SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Dilworth, D. Articles by Hogg, D. Search for Related Content PubMed PubMed Citation Articles by Dilworth, D. Articles by Hogg, D. Related Collections Brief Reports Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 95 No. 5 (March 1), 2000: pp. 1869-1871 BRIEF REPORT Germline CDKN2A mutation implicated in predisposition to multiple myeloma David Dilworth, Ling Liu, A. Keith Stewart, James R. Berenson, Norman Lassam, and David Hogg From the Departments of Medical Biophysics, Clinical Science, and Medicine, University of Toronto, Toronto, Ontario, Canada, and the Department of Medical Oncology, University of California at Los Angeles, Los Angeles, CA.     Abstract Top Abstract Introduction Study design Results and discussion References Germline mutations of the CDKN2A (p16INK4A) tumor suppressor gene predispose patients to melanoma and pancreatic carcinoma. In contrast, mutations of the murine CDKN2A gene predispose BALB/c mice to pristane-induced plasmacytoma. We describe here a family in which a germline mutation of CDKN2A is present in 4 individuals who developed melanoma as well as in a fifth family member who is suffering from multiple myeloma. To determine whether the CDKN2A mutation predisposed the myeloma patient to her disease, we carried out loss of heterozygosity studies on sorted bone marrow from this individual and observed loss of the wild type CDKN2A allele in the malignant plasma cells. We suggest that germline mutations of CDKN2A may predispose individuals to a wider variety of malignancy than has been hitherto reported, but that the expression of these cancers may depend heavily on the genetic background of the patient. (Blood. 2000;95:1869-1871) © 2000 by The American Society of Hematology.     Introduction Top Abstract Introduction Study design Results and discussion References The CDKN2A tumor suppressor gene encodes a cell cycle inhibitor (designated protein 16 [p16], p16INK4A, or CDKN2A) that binds to and sequesters the CDK4 and CDK6 kinases from their regulatory cyclin D subunit. Deprived of its regulatory partner, cdk4 cannot phosphorylate the retinoblastoma protein (Rb), which is considered the "gatekeeper" of cell proliferation. As a result, the cells do not progress past the restriction point into the S phase.1 Deletion, transcriptional inactivation, or mutation of the CDKN2A tumor suppressor gene occurs in more than 50% of sporadic tumors arising from a large number of different tissues.2 This promiscuous and widespread alteration of CDKN2A in malignancy rivals or surpasses that of p53. Curiously, families bearing a germline mutation of CDKN2A typically develop a restricted spectrum of cancers including melanoma and occasionally pancreatic carcinoma.3 Some investigators have reported that a few kindreds display a broader range of tumor types including lung4 and oropharyngeal cancers, cholangiocarcinoma5, and glial tumors.6-8 Animal models of disease have the potential to shed considerable light on their human counterparts. It has been known for decades that an intraperitoneal injection of mineral oil, plastics, or pristane will induce plasmacytomas in BALB/c mice.9 As murine plasmacytoma corresponds to multiple myeloma in humans, there has been considerable interest in the genetic basis for susceptibility to this disease. To address this question, Mock et al11 mapped 4 plasmacytoma susceptibility/resistance loci (Pctrl) in BALB/c mice.10 One of these loci is allelic to CDKN2A, and BALB/c mice bearing the susceptibility allele possess a germline mutation of CDKN2A that encodes a protein deficient in binding to CDK4. The identities of the genes corresponding to the remaining Pctrl are not known at this time. However, they likely represent additional modifiers that in conjunction with a germline CDKN2A mutation, account for the predisposition to plasmacytoma in BALB/c mice.12 Previous studies have demonstrated that there is a significant familial risk of multiple myeloma.13 In light of the murine model described above, we hypothesized that germline CDKN2A mutations in humans might influence myeloma predisposition in some individuals. We describe here a melanoma-prone family in which a germline CDKN2A mutation cosegregated with both cases of melanoma and a single case of myeloma (patient No. II:1). In the patient with myeloma, we further demonstrated loss of heterozygosity (LOH) of the wild type allele in the malignant plasma cells. This suggests that the germline CDKN2A mutation played a role in the development of this patient's malignancy.     