|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 95 No. 6 (March 15), 2000:
pp. 2000-2007
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Division of Molecular and Genetic Medicine, Royal
Hallamshire Hospital, University of Sheffield, United Kingdom; Medical
School of Gazi University, Ankara, Turkey; University Hospital of
Skejby, Aarhus, Denmark. Submitted March 3, 1999; accepted November 29, 1999.
Two novel mutations, a T-to-C transition at nucleotide 2612 and a
T-to-G transversion at nucleotide 3923 of the von Willebrand factor
(vWF) complementary DNA, were detected by analysis of the vWF gene in
DNA from members of 2 families with atypical von Willebrand disease.
The T2612C transition predicts substitution of cysteine by arginine at
amino acid position 788 (C788R), and the T3923G transversion predicts
substitution of cysteine by glycine at position 1225 (C1225G) of
pre-pro-vWF. The patients homozygous for the C788R and
C1225G mutations both had a partial vWF deficiency (0.18 IU/mL and 0.07 IU/mL vWF antigen, respectively); vWF in
plasma from patients homozygous for either the C788R or the C1225G
mutation failed to bind factor VIII and lacked high molecular weight
multimers. Recombinant (r) vWF molecules having the C788R or C1225G
mutation were expressed in COS-7 cells. Both rvWF C788R and rvWF C1225G exhibited significantly impaired secretion and failed to bind factor VIII. Recombinant vWF C788R in COS-7 culture medium showed a
severe reduction in high molecular weight multimers, whereas rvWF
C1225G showed a very mild reduction in high molecular weight multimers
when compared with wild-type rvWF.
(Blood. 2000;95:2000-2007)
Von Willebrand factor (vWF) is a large glycoprotein
synthesized by endothelial cells and megakaryocytes that circulates in plasma as disulfide-linked multimers ranging in size from
5 × 105 to
20 × 106d; vWF has two roles in
hemostasis. First, it acts as a carrier for factor VIII, protecting it
from proteolytic degradation in plasma. Second, vWF mediates
platelet-subendothelium and platelet-platelet interactions at the site
of vascular injury.1 The 178-kb gene encoding vWF has been
localized to chromosome 12 and contains 52 exons. The 8.7-kb messenger
RNA encodes a precursor of 2813 amino acids that includes a signal
peptide (22 amino acids), a propeptide (741 amino acids), and the
mature subunit (2050 amino acids).2,3 The domains of vWF
are in the following order from N- to C-terminus;
D1-D2-D'-D3-A1-A2-A3-D4-B1-B2-B3-C1-C2-CK.4 The
functions of vWF have been located to specific domains. Regions essential for factor VIII binding reside in the D' (amino acids 769 to 865 in pre-pro-vWF) and D3 (amino acids 866 to 1242 in pre-pro-vWF) domains.5,6
Mutations in the vWF gene resulting in quantitative deficiencies or
qualitative abnormalities of vWF lead to von Willebrand disease
(vWD). This is the most common bleeding disorder in humans. The current
classification of vWD recognizes three types.7 Type 1 vWD
is the most common form of the disease; it accounts for 70% of
cases1,7 and is characterized by a partial quantitative deficiency of vWF and normal multimers. Type 3 vWD occurs in 1 to 2 individuals per million and refers to a complete deficiency of vWF.
Type 3 vWD is generally inherited in an autosomal recessive manner.7 Type 2 vWD refers to qualitative deficiency of vWF and is subdivided into types 2A, 2B, 2M, and 2N.7 Type 2A
and 2M variants show decreased platelet binding. In type 2A vWD, but not in type 2M vWD, this is associated with an absence of high molecular weight multimers. Type 2B variants have an increased affinity
for platelet glycoprotein Ib. Type 2N vWD refers to variants that have
a decreased affinity for factor VIII.8,9
This report describes the molecular defects underlying cases of
atypical vWD in 2 different consanguineous families from Turkey. As
with previously described cases of type 2N vWD, the vWF in plasma from
both affected individuals failed to bind factor VIII. However, unlike
the situation in classical type 2N vWD, both individuals had
significantly reduced levels of plasma vWF and lacked high molecular
weight multimers. Analysis of the vWF gene sequence in DNA from
affected members of both families detected a novel mutation in each
family, T2612C and T3923G, predicting substitution of cysteine residues
by arginine and by glycine at amino acid positions 788 and 1225 of
pre-pro-vWF respectively. Recombinant (r) vWF molecules having either
the C788R or C1225G mutation were expressed in COS-7 cells. Both rvWF
C788R and rvWF C1225G exhibited significantly impaired secretion and
failed to bind factor VIII. Recombinant vWF C788R showed a severe
impairment in its ability to form high molecular weight multimers. In
contrast, rvWF C1225G showed a very mild reduction in its ability to
form high molecular weight multimers compared with wild-type rvWF.
