somatic mutations in diffuse large B-cell lymphoma (DLBCL) Analysis of mutation pattern Only 3 VH gene sequences had less than 2% difference from the most similar germline gene and an additional 3 VH gene isolates had a germline unmutated sequence. More than 2% difference from the most similar germline sequence was detected in the remaining 52 potentially functional and the 8 nonfunctional VH gene sequences. No significant difference in the mutation level was observed between the nonfunctional and potentially functional VH gene isolates, thus suggesting that the mutational process was active on both allele products. Forty (68.9%) of the potentially functional VH gene isolates differed by more than 5% from the most similar germline counterpart and 24 (41.4%) differed by more than 10%. In the 5 cases with 2 potentially functional VH gene isolates, 3 had a similar level of mutation in both identified VH genes, whereas in 2, only 1 isolate was mutated while the second was unmutated. No correlation between the level of mutation and VH gene family use was observed. Analysis of the distribution of the R versus S mutations demonstrated that 33 of the 55 potentially functional mutated VH genes contained a significantly lower number of R mutations in the FRs (see Table 2) than would be expected if mutations had occurred by chance alone without selective forces. Thus, in these genes a selective force to conserve FR sequences and maintain binding to an antigen can be inferred. In most of the mutated sequences the CDRs R/S ratio values were higher than those within FRs of the corresponding VH genes. However, in only 13 potentially functional sequences was the presence of the positive selective forces observed, as demonstrated by an excess of R mutations in the CDRs, exceeding that expected to occur by chance (see Table 2). In 12 DLBCL cases concomitant scarcity of R mutations in FRs and excess of R mutations in CDRs were observed. We performed a search for similar R mutations within the CDRs of isolates belonging to the same VH genes. Recurrent amino acid changes were not observed in the tumor samples tested in this study.     Discussion Top Abstract Introduction Materials and methods Results Discussion References The present study was undertaken to clarify the issues of VH gene use and somatic mutation in DLBCL. For this purpose, molecular analysis of the Ig VH region was performed in 71 untreated primary DLBCL patientsthe largest cohort studied to date. This study demonstrates an unbiased VH gene use in DLBCL. The VH3, the largest family, was used most often, followed by VH4, VH1, VH2, VH5, and VH7, an ordering that is similar to the number of functional genes within each family.2,3 The VH gene use in DLBCL is also similar to the previously reported use of VH families in peripheral and lymph node lymphocytes in normal individuals (see Table 3).2,31-34 VH4-34 gene was used in 5 (8.6%) potentially functional VH sequences similar to its use in normal individuals.36,37 Previous studies evaluating VH gene use in DLBCL reported disconcordant results. Daley et al12 evaluated VH gene use in 10 DLBCL cell lines and reported random VH family use that mirrors VH family complexity and VH family use in normal B cells. Rosenquist et al16 studied 35 DLBCL samples by PCR and found an unbiased VH family use. However, sequencing or cloning analysis of VH genes to verify clonality and to exclude amplification of Ig genes derived from infiltrating reactive B cells was not performed in that study. Kuppers et al13 examined 19 DLBCL tumors and reported unbiased VH family use. In contrast, biased VH family use with overrepresentation of VH4-34 gene was reported in other DLBCL studies. Stevenson et al14 evaluated the use of VH4-34 gene in NHL by immunostaining with 9G4 antibody, which recognizes the A-V-Y