Study design Top Abstract Introduction Study design Results and discussion References Sorting of bone marrow plasma cells Following informed consent, cells from a bone marrow (BM) aspiration were acquired from patient No. II:1. Plasma cells were purified from the unsorted BM using the B-B4 monoclonal antibody (mAb) (-syndecan/CD138; Serotec, Oxford, England) and immunomagnetic beads (DYNABEADS M450 rat antimouse immunoglobulin G1 [IgG1]; Dynal, Oslo, Norway).14 Amplification and LOH analysis of CDKN2A exon 1 We prepared DNA from peripheral blood following standard protocols. We amplified CDKN2A exon 1 sequences from all available members of the family as well as the presort and postsort BM DNA obtained from patient No. II:1 by using the forward primer (p16E1-FF) 5'GAAAGAGGAGGGGCTGGCTGGTC and the reverse primer (p16E1-RR) 5'GCGCTACCTGATTCCAATTCCCCTGC. The reaction products were separated by polyacrylamide gel electrophoresis (PAGE) on an 8% ethidium-stained polyacrylamide gel and photographed under ultraviolet light.     Results and discussion Top Abstract Introduction Study design Results and discussion References A melanoma-prone family containing a member with multiple myeloma Family A is of northern European descent and comprises 9 members, 4 of whom developed melanoma (including one case of multiple primary disease; Figure 1). In addition to melanoma, one sibling (patient No. II:1) developed multiple myeloma at the age of 53, and a second developed a "brain tumor" (patient No. II:2-it is unknown whether this was a primary tumor or metastatic lesion). We sequenced the genomic DNA of the index case, patient No. II:1, and found that she harbors a germline CDKN2A mutation in exon 1, designated +24 (not shown). This mutation results from a duplication of the first 24 nucleotides of the CDKN2A coding sequence and has been previously associated with melanoma predisposition by multiple investigators worldwide.15 View larger version (20K): [in this window] [in a new window]   Fig 1. The +24 base pair mutation cosegregates with melanoma and myeloma in family A, and the wild type allele is deleted in the malignant plasma cells of patient No. II:1. Shaded members denote cancer development with the cancer type given below. The arrow indicates the proband with multiple myeloma. Four individuals in family A have developed melanoma (patients No. I:1, II:2, II:5, and II:7). The positions of the wild type, mutant, and heteroduplex bands are indicated on the right-hand side of the figure. Note that all 5 individuals harboring the +24 mutation have developed cancer, while patients No. I:2, II:4, and II:6 are wild type for both alleles and have not developed any malignancy. (DNA was not available for patient No. II:3.) On the left side of the figure, the PCR reactions from germline, unsorted BM, and sorted BM cells are shown under patient No. II:1. Note that the LOH of the wild type CDKN2A allele is seen only in the sorted (greater than 90% malignant plasma cells) obtained from this individual. Importantly, there is a large decrease in the amount of heteroduplex DNA present in the sorted BM sample, which was again due to lack of the wild type PCR product. The +24 mutant and wild type CDKN2A exon 1 polymerase chain reaction (PCR) products can be resolved easily by PAGE. We obtained peripheral blood lymphocyte (PBL) genomic DNA from all available members of family A and used PAGE to analyze each member of the family (Figure 1). Interestingly, every member of this family possessing the +24 mutation has developed cancer; in contrast, the 3 noncarrier family members are cancer free. While the association of the germline CDKN2A mutation and melanoma in this family was unsurprising, its role in the development of myeloma in patient No. II:1 was unclear. We hypothesized that the +24 mutation had predisposed patient No. II:1 to this disease. LOH analysis of wild type CDKN2A in malignant plasma cells If loss of CDKN2A expression played a role in the development of myeloma in patient No. II:1, the malignant cells should demonstrate loss or dysfunction of the wild type but not the mutant CDKN2A allele. To confirm this prediction, we performed LOH analysis on this patient's plasma cells. Following informed consent, we acquired an aliquot of a BM aspiration (performed as part of the routine clinical care of this patient). Examination of this BM sample revealed that it comprised both normal hematopoietic elements and 30% or less malignant plasma