Materials
Methods
Blood samples.
Peripheral venous blood was collected from the two propositi, their
parents, and their siblings in Turkey following informed consent.
Citrated blood was centrifuged at 2500g for 10 minutes to
separate plasma, which was stored at Phenotypic analysis and laboratory assays.
Factor VIII coagulant activity (factor VIII:C), factor VIII antigen
(FVIII:Ag), vWF antigen (vWF:Ag) and vWF ristocetin
cofactor (RCoF) assays were performed with the use of
standard methods.10,11 Bleeding times were determined with
the use of a Simplate-II device (General Diagnostics, Morris Plains, NJ).
Multimer analysis.
We analyzed vWF multimers by electrophoresis in either 2% or 3%
(wt/vol) sodium dodecyl sulfate (SDS)/agarose
gels.12 Proteins were electrophoretically transferred to
nitrocellulose and vWF was detected with polyclonal rabbit anti-human
vWF antibody followed by a secondary alkaline phosphatase-conjugated
swine anti-rabbit immunoglobulin G (IgG) polyclonal and colorimetric
staining. Alternatively, where indicated, the secondary alkaline
phosphatase-conjugated swine anti-rabbit IgG polyclonal and
colorimetric staining was replaced with secondary horseradish
peroxidase-conjugated swine anti-rabbit IgG polyclonal and enhanced chemiluminescence.
FVIII binding assay.
The affinity of vWF for factor VIII was assessed as described
previously.13 Results were plotted as concentration of
vWF:Ag (IU/dL) against activity of bound
factor VIII expressed as absorbance at 405 nm. Normal plasma pooled
from 20 healthy individuals and plasma from an individual homozygous
for the T791M mutation in vWF, which showed a complete absence of
factor VIII binding,14 were used as control samples.
Terminology.
We use vWF to refer to the complete pre-pro-vWF protein in relation to
the numbering of amino acids. Thus, C788 and C1225 are C25 and C462 of
the mature vWF subunit, respectively. This scheme is adopted to allow
for numbering of mutations throughout the pre-pro-vWF product in this
and subsequent publications from our group. We also use this system to
refer to mutations previously reported by other groups and indicate the
numbering previously used in these publications for the mature vWF subunit.
Mutation screening.
Genomic DNA was extracted from citrated blood with the use of the BACC2
DNA extraction kit and the protocol supplied by the manufacturer. DNA
corresponding to the 2.2-kb promoter (nucleotides 1 through
2181)2 and exons 1 through 52, including exon/intron boundaries of the vWF gene, was amplified by means of the polymerase chain reaction (PCR). Apart from the promoter and exons 9, 10, 15, 26, and 28, which were amplified with the use of the primers indicated
(Table 1), the fragments were amplified
with the use of the oligonucleotide primers previously designed by
Zhang et al.15,16 PCRs contained 0.5 µg of genomic DNA
diluted in a final volume of 50 µL containing 200 µmol/L dNTPs, 300 ng of each primer, 1 U Taq
DNA polymerase, 67 mmol/L Tris/HCl pH 8.8, 16.6 mmol/L (NH4)2SO4, 10 mmol/L
DNA sequencing.
Following electrophoresis in 1% agarose, amplified DNA fragments were
purified with the use of a QIAEX kit and the protocol supplied by the
manufacturer. Sequence analysis of amplified DNA fragments and plasmid
DNA was performed with the use of a Thermosequenase cycle sequencing
kit with 32P end-labeled PCR primers as directed by the
manufacturer. Automated sequencing of plasmid DNA was performed with
the use of an Applied Biosystems DNA sequencer (model 373).
Plasmid construction.