amino acid sequence within FR1 of VH4-34. Five of the 28 intermediate and high-grade NHL used VH4-34; however, it was not clear which of these cases were DLBCL. Funkhouser and Warnke15 found VH4-34 gene use in 6 of 20 DLBCL cases by using the same antibody. In none of these studies was the clinical status of evaluated cases reported, making it unclear if these cases were evaluated at presentation, before therapy, or at the time of lymphoma relapse. In a previous study performed in our laboratory,11 biased VH family use in DLBCL was found, with 14 of 17 cases using VH4 family genes, 11 of which were VH4-34. This study group mostly included samples acquired from patients at the time of lymphoma relapse. None of these cases was included in the present study. In addition, we have reexamined these cases by our current methods and reconfirmed the previously published results. The reason for the discrepancy in the reported use of VH families in DLBCL is unclear, but it may be caused by the inclusion of untreated and relapsed DLBCL cases in different studies and the relatively small size of the previous study cohorts. Analysis of a large group of untreated DLBCL specimens, as was done in the present study, should put to rest the issue of VH gene use in this tumor. Intraclonal heterogeneity is a consistent finding in FL, which represents a germinal center tumor prototype. However, contradicting results regarding the presence of intraclonal heterogeneity in DLBCL were reported in the literature. Intraclonal heterogeneity was shown in several untreated DLBCL cases,21,22 primary testicular lymphoma,23 and in some but not all the specimens of primary DLBCL of the brain43 and stomach.44 Absence of intraclonal variation in DLBCL was previously reported in relapsed DLBCL cases11 and in DLBCL of the skin19 and in patients with acquired immunodeficiency syndrome.18 The extent of the molecular cloning may account for the observed discrepancy. Evaluation of insufficient number of molecular clones may fail to discriminate between real mutations and Taq errors and fail to detect a low level of intraclonal heterogeneity. Indeed, our initial examination of a small number of clones in 19 specimens in this study failed to reveal intraclonal heterogeneity, whereas evaluation of a larger number of molecular clones disclosed its presence. The present study extensively cloned 8 untreated DLBCL specimens from different tissues. The results suggest the presence of 2 DLBCL subgroups based on the presence of intraclonal heterogeneity: a large DLBCL subgroup showing evidence of ongoing mutations, which is a hallmark of GC microenvironment, and a smaller subgroup without intraclonal heterogeneity. Whether these subgroups represent DLBCL cases originating from GC and post-GC cells, respectively, or whether the transforming events may render the cell independent from the influence of GC microenvironment is presently unclear. Further studies elucidating these issues and correlating the presence of intraclonal heterogeneity with tumor immunophenotype are necessary. Analysis of mutations in VH genes can provide insights regarding the role of antigen prior to or during DLBCL clonal outgrowth.6,7 In 24% of the potentially functional mutated VH genes there was evidence for positive selection as demonstrated by analysis of R mutations in CDRs. Scarcity of R mutations in FRs was observed in 60% of mutated sequences, thus suggesting selection for functional Ig in these tumors. It is possible that in some DLBCL CDRs of germline VH genes possess sufficient antigen-binding affinity and the antigen provides negative selective pressure by selecting against FR R mutations to maintain Ig function. However, presently the identity of possible antigens involved in DLBCL clonal selection is unknown. Alternatively, it is