cells. To ensure that nonmalignant constituents of the BM did not interfere with the LOH analysis, we enriched the sample for the malignant clone using magnetic bead selection with a plasma cell-specific B-B4 mAb (-syndecan/CD138, Serotec), which resulted in a final sample containing more than 90% plasma cells. We isolated genomic DNA from both the sorted and unsorted BM samples as well as from the PBLs from patient No. II:1, amplified exon 1 of CDKN2A from each sample, and resolved the PCR products on a PAGE gel. Germline DNA amplified from the myeloma patient (No. II:1) demonstrated equal ratios of the wild type and mutant exon 1 alleles of CDKN2A (Figure 1). Similarly, DNA from unsorted BM cells from this individual appears heterozygous as well because the minority of cells (30% or less) is malignant. However, DNA isolated from sorted BM, which is highly enriched with malignant plasma cells (greater than 90%), comprises mainly the mutant allele, as indicated by excess of the corresponding PCR product. The small amount of wild type PCR product present in this lane arises from residual nonmalignant cells in the sorted BM sample. We conclude that the wild type CDKN2A allele is lost in the malignant cells and propose that this loss played a role in the development of myeloma in patient No. II:1 of family A. Our hypothesis that abrogation of CDKN2A function plays a role in myeloma initiation or progression in patient No. II:1 is reinforced by 2 previous observations. First, germline CDKN2A mutations predispose mice to pristane-induced plasmacytoma. Second, loss of CDKN2A function occurs commonly in human myeloma, albeit at a later stage of the disease.16,17 It is possible that the loss of CDKN2A in this patient may be a nonspecific event that occurred in the malignant cells due to an unstable genome. However, this explanation seems unlikely due to the important role played by CDKN2A in cell cycle control and the almost universal loss of control of the restriction point in the malignancy. In light of the genetic complexity of both melanoma and myeloma susceptibility, it is not likely that most CDKN2A mutation-bearing individuals are equally predisposed to both diseases. Comparing an analogy between humans and BALB/c mice, which carry at least 4 Pctrl, germline CDKN2A mutations in humans may not be predisposed to myeloma unless other modifier genes that accelerate tumor development are present.     Acknowledgments We thank the families and individuals who attended the Toronto Familial Melanoma Clinic and participated in the study. We thank Rakesh Nayer for technical assistance.     Footnotes Submitted August 9, 1999; accepted October 29, 1999. Supported by grant #7430 from The National Cancer Institute of Canada, Toronto, Ontario, Canada. Reprints: David Hogg, University of Toronto, Medical Sciences Building, Room 7368, Toronto, Ontario, M5S 1A8 Canada; e-mail: david.hogg{at}utoronto.ca. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.     References Top Abstract Introduction Study design Results and discussion References 1. Sherr CJ, Roberts JM. Inhibitors of mammalian G1 cyclin-dependent kinases. Genes Devel. 1995;9:1149-1163[Free Full Text]. 2. Kamb A, Gruis NA, Weaver-Feldhaus J, et al. A cell cycle regulator potentially involved in genesis of many tumor types. Science. 1994;264:436-440[Abstract/Free Full Text]. 3. Goldstein AM, Fraser MC, Streuwing JP, et al. Increased risk of pancreatic cancer in melanoma-prone kindreds with p16INK4 mutations. NEJM. 1995;333:970-974[Abstract/Free Full Text]. 4. Yarbrough WG, Aprelikova O, Pei H, Olshan AF, Liu ET. Familial tumor syndrome associated with a germline nonfunctional p16INK4a allele. J Natl Cancer Inst. 1996;88:1489-1491[Free Full Text]. 5. Sun S, Pollock PM, Liu L, et al. CDKN2A mutation in a non-FAMMM kindred with cancers at multiple sites results in a functionally abnormal protein. Int J Cancer. 1997;73:531-536[Medline] [Order article via Infotrieve]. 6. Azizi E, Friedman J, Pavlotsky F, et al. Familial cutaneous malignant melanoma and tumors of the nervous system. A hereditary cancer syndrome. Cancer. 1995;76:1571-1578[Medline] [Order article via Infotrieve]. 7. Kaufmann DK, Kimmel DW, Parisi JE, Michels VV. A familial syndrome with cutaneous malignant melanoma and cerebral astrocytoma. Neurology. 1993;43:1728-1731[Abstract/Free Full Text]. 8. Bahuau M, Vidlaud D, Jenkins RB, et al. Germ-line deletion involving the INK4 locus in familial proneness to melanoma and nervous system tumors. Cancer Res. 1998;58:2298-2303[Abstract/Free Full Text]. 