Plasmid pSVH vWF1 contains full-length wild-type human vWF cDNA cloned
into the expression vector pSV7D as described previously.22 Plasmid pSVvWFC788R contained a T-to-C transition at nucleotide 2612 of
the vWF cDNA predicted to result in substitution of cysteine by
arginine at amino acid 788 in pre-pro-vWF. PSV vWF C788R was constructed by mutagenesis of a shuttle vector pSP70BglII,
which contains a 4.7-kb fragment (nucleotides 2248 through 6936) of the
vWF cDNA obtained by BglII digestion of pSVHvWF1 cloned into pSP70. Mutagenesis was performed by means of the GeneEditor system and
the mutagenic oligonucleotide:
5'GAAGGGCTCGAGCGTACCAAAACGTG3' (nucleotides 2600 through
2625 in the vWF cDNA). Clones containing the appropriate mutation were
confirmed by sequence analysis. The mutated fragment was subcloned into
the BglII sites of pSVHvWF1 to obtain pSV vWF C788R. The
presence of the appropriate mutation in pSVvWFC788R was confirmed
again by sequence analysis.
Expression of wild-type pSVHvwF1, pSVvwFC788R, and pSVvwFC1225G.
COS-7 cells were maintained in Dulbecco's modified Eagle's medium
(DMEM) (Gibco Life Technologies) supplemented with 10% fetal bovine
serum (FBS). Cells, at 60% confluence, in 10-cm dishes were washed
twice with serum-free DMEM containing 10 mmol/L HEPES pH
7.15, and incubated for 90 minutes at 37°C with 5 mL
of the same medium containing 0.4 mg/mL DEAE-dextran and
3 µg/mL of the appropriate plasmid DNA (15 µg plasmid DNA per
dish). Where wild-type vWF was coexpressed with mutant vWF, 7.5 µg
wild-type and 7.5 µg mutant plasmid DNA were used per dish. The cells
were then washed 3 times with DMEM containing 10% FBS and incubated in
the same medium containing 100 µmol/L chloroquine for 3 hours. Following 3 further washes with DMEM containing 10% FBS, the
cells were incubated in the same medium prior to analysis as described below.
Steady-state analysis of von Willebrand factor secretion.
For steady-state analysis of vWF secretion, the COS-7 cells were washed
3 times in serum-free DMEM 24 hours posttransfection and incubated for
a further 48 hours in 5 mL of serum-free DMEM supplemented with 0.5%
BSA and a 1% insulin/transferrin/selenium supplement. Medium was
collected into a final concentration of 10 µg/mL soybean trypsin
inhibitor (SBTI) and 1 mmol/L phenylmethylsulphonyl fluoride (PMSF). The cells were washed 3 times with phosphate-buffered saline (PBS), then lysed with 1 mL of Triton lysis buffer
(10 mmol/L Tris-HCl, pH 7.4, containing 1 mmol/L EDTA, 150 mmol/L NaCl, 0.5% Triton
X-100, 0.5% sodium deoxycholate, 10 µg/mL SBTI, and 1 mmol/L PMSF). Lysates were incubated on ice for at least 1 hour, then centrifuged for 15 minutes at 12 000g to pellet
nuclei and cell debris. The vWF in cell lysates and medium samples from steady-state secretion experiments was quantified by a sandwich enzyme-linked immunoabsorbent assay (ELISA) using 1:1000 rabbit anti-human vWF polyclonal antibody as the coating antibody and 1:1000
horseradish peroxidase-conjugated anti-human vWF as the detecting
antibody. ELISAs were developed with the use of
o-phenylenediamine as the colorimetric substrate with
measurement of the optical density at 490 nm.
Pulse-chase analysis of von Willebrand factor secretion.
For pulse-chase analysis of vWF secretion, at 48 hours
posttransfection, COS-7 cells were washed twice with cysteine- and methionine-free DMEM and pre-incubated with the same medium for 1 hour.
The cells were then incubated for 20 minutes with 250 µCi of Promix
[35S]-cysteine and [35S]-methionine mixture
per 10-cm dish in 5 mL of cysteine- and methionine-free DMEM. Labeling
medium was removed, and the cells were incubated for various times up
to 96 hours with 5 mL of chase medium consisting of serum-free DMEM
supplemented with 0.5% BSA and a 1% insulin/transferrin/selenium
supplement. The medium was then removed, and the cells were washed
twice with ice-cold PBS before lysis with 0.75 mL of ice-cold Triton
lysis buffer on ice for at least 1 hour. Lysates were adjusted to 1 mL
with lysis buffer and then centrifuged for 15 minutes at
12 000g to pellet nuclei and cell debris. To each 5 mL medium
sample, 0.5 mL of 10 × concentrated Triton lysis buffer was added.