possible that superantigens that bind Ig receptor via FR regions may be involved in stimulation of lymphoma cells, thus providing negative selection pressure on FR region without positive selection pressure on CDR regions. No evidence of antigen selective pressure was evident in 35% of mutated DLBCL cases, thus suggesting antigen independent tumor evolution. Furthermore, in contrast to normal B cells and most cases of FL, which usually express surface antigen receptors, DLBCL cells may propagate without surface antigen receptor expression, as demonstrated by negative Ig immunostaining and finding of solitary nonfunctional VH genes in a significant proportion of DLBCL tumors. In conclusion, the present study results revealed a random use of VH genes by DLBCL cells. In a substantial number of DLBCL cases a clonal VH gene sequence was not detected. Functional VH genes were commonly mutated and only a small number of unmutated germline VH gene isolates were found. Ongoing somatic mutations were observed in the majority of cases. Positive and or negative antigen selection pressure was observed in 65% of mutated DLBCL cases. These findings indicate a heterogeneous pathobiology of DLBCL.     Footnotes Supported by grants CA33399 and CA34233 from the USPHS-NIH. R.L. is an American Cancer Society Clinical Research Professor. Reprints: Ronald Levy, Stanford University School of Medicine, Division of Oncology, M207, Stanford, CA 94305-5306. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.     References Top Abstract Introduction Materials and methods Results Discussion References 1. Rajewsky K. Clonal selection and learning in the antibody system. Nature. 1996;381:751-758[Medline] [Order article via Infotrieve]. 2. Cook GP, Tomlinson IM. The human immunoglobulin VH repertoire. Immunol Today. 1995;16:237-242[Medline] [Order article via Infotrieve]. 3. Cook GP, Tomlinson IM, Walter G, et al. A map of the human immunoglobulin VH locus completed by analysis of the telomeric region of chromosome 14q. Nat Genet. 1994;7:162-168[Medline] [Order article via Infotrieve]. 4. Berek C. The development of B cells and the B-cell repertoire in the microenvironment of the germinal center. Immunol Rev. 1992;126:5-19[Medline] [Order article via Infotrieve]. 5. Klein U, Goossens T, Fischer M, et al. Somatic hypermutation in normal and transformed human B cells. Immunol Rev. 1998;162:261-280[Medline] [Order article via Infotrieve]. 6. Shlomchik M, Mascelli M, Shan H, et al. Anti-DNA antibodies from autoimmune mice arise by clonal expansion and somatic mutation. J Exp Med. 1990;171:265-292[Abstract/Free Full Text]. 7. Bahler DW, Levy R. Clonal evolution of a follicular lymphoma: evidence for antigen selection. Proc Natl Acad Sci U S A. 1992;89:6770-6774[Abstract/Free Full Text]. 8. Bahler DW, Zelenetz AD, Chen TT, Levy R. Antigen selection in human lymphomagenesis. Cancer Res. 1992;52:5547s-5551s[Abstract/Free Full Text]. 9. Li Y, Spellerberg MB, Stevenson FK, Capra JD, Potter KN. The I binding specificity of human VH 4-34 (VH 4-21) encoded antibodies is determined by both VH framework region 1 and complementarity determining region 3. J Mol Biol. 1996;256:577-589[Medline] [Order article via Infotrieve]. 10. Silverman GJ. Human antibody responses to bacterial antigens: studies of a model conventional antigen and a proposed model B cell superantigen. Int Rev Immunol. 1992;9:57-78[Medline] [Order article via Infotrieve]. 11. Hsu FJ, Levy R. Preferential use of the VH4 Ig gene family by diffuse large-cell lymphoma. Blood. 1995;86:3072-3082[Abstract/Free Full Text]. 12. Daley MD, Berinstein NL, Siminovitch KA. Immunoglobulin heavy chain variable gene utilization in human large cell and Burkitt's lymphoma cell lines. Clin Invest Med. 1994;17:522-530[Medline] [Order article via Infotrieve]. 