9. Pedio G, Grieshaber, Ruttner JR. Zur Plasmozytom-Onkogenese (LPC-1). Durch Milzhomogenat einer mit Meneralol behandelten BALB-c Maus induzierte transplantable Neoplasie(HIPA) mit plasmazellularer Evolution. I. Biologisch-histologischerTeil. Pathol Microbiol. 1968;31:278-286. 10. Mock BA, Krall MM, Dosik JK. Genetic mapping of tumor susceptibility genes involved in mouse plasmacytomagenesis. Proc Natl Acad Sci U S A. 1993;90:9499-9503[Abstract/Free Full Text]. 11. Zhang S, Ramsay ES, Mock BA. Cdkn2a, the cyclin-dependent kinase inhibitor encoding p16INK4a and p19ARF, is a candidate for the plasmacytoma susceptibility locus, Pctr1. Proc Natl Acad Sci U S A. 1998;95:2429-2434[Abstract/Free Full Text]. 12. Mock BA, Hartley J, Le Tissier P, Wax JS, Potter M. The plasmacytoma resistance gene, Pctr2, delays the onset of tumorigenesis and resides in the telomeric region of chromosome 4. Blood. 1997;90:4092-4098[Abstract/Free Full Text]. 13. Brown LM, Linet MS, Greenberg RS, et al. Multiple myeloma and family history of cancer among blacks and whites in the U.S. Cancer. 1999;85:2385-2390[Medline] [Order article via Infotrieve]. 14. Bjorkstrand B, Dilber MS, Smith CI, Gahrton G, Xanthopoulos KG. Retroviral-mediated gene transfer into human myeloma cells. Br J Haematol. 1994;88:325-331[Medline] [Order article via Infotrieve]. 15. Pollock PM, Spurr N, Bishop T, et al. Haplotype analysis of two recurrent CDKN2A mutations in 10 melanoma families: evidence for common founders and independent mutations. Hum Mutat. 1998;11:424-431[Medline] [Order article via Infotrieve]. 16. Ogawa S, Hangaishi A, Miyawaki S, et al. Loss of the cyclin-dependent kinase 4-inhibitor (p16; MTS1) gene is frequent in and highly specific to lymphoid tumors in primary human hematopoietic malignancies. Blood. 1995;86:1548-1556[Abstract/Free Full Text]. 17. Ng MH, Chung YF, Lo KW, et al. Frequent hypermethylation of p16 and p15 genes in multiple myeloma. Blood. 1997;89:2500-2506[Abstract/Free Full Text]. © 2000 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: S. Y. Kristinsson, L. R. Goldin, M. Bjorkholm, I. Turesson, and O. Landgren Risk of solid tumors and myeloid hematological malignancies among first-degree relatives of patients with monoclonal gammopathy of undetermined significance Haematologica, August 1, 2009; 94(8): 1179 - 1181. [Full Text] [PDF] N. J. Camp, T. L. Werner, L. A. Cannon-Albright, H. T. Lynch, and S. Thome Familial Myeloma N. Engl. J. Med., October 16, 2008; 359(16): 1734 - 1735. [Full Text] [PDF] H. T. Lynch, K. Ferrara, B. Barlogie, E. A. Coleman, J. F. Lynch, D. Weisenburger, W. Sanger, P. Watson, H. Nipper, V. Witt, et al. Familial Myeloma N. Engl. J. Med., July 10, 2008; 359(2): 152 - 157. [Abstract] [Full Text] [PDF] A. Dib, B. Barlogie, J. D. Shaughnessy Jr, and W. M. Kuehl Methylation and expression of the p16INK4A tumor suppressor gene in multiple myeloma Blood, February 1, 2007; 109(3): 1337 - 1338. [Full Text] [PDF] H. T. Lynch, P. Watson, S. Tarantolo, P. H. Wiernik, B. Quinn-Laquer, K. Isgur Bergsagel, L. Huiart, O.I. Olopade, H. Sobol, W. Sanger, et al. Phenotypic Heterogeneity in Multiple Myeloma Families J. Clin. Oncol., February 1, 2005; 23(4): 685 - 693. [Abstract] [Full Text] [PDF] R. Fonseca, B. Barlogie, R. Bataille, C. Bastard, P. L. Bergsagel, M. Chesi, F. E. Davies, J. Drach, P. R. Greipp, I. R. Kirsch, et al. Genetics and Cytogenetics of Multiple Myeloma: A Workshop Report Cancer Res., February 15, 2004; 64(4): 1546 - 1558. [Abstract] [Full Text] [PDF] T. A. Dragani 10 Years of Mouse Cancer Modifier Loci: Human Relevance Cancer Res., June 15, 2003; 63(12): 3011 - 3018. [Abstract] [Full Text] [PDF] H. T. Lynch, W. G. Sanger, S. Pirruccello, B. Quinn-Laquer, and D. D. Weisenburger Familial Multiple Myeloma: a Family Study and Review of the Literature J Natl Cancer Inst, October 3, 2001; 93(19): 1479 - 1483. [Abstract] [Full Text] [PDF] S.-L. Zhang, W. DuBois, E. S. Ramsay, V. Bliskovski, H. C. Morse III, L. Taddesse-Heath, W. C. Vass, R. A. DePinho, and B. A. Mock Efficiency Alleles of the Pctr1 Modifier Locus for Plasmacytoma Susceptibility Mol. Cell. Biol., January 1, 2001; 21(1): 310 - 318. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Dilworth, D. Articles by Hogg, D. Search for Related Content PubMed PubMed Citation Articles by Dilworth, D. Articles by Hogg, D. Related Collections Brief Reports Social Bookmarking                   What's this?

	Copyright © 2000 by American Society of Hematology         Online ISSN: 1528-0020