Immunoprecipitation of von Willebrand factor.
Cell lysates (1 mL) and medium supernatants (5 mL) were preincubated
with 100 µL and 200 µL of
protein-A sepharose (10% wt/vol in PBS), respectively,
at 4°C for 1 hour to preclear the samples of protein-A
binding components. Precleared samples were then incubated
overnight at 4°C with 100 µL (cell lysates) or
200 µL (medium supernatants) of protein-A sepharose and
5 µL (cell lysates) or 20 µL (medium
supernatants) of rabbit anti-human vWF polyclonal antibody. The
sepharose beads were pelleted, washed 4 times with Triton lysis buffer,
and then prepared for analysis by SDS-polyacrylamide gel
electrophoresis (SDS-PAGE) as described below.
SDS-polyacrylamide gel electrophoresis.
Immunoprecipitation sepharose beads were resuspended in 100 µL of
SDS-PAGE sample buffer (0.25 mmol/L
Tris-HCl, pH 6.8, containing 2% wt/vol SDS, 20%
vol/vol glycerol, 50 mol/L
DTT and 0.004% wt/vol bromophenol blue).
The samples were boiled for 5 minutes prior to electrophoresis. Cooled
samples were loaded onto 6% SDS-polyacrylamide gels with 3% stacking
gels for electrophoresis. Electrophoresis was performed overnight for
18 hours at room temperature at a constant current of 7 mA until the
bromophenol blue dye reached the bottom of the gel. Gels were fixed in
methanol:acetic acid:water (1:1:9) for 1 hour, then dried under vacuum,
and subjected to autoradiography with the use of Kodak Biomax film for
48 hours.
Patient histories and phenotypic results
Multimer analysis of plasma von Willebrand factor
Factor VIII binding analysis of plasma von Willebrand factor The results of factor VIII binding analysis performed on plasma samples from the propositi of families A and B are shown in Figures 1A(iii) and 1B(iii); vWF in plasma from the propositus AII:2 (Figure 1A[iii]) failed to bind factor VIII similar to plasma vWF from a patient known to be homozygous for the type 2N mutation T791M. A moderate reduction in the factor VIII binding capacity of plasma vWF was shown for the sibling of AII:2 (AII:1, Figure 1A[iii]). The vWF in plasma from the propositus BII:1 (Figure 1B[iii]) showed a severe reduction in factor VIII binding, which was only slightly increased compared with plasma vWF from the patient homozygous for the T791M mutation.Candidate mutations C788R and C1225G CSGE and CCMA were used to analyze all exons, exon/intron boundaries, and the promoter of the vWF gene in DNA from affected members of both families. In family A, CSGE analysis detected a mutation in amplified DNA corresponding to exon 18, which on sequencing was shown to have a T-to-C transition at position 2612 of the vWF cDNA, predicting substitution of cysteine by arginine at amino acid 788 in pre-pro-vWF. The propositus (AII:2) was homozygous for the T2612C transition. The father (AI:1), mother (AI:2), and sibling (AII:1) were heterozygous for the same defect. In all cases, the mutation was inherited with the 6 repeat allele of the intron 40 VNTR-1.Steady-state analysis of recombinant von Willebrand factor C788R and recombinant von Willebrand factor C1225G secretion The T2612C (C788R) and T3923G (C1225G) mutations were introduced into the full-length vWF cDNA in the expression vector pSVH vWF1. To investigate the synthesis and secretion of vWF containing these substitutions, the expression vectors pSVvWFC788R and pSVvWFC1225G were used to transfect COS-7 cells either alone or in combination with pSVHvWF1 (wild-type) to generate mutant and wild-type hybrids. Intracellular rvWF in the cell lysates and secreted rvWF in the conditioned media of the mutated vWF transfectants were quantified by ELISA and compared with that of wild-type vWF (Figure 2). Secretion of rvWF C788R and rvWF C788R/wild-type hybrid were decreased to 41% ± 9% and 67% ± 5, respectively, relative to wild-type rvWF. Secretion of rvWF C1225G and rvWF C1225G/wild-type hybrid were decreased to 58% ± 3% and 74% ± 10, respectively, relative to wild-type rvWF. The intracellular levels of rvWF C788R and rvWF C788R/wild-type hybrid were 107% ± 8% and 97% ± 3%, respectively, relative to wild-type rvWF. The intracellular levels of rvWF C1225G and rvWF C1225G/wild-type hybrid were 102% ± 4% and 96% ± 1, respectively, relative to wild-type rvWF (Figure 2).