13. Kuppers R, Rajewsky K, Hansmann ML. Diffuse large cell lymphomas are derived from mature B cells carrying V region genes with a high load of somatic mutation and evidence of selection for antibody expression. Eur J Immunol. 1997;27:1398-1405[Medline] [Order article via Infotrieve]. 14. Stevenson FK, Spellerberg MB, Treasure J, et al. Differential usage of an Ig heavy chain variable region gene by human B-cell tumors. Blood. 1993;82:224-230[Abstract/Free Full Text]. 15. Funkhouser WK, Warnke RA. Preferential IgH V4-34 gene segment usage in particular subtypes of B-cell lymphoma detected by antibody 9G4. Hum Pathol. 1998;29:1317-1321[Medline] [Order article via Infotrieve]. 16. Rosenquist R, Lindstrom A, Holmberg D, Lindh J, Roos G. V(H) gene family utilization in different B-cell lymphoma subgroups. Eur J Haematol. 1999;62:123-128[Medline] [Order article via Infotrieve]. 17. Taniguchi M, Oka K, Hiasa A, et al. De novo CD5+ diffuse large B-cell lymphomas express VH genes with somatic mutation. Blood. 1998;91:1145-1151[Abstract/Free Full Text]. 18. Delecluse HJ, Hummel M, Marafioti T, Anagnostopoulos I, Stein H. Common and HIV-related diffuse large B-cell lymphomas differ in their immunoglobulin gene mutation pattern. J Pathol. 1999;188:133-138[Medline] [Order article via Infotrieve]. 19. Gellrich S, Golembowski S, Audring H, Jahn S, Sterry W. Molecular analysis of the immunoglobulin VH gene rearrangement in a primary cutaneous immunoblastic B-cell lymphoma by micromanipulation and single-cell PCR. J Invest Dermatol. 1997;109:541-545[Medline] [Order article via Infotrieve]. 20. Stiernholm N, Kuzniar B, Berinstein NL. Absence of immunoglobulin variable region hypermutation in a large cell lymphoma after in vivo and in vitro propagation. Blood. 1992;80:738-743[Abstract/Free Full Text]. 21. Ottensmeier CH, Thompsett AR, Zhu D, Wilkins BS, Sweetenham JW, Stevenson FK. Analysis of VH genes in follicular and diffuse lymphoma shows ongoing somatic mutation and multiple isotype transcripts in early disease with changes during disease progression. Blood. 1998;91:4292-4299[Abstract/Free Full Text]. 22. van Belzen N, Hupkes PE, Doekharan D, Hoogeveen-Westerveld M, Dorssers LC, van't Veer MB. Detection of minimal disease using rearranged immunoglobulin heavy chain genes from intermediate- and high-grade malignant B cell non-Hodgkin's lymphoma. Leukemia. 1997;11:1742-1752[Medline] [Order article via Infotrieve]. 23. Hyland J, Lasota J, Jasinski M, Petersen RO, Nordling S, Miettinen M. Molecular pathological analysis of testicular diffuse large cell lymphomas. Hum Pathol. 1998;29:1231-1239[Medline] [Order article via Infotrieve]. 24. Harris NL, Jaffe ES, Stein H, et al. A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group [see comments]. Blood. 1994;84:1361-1392[Free Full Text]. 25. Campbell MJ, Zelenetz AD, Levy S, Levy R. Use of family specific leader region primers for PCR amplification of the human heavy chain variable region gene repertoire. Mol Immunol. 1992;29:193-203[Medline] [Order article via Infotrieve]. 26. Chang B, Casali P. The CDR1 sequences of a major proportion of human germline Ig VH genes are inherently susceptible to amino acid replacement. Immunol Today. 1994;15:367-373[Medline] [Order article via Infotrieve]. 27. Kneba M, Bergholz M, Bolz I, et al. Heterogeneity of immunoglobulin gene rearrangements in B-cell lymphomas. Int J Cancer. 1990;45:609-613[Medline] [Order article via Infotrieve]. 28. Rassenti LZ, Kipps TJ. Lack of allelic exclusion in B cell chronic lymphocytic leukemia. J Exp Med. 1997;185:1435-1445[Abstract/Free Full Text]. 29. Monni O, Joensuu H, Franssila K, Knuutila S. DNA copy number changes in diffuse large B-cell lymphomacomparative genomic hybridization study. Blood. 1996;87:5269-5278[Abstract/Free Full Text]. 