Pulse-chase analysis of recombinant von Willebrand factor C788R and recombinant von Willebrand factor C1225G secretion A pulse-chase approach was adopted to further investigate the variation in steady-state levels of secreted rvWF having the C788R and C1225G amino acid substitutions. Transfected cells were pulse-labeled for 20 minutes and then chased for various periods of time in unlabeled growth medium. The labeled vWF in cell lysates and medium samples was immunoprecipitated and analyzed by SDS-PAGE and autoradiography (Figure 3). Wild-type rvWF was detected in the medium after 2 hours, and all of the wild-type rvWF was chased out of the cells between 48 and 96 hours as shown previously.23,24 Immediately after the pulse (0 hours of chase period, Figure 3), identical amounts of rvWF C788R and rvWF C1225G were immunoprecipitated from the cell lysates compared with the wild-type rvWF (Figure 3). This indicated that amounts of rvWF C788R and rvWF C1225G equivalent to that of wild-type rvWF were synthesized. Both rvWF C788R and rvWF C1225G were detected in the medium after 2 hours. However, over the course of the 96-hour chase, the rates of secretion of both variants were significantly reduced. None of the radiolabeled rvWF C788R or rvWF C1225G remained in the cells between 48 and 96 hours. These results indicate that both rvWF C788R and rvWF C1225G underwent impaired intracellular transport and secretion.
Factor VIII binding analysis of recombinant von Willebrand factor C788R and recombinant von Willebrand factor C1225G To determine if the C788R and C1225G amino acid substitutions alone could account for the lack of binding of vWF to factor VIII, medium supernatants from the steady-state secretion analysis were assayed for the ability of the rvWFs to bind factor VIII (Figure 4). Wild-type rvWF showed a dose-dependent increase in binding of factor VIII similar to that of vWF from normal pooled plasma (Figure 4). However, rvWF C788R (Figure 4A) failed to bind factor VIII like plasma vWF from a patient known to be homozygous for the type 2N mutation T791M (Figure 4). Similarly, rvWF C1225G (Figure 4B) showed a severe reduction in its ability to bind factor VIII, which was only slightly increased compared with vWF from the patient homozygous for the T791M mutation (Figure 4). The rvWF C788R/wild-type hybrid (Figure 4A) showed a dose-dependent increase in binding of factor VIII similar to that of vWF from normal pooled plasma and wild-type rvWF. In contrast, rvWF C1225G/wild-type hybrid (Figure 4B) exhibited a moderate reduction in factor VIII binding.
Multimer analysis of recombinant von Willebrand factor C788R and recombinant von Willebrand factor C1225G To determine the effects of the individual C788R and C1225G amino acid substitutions on vWF multimer structure, we used vWF expressed in COS-7 cells. The COS-7 medium samples containing wild-type rvWF, rvWF C788R, rvWF C1225G, and hybrids of mutant and wild-type vWF were separated by SDS-agarose electrophoresis (Figure 5). The wild-type rvWF (Figure 5, lane 1) exhibited a full range of multimers. The rvWF C788R/wild-type hybrid (Figure 5, lane 2) showed a multimer pattern similar to that of wild-type rvWF (Figure 5, lane 1). Both rvWF C1225G/wild-type hybrid (Figure 5, lane 3) and rvWF C1225G (lane 5) showed very mild reductions in high molecular weight multimers compared with wild-type rvWF (lane 1), which were observed on repeated occasions. In contrast, rvWF C788R (lane 4) showed only low molecular weight multimers.
In the classification of vWD,7 type 2N vWD is defined as a variant of vWD associated with defective binding of vWF to factor VIII. Type 1 vWD is defined as a quantitative form of the disease associated with reduced vWF:Ag level and normal binding of vWF to factor VIII. We report here 2 novel cases of atypical type 2N vWD in 2 families initially classified as having type 1 vWD owing to the quantitative deficiency of vWF:Ag in plasma from affected members of both families. The binding of plasma vWF to factor VIII was completely absent in the individual homozygous for the C788R mutation and virtually absent in the individual homozygous for the C1225G mutation. Similarly, the binding of rvWF C788R to factor VIII was completely absent, and the binding of rvWF C1225G to factor VIII was severely reduced.