30. Sklar J, Cleary ML, Thielemans K, Gralow J, Warnke R, Levy R. Biclonal B-cell lymphoma. N Engl J Med. 1984;311:20-27[Abstract]. 31. Logtenberg T, Schutte ME, Inghirami G, et al. Immunoglobulin VH gene expression in human B cell lines and tumors: biased VH gene expression in chronic lymphocytic leukemia. Int Immunol. 1989;1:362-366[Abstract/Free Full Text]. 32. Guigou V, Cuisinier AM, Tonnelle C, Moinier D, Fougereau M, Fumoux F. Human immunoglobulin VH and VK repertoire revealed by in situ hybridization. Mol Immunol. 1990;27:935-940[Medline] [Order article via Infotrieve]. 33. Brezinschek HP, Brezinschek RI, Lipsky PE. Analysis of the heavy chain repertoire of human peripheral B cells using single-cell polymerase chain reaction. J Immunol. 1995;155:190-202[Abstract]. 34. Bessudo A, Rassenti L, Havlir D, Richman D, Feigal E, Kipps TJ. Aberrant and unstable expression of immunoglobulin genes in persons infected with human immunodeficiency virus. Blood. 1998;92:1317-1323[Abstract/Free Full Text]. 35. Stewart AK, Huang C, Stollar BD, Schwartz RS. High-frequency representation of a single VH gene in the expressed human B cell repertoire. J Exp Med. 1993;177:1227[Free Full Text]. 36. Stevenson FK, Smith GJ, North J, Hamblin TJ, Glennie MJ. Identification of normal B-cell counterparts of neoplastic cells which secrete cold agglutinins of anti-I and anti-i specificity. Br J Haematol. 1989;72:9-15[Medline] [Order article via Infotrieve]. 37. Kraj P, Friedman DF, Stevenson F, Silberstein LE. Evidence for the overexpression of the VH4-34 (VH4.21) Ig gene segment in the normal adult human peripheral blood B cell repertoire. J Immunol. 1995;154:6406-6420[Abstract]. 38. Nakamine H, Bagin RG, Vose JM, et al. Prognostic significance of clinical and pathologic features in diffuse large B-cell lymphoma. Cancer. 1993;71:3130-3137[Medline] [Order article via Infotrieve]. 39. Frizzera G. Non-Hodgkin lymphomas: pathologic features and clinical correlations. In: Hoffman R, ed. Hematology: Basic Principles and Practice. New York: Churchill Livingstone; 1995:1247-1278. 40. Kon S, Levy S, Levy R. Retention of an idiotypic determinant in a human B-cell lymphoma undergoing immunoglobulin variable-region mutation. Proc Natl Acad Sci U S A. 1987;84:5053-5057[Abstract/Free Full Text]. 41. Cleary ML, Meeker TC, Levy S, et al. Clustering of extensive somatic mutations in the variable region of an immunoglobulin heavy chain gene from a human B cell lymphoma. Cell. 1986;44:97-106[Medline] [Order article via Infotrieve]. 42. Bahler DW, Campbell MJ, Hart S, Miller RA, Levy S, Levy R. Ig VH gene expression among human follicular lymphomas. Blood. 1991;78:1561-1568[Abstract/Free Full Text]. 43. Thompsett AR, Ellison DW, Stevenson FK, Zhu D. V(H) gene sequences from primary central nervous system lymphomas indicate derivation from highly mutated germinal center B cells with ongoing mutational activity. Blood. 1999;94:1738-1746[Abstract/Free Full Text]. 44. Driessen A, Tierens A, Ectors N, et al. Primary diffuse large B cell lymphoma of the stomach: analysis of somatic mutations in the rearranged immunoglobulin heavy chain variable genes indicates antigen selection. Leukemia. 1999;13:1085-1092[Medline] [Order article via Infotrieve]. © 2000 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: R B Ilgenfritz, K Kayasut, A Le Tourneau, O A Calendini, L Ouafi, C Marzac, J Diebold, F Devez, V Ducruit, P E Bouchet, et al. Correlation between molecular and histopathological diagnoses of B cell lymphomas in bone marrow biopsy and aspirates J. Clin. Pathol., April 1, 2009; 62(4): 357 - 360. [Abstract] [Full Text] [PDF] M. Colombat, H. Mal, C. Copie-Bergman, J. Diebold, D. Damotte, P. Callard, M. Fournier, J.-P. Farcet, M. Stern, and M.-H. Delfau-Larue Primary cystic lung light chain deposition disease: a clinicopathologic entity derived from unmutated B cells with a stereotyped IGHV4-34/IGKV1 receptor Blood, September 1, 2008; 112(5): 2004 - 2012. [Abstract] [Full Text] [PDF] U. Hershberg, M. Uduman, M. J. Shlomchik, and S. H. Kleinstein Improved methods for detecting selection by mutation analysis of Ig V region sequences Int. Immunol., May 1, 2008; 20(5): 683 - 694. [Abstract] [Full Text] [PDF] M. Booman, J. Douwes, M.-C. Legdeur, J. van Baarlen, E. Schuuring, and P. Kluin From brain to testis: immune escape and clonal selection in a B cell lymphoma with selective out-growth in two immune sanctuariesy Haematologica, June 1, 2007; 92(6): e69 - e71. [Abstract] [Full Text] [PDF] M. A Catherwood, D. Gonzalez, C. Patton, E. Dobbin, L. Venkatraman, and H D. Alexander Improved clonality assessment in germinal centre/post-germinal centre non-Hodgkin's lymphomas with high rates of somatic hypermutation J. Clin. Pathol., May 1, 2007; 60(5): 524 - 528. [Abstract] [Full Text] [PDF] K. Stamatopoulos, C. Belessi, C. Moreno, M. Boudjograh, G. Guida, T. Smilevska, L. Belhoul, S. Stella, N. Stavroyianni, M. Crespo, et al. Over 20% of patients with chronic lymphocytic leukemia carry stereotyped receptors: pathogenetic implications and clinical correlations Blood, January 1, 2007; 109(1): 259 - 270. [Abstract] [Full Text] [PDF] I. S. Lossos and D. Morgensztern Prognostic Biomarkers in Diffuse Large B-Cell Lymphoma J. Clin. Oncol., February 20, 2006; 24(6): 995 - 1007. [Abstract] [Full Text] [PDF] F. Yang, G. C. Waldbieser, and C. J. Lobb The Nucleotide Targets of Somatic Mutation and the Role of Selection in Immunoglobulin Heavy Chains of a Teleost Fish J. Immunol., February 1, 2006; 176(3): 1655 - 1667. [Abstract] [Full Text] [PDF] S. E. Coupland, M. Hummel, H.-H. Muller, and H. Stein Molecular Analysis of Immunoglobulin Genes in Primary Intraocular Lymphoma Invest. Ophthalmol. Vis. Sci., October 1, 2005; 46(10): 3507 - 3514. [Abstract] [Full Text] [PDF] I. S. Lossos Molecular Pathogenesis of Diffuse Large B-Cell Lymphoma J. Clin. Oncol., September 10, 2005; 23(26): 6351 - 6357. [Abstract] [Full Text] [PDF] R. J. Bende, W. M. Aarts, R. G. Riedl, D. de Jong, S. T. Pals, and C. J.M. van Noesel Among B cell non-Hodgkin's lymphomas, MALT lymphomas express a unique antibody repertoire with frequent rheumatoid factor reactivity J. Exp. Med., April 18, 2005; 201(8): 1229 - 1241. [Abstract] [Full Text] [PDF] J. Q. Zhang, C. Okumura, T. McCarty, M. S. Shin, P. Mukhopadhyay, M. Hori, T. A. Torrey, Z. Naghashfar, J. X. Zhou, C. H. Lee, et al. Evidence for Selective Transformation of Autoreactive Immature Plasma Cells in Mice Deficient in Fasl J. Exp. Med., December 6, 2004; 200(11): 1467 - 1478. [Abstract] [Full Text] [PDF] Q. Lou, R. J. Kelleher Jr, A. Sette, J. Loyall, S. Southwood, R. B. Bankert, and S. H. Bernstein Germ line tumor-associated immunoglobulin VH region peptides provoke a tumor-specific immune response without altering the response potential of normal B cells Blood, August 1, 2004; 104(3): 752 - 759. [Abstract] [Full Text] [PDF] D. Capello, M. Cerri, G. Muti, E. Berra, P. Oreste, C. Deambrogi, D. Rossi, G. Dotti, A. Conconi, M. Vigano, et al. Molecular histogenesis of posttransplantation lymphoproliferative disorders Blood, November 15, 2003; 102(10): 3775 - 3785. [Abstract] [Full Text] [PDF] D. Kienle, A. Krober, T. Katzenberger, G. Ott, E. Leupolt, T. F. E. Barth, P. Moller, A. Benner, A. Habermann, H. K. Muller-Hermelink, et al. VH mutation status and VDJ rearrangement structure in mantle cell lymphoma: correlation with genomic aberrations, clinical characteristics, and outcome Blood, October 15, 2003; 102(8): 3003 - 3009. [Abstract] [Full Text] [PDF] M Uchiyama, T Maesawa, A Yashima, T Itabashi, Y Ishida, and T Masuda Consensus primers for detecting monoclonal immunoglobulin heavy chain rearrangement in B cell lymphomas J. Clin. Pathol., October 1, 2003; 56(10): 778 - 779. [Abstract] [Full Text] [PDF] D. Sansonno, V. De Re, G. Lauletta, F. A. Tucci, M. Boiocchi, and F. Dammacco Monoclonal antibody treatment of mixed cryoglobulinemia resistant to interferon alpha with an anti-CD20 Blood, May 15, 2003; 101(10): 3818 - 3826. [Abstract] [Full Text] [PDF] F. Tanioka, S. Tamashima, S.