We thank Dr C. Mazurier (Lille, France) for supplying the plasma from a patient homozygous for the T791M mutation, Dr A. Inbal (Tel Aviv, Israel) for providing pSVH vWF1, Barbara Sampson (Sheffield, UK) for advice and assistance with the multimer analysis, and Hazel Holden (Sheffield, UK) for oligonucleotide synthesis and automated sequencing of mutated plasmid DNA.
Supported by a project grant from the British Heart Foundation (Grant PG/97016).
S.A. and A.M.A. contributed equally to this work.
Reprints: Simon Allen, Division of Molecular and Genetic Medicine, Royal Hallamshire Hospital, Glossop Road, Sheffield S10 2JF United Kingdom; e-mail: simon.allen{at}sheffield.ac.uk.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1. Sadler JE. Biochemistry and genetics of von Willebrand factor. Annu Rev Biochem. 1998;67:395[Medline] [Order article via Infotrieve].
2.
Mancuso DJ, Tuley EA, Westfield LA, et al.
Structure of the gene for human von Willebrand factor.
J Biol Chem.
1989;264:19,514 3. Titani K, Kumar S, Takio K, et al. Amino acid sequence of human von Willebrand factor. Biochemistry. 1986;25:3171[Medline] [Order article via Infotrieve]. 4. Shelton-Inloes BB, Titani K, Sadler JE. cDNA sequence for human von Willebrand factor reveals five types of repeated domains and five possible protein sequence polymorphisms. Biochemistry. 1986;25:3164[Medline] [Order article via Infotrieve].
5.
Foster PA, Fulcher CA, Marti T, Titani K, Zimmerman TS.
A major factor VIII binding domain resides within the amino-terminal 272 amino acid residues of von Willebrand factor.
J Biol Chem.
1987;262:8443
6.
Takahashi Y, Kalafatis M, Girma JP, Sewerin K, Andersson LO, Meyer D.
Localization of a factor VIII binding domain on a 34 kilodalton fragment of the N-terminal portion of von Willebrand factor.
Blood.
1987;70:1679 7. Sadler JE. A revised classification of von Willebrand disease. Thromb Haemost. 1994;71:520[Medline] [Order article via Infotrieve]. 8. Mazurier C. Von Willebrand disease masquerading as haemophilia A. Thromb Haemost. 1992;67:391[Medline] [Order article via Infotrieve]. 9. Mazurier C, Meyer D. Factor VIII binding assay of von Willebrand factor and the diagnosis of type 2N von Willebrand disease: results of an international survey. Thromb Haemost. 1996;76:270[Medline] [Order article via Infotrieve]. 10. Ingerslev J. A sensitive ELISA for von Willebrand factor (vWF:Ag). Scand J Clin Lab Invest. 1987;47:143[Medline] [Order article via Infotrieve]. 11. Ingerslev J, Stenberg S. Enzyme linked immunosorbent assay (ELISA) for the measurement of factor VIII coagulant antigen (CAg) using haemophilic antibodies. Br J Haematol. 1986;62:325[Medline] [Order article via Infotrieve]. 12. Bukh A, Ingerslev J, Stenberg S, Moller NPH. The multimeric structure of plasma FVIII:RAg studied by electroelution and immunoperoxidase detection. Thromb Res. 1986;43:579[Medline] [Order article via Infotrieve]. 13. Nesbitt IM, Goodeve AC, Guilliatt AM, Makris M, Preston FE, Peake IR. Characterization of type 2N von Willebrand disease using phenotypic and molecular techniques. Thromb Haemost. 1996;75:959[Medline] [Order article via Infotrieve].
14.
Gaucher C, Jorieux S, Mercier B, Oufkir D, Mazurier C.
The "Normandy" variant of von Willebrand's disease: characterization of a point mutation in the von Willebrand factor gene.
Blood.
1991;77:1937
15.
Zhang ZP, Blomback M, Nyman D, Anvret M.
Mutations of von Willebrand factor gene in families with von Willebrand disease in the Aland islands.
Proc Natl Acad Sci U S A.
1993;90:7937 16. Zhang ZP, Blomback M, Egberg N, Falk G, Anvret M. Characterization of the von Willebrand factor gene (VWF) in von Willebrand disease type III patients from 24 families of Swedish and Finnish origin. Genomics. 1994;21:188[Medline] [Order article via Infotrieve]. 17. Standen GR, Bignell P, Bowen DJ, Peake IR, Bloom AL. Family studies in von Willebrand's disease by analysis of restriction fragment length polymorphisms and an intragenic variable number tandem repeat (VNTR) sequence. Br J Haematol. 1990;76:242[Medline] [Order article via Infotrieve].
18.
Peake IR, Bowen D, Bignell P, et al.
Family studies and prenatal diagnosis in severe von Willebrand disease by polymerase chain reaction amplification of a variable number tandem repeat region of the von Willebrand factor gene.
Blood.
1990;76:555
19.
van Amstel HK, Reitsma PH.
Tetranucleotide repeat polymorphism in the vWF gene.
Nucleic Acids Res.
1990;18:4957
20.
Cotton RGH, Rodrigues NR, Campbell RD.
Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.
Proc Natl Acad Sci U S A.
1988;85:4397 21. Williams IJ, Abuzenadah A, Winship PR, et al. Precise carrier diagnosis in families with haemophilia A: use of conformation sensitive gel electrophoresis for mutation screening and polymorphism analysis. Thromb Haemost. 1998;79:723[Medline] [Order article via Infotrieve]. 22. Wagner DD, Saffaripour S, Bonfanti R, et al. Induction of specific storage organelles by von Willebrand factor propolypeptide. Cell. 1991;64:403[Medline] [Order article via Infotrieve].
23.
Lyons SE, Bruck ME, Bowie EJW, Ginsburg D.
Impaired intracellular transport produced by a subset of type 2A von Willebrand disease mutations.
J Biol Chem.
1992;267:4424
24.
Englender T, Lattuada A, Mannucci PM, Sadler JE, Inbal A.
Analysis of Arg834Gln and Val902Glu type 2A von Willebrand disease mutations: studies with recombinant von Willebrand factor and correlation with patient characteristics.
Blood.
1996;87:2788 25. Jorieux S, Gaucher C, Fressinaud E, Goudemand J, Meyer D, Mazurier C. Mutations in cysteine residues 25 and 95 of mature von Willebrand factor induce type 2N von Willebrand disease. Thromb Haemost. 1997(supp):OC1586.
26.
Jorieux S, Gaucher C, Goudemand J, Mazurier C.
A novel mutation in the D3 domain of von Willebrand factor markedly decreases its ability to bind factor VIII and affects its multimerization.
Blood.
1998;92:4663
27.
Wagner DD, Marder VJ.
Biosynthesis of von Willebrand protein by human endothelial cells: processing steps and their intracellular localization.
J Cell Biol.
1984;99:2123 28. Marti T, Rosselet SJ, Titani K, Walsh KA. Identification of disulphide-bridged substructures within human von Willebrand factor. Biochemistry. 1987;26:8099[Medline] [Order article via Infotrieve].
29.
Voorberg J, Fontijn R, Calafat J, Janssen H, van Mourik JA, Pannekoek H.
Assembly and routing of von Willebrand factor variants: the requirements for disulphide linked dimerization reside within the carboxy-terminal 151 amino acids.
J Cell Biol.
1991;113:195 30. Voorberg J, Fontijn R, van Mourik JA, Pannekoek H. Domains involved in multimer assembly of von Willebrand factor (vWF): multimerization is independant of dimerization. EMBO J. 1990;9:797[Medline] [Order article via Infotrieve].
31.
Dong ZG, Thoma RS, Crimmins DL, McCourt DW, Tuley EA, Sadler JE.
Disulfide bonds required to assemble functional von-Willebrand-factor multimers.
J Biol Chem.
1994;269:6753
32.
Wagner DD, Lawrence SO, Ohlsson-Wihelm BM, Fay PJ, Marder VJ.
Topology and order of formation of interchain disulfide bonds in von Willebrand factor.
Blood.
1987;69:27
33.
Dent JA, Berkowitz SD, Ware J, Kasper CK, Ruggeri ZM.
Identification of a cleavage site directing the immunochemical detection of molecular abnormalities in type 2A von Willebrand factor.