-i. Shimizu, H. Kobayashi, Y. Kobayashi, and H. Sugimura A Case of Primary Plasma Cell Leukemia with Hairy-cell Morphology and Lambda-type Bence-Jones Protein. Immunohistochemical and Molecular Analysis Jpn. J. Clin. Oncol., May 1, 2003; 33(5): 232 - 237. [Abstract] [Full Text] [PDF] J. R. Smith, R. M. Braziel, S. Paoletti, M. Lipp, M. Uguccioni, and J. T. Rosenbaum Expression of B-cell-attracting chemokine 1 (CXCL13) by malignant lymphocytes and vascular endothelium in primary central nervous system lymphoma Blood, February 1, 2003; 101(3): 815 - 821. [Abstract] [Full Text] [PDF] I. S. Lossos, A. A. Alizadeh, R. Rajapaksa, R. Tibshirani, and R. Levy HGAL is a novel interleukin-4-inducible gene that strongly predicts survival in diffuse large B-cell lymphoma Blood, January 15, 2003; 101(2): 433 - 440. [Abstract] [Full Text] [PDF] S. L. Barrans, I. Carter, R. G. Owen, F. E. Davies, R. D. Patmore, A. P. Haynes, G. J. Morgan, and A. S. Jack Germinal center phenotype and bcl-2 expression combined with the International Prognostic Index improves patient risk stratification in diffuse large B-cell lymphoma Blood, February 15, 2002; 99(4): 1136 - 1143. [Abstract] [Full Text] [PDF] P. Algara, M. S. Mateo, M. Sanchez-Beato, M. Mollejo, I. C. Navas, L. Romero, F. Sole, M. Salido, L. Florensa, P. Martinez, et al. Analysis of the IgVH somatic mutations in splenic marginal zone lymphoma defines a group of unmutated cases with frequent 7q deletion and adverse clinical course Blood, February 15, 2002; 99(4): 1299 - 1304. [Abstract] [Full Text] [PDF] F. Leithauser, M. Bauerle, M. Q. Huynh, and P. Moller Isotype-switched immunoglobulin genes with a high load of somatic hypermutation and lack of ongoing mutational activity are prevalent in mediastinal B-cell lymphoma Blood, November 1, 2001; 98(9): 2762 - 2770. [Abstract] [Full Text] [PDF] A. Conconi, F. Bertoni, E. Pedrinis, T. Motta, E. Roggero, S. Luminari, C. Capella, M. Bonato, F. Cavalli, and E. Zucca Nodal marginal zone B-cell lymphomas may arise from different subsets of marginal zone B lymphocytes Blood, August 1, 2001; 98(3): 781 - 786. [Abstract] [Full Text] [PDF] I. S. Lossos, R. Tibshirani, B. Narasimhan, and R. Levy The Inference of Antigen Selection on Ig Genes J. Immunol., November 1, 2000; 165(9): 5122 - 5126. [Abstract] [Full Text] [PDF] C. H. Ottensmeier and F. K. Stevenson Isotype switch variants reveal clonally related subpopulations in diffuse large B-cell lymphoma Blood, October 1, 2000; 96(7): 2550 - 2556. [Abstract] [Full Text] [PDF] I. S. Lossos, A. A. Alizadeh, M. B. Eisen, W. C. Chan, P. O. Brown, D. Botstein, L. M. Staudt, and R. Levy Ongoing immunoglobulin somatic mutation in germinal center B cell-like but not in activated B cell-like diffuse large cell lymphomas PNAS, August 17, 2000; (2000) 180316097. [Abstract] [Full Text] I. S. Lossos, A. A. Alizadeh, M. B. Eisen, W. C. Chan, P. O. Brown, D. Botstein, L. M. Staudt, and R. Levy Ongoing immunoglobulin somatic mutation in germinal center B cell-like but not in activated B cell-like diffuse large cell lymphomas PNAS, August 29, 2000; 97(18): 10209 - 10213. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Lossos, I. S. Articles by Levy, R. Search for Related Content PubMed PubMed Citation Articles by Lossos, I. S. Articles by Levy, R. Related Collections Neoplasia Social Bookmarking                   What's this?

	Copyright © 2000 by American Society of Hematology         Online ISSN: 1528-0020