Proc Natl Acad Sci U S A.
1990;87:6306 34. Thomas PJ, Qu BH, Pedersen PL. Defective protein folding as a basis of human disease. Trends Biochem Sci. 1995;20:456[Medline] [Order article via Infotrieve].
35.
Le A, Steiner JL, Ferrell GA, Shaker JC, Sifers RN.
Association between calnexin and a secretion-incompetent variant of human
36.
Pind S, Riordan JR, Williams DB.
Participation of the endoplasmic reticulum chaperone in the biogenesis of the cystic fibrosis transmembrane conductance regulator.
J Biol Chem.
1994;269:12,784
37.
Chessler SD, Byers PH.
BiP binds type I procollagen pro
38.
Kim PS, Kwon OY, Arvan P.
An endoplasmic reticulum storage disease causing congenital goiter with hypothyroidism.
J Cell Biol.
1996;133:517 39. Brodsky JL, McCracken AA. ER-associated and proteasome-mediated protein degradation: how two topologically restricted events came together. Trends Cell Biol. 1997;7:151. 40. Chand S, McCraw A, Hutton R, Tuddenham EGD, Goodall AH. A two-site, monoclonal antibody-based immunoassay for von Willebrand factor: demonstration that vWF function resides in a conformational epitope. Thromb Haemost. 1986;55:318[Medline] [Order article via Infotrieve].
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  A. Casonato, E. Pontara, F. Sartorello, M.G. Cattini, P. Perutelli, A. Bertomoro, L. Gallinaro, and A. Pagnan Identifying Carriers of Type 2N von Willebrand Disease: Procedures and Significance Clinical and Applied Thrombosis/Hemostasis, April 1, 2007; 13(2): 194 - 200. [Abstract] [PDF]
|
|
|
|
 |
|
 M. H. Soteh, I. R Peake, L. Marsden, J. Anson, J. Batlle, D. Meyer, E. Fressinaud, C. Mazurier, J. Goudemand, J. Eikenboom, et al. Mutational analysis of the von Willebrand factor gene in type 1 von Willebrand disease using conformation sensitive gel electrophoresis: a comparison of fluorescent and manual techniques Haematologica, April 1, 2007; 92(4): 550 - 553. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Michaux, L. J. Hewlett, S. L. Messenger, A. C. Goodeve, I. R. Peake, M. E. Daly, and D. F. Cutler Analysis of intracellular storage and regulated secretion of 3 von Willebrand disease-causing variants of von Willebrand factor Blood, October 1, 2003; 102(7): 2452 - 2458. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Moser, O. Binder, Y. Wu, J. Aitsebaomo, R. Ren, C. Bode, V. L. Bautch, F. L. Conlon, and C. Patterson BMPER, a Novel Endothelial Cell Precursor-Derived Protein, Antagonizes Bone Morphogenetic Protein Signaling and Endothelial Cell Differentiation Mol. Cell. Biol., August 15, 2003; 23(16): 5664 - 5679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Allen, A. M. Abuzenadah, J. Hinks, J. L. Blagg, T. Gursel, J. Ingerslev, A. C. Goodeve, I. R. Peake, and M. E. Daly A novel von Willebrand disease-causing mutation (Arg273Trp) in the von Willebrand factor propeptide that results in defective multimerization and secretion Blood, July 15, 2000; 96(2): 560 - 568. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
70°C. Blood samples and plasma were shipped to Aarhus, Denmark, where the laboratory assays for
vWF antigen (vWF:Ag), ristocetin cofactor (RcoF), factor VIII:Ag, factor VIII:C and colorimetric multimer analysis were performed. Blood
samples and plasma were then shipped to Sheffield, UK, where the
mutation detection, chemiluminescent multimer analysis, and factor
VIII-binding analysis were performed. All subsequent recombinant expression experiments, including laboratory assays, chemiluminescent multimer analysis, factor VIII-binding, and pulse-chase analysis, were
performed in Sheffield, UK.
-mercaptoethanol, 100 µg/mL bovine serum
albumin (BSA), and 1.5 to 4.0 mmol/L MgCl2.
Samples were heated at 94°C for 1 minute and then subjected to 35 cycles of denaturation at 94°C for 1 minute, annealing at 50°
to 60°C for 30 seconds, and extension at 72°C for 30 seconds.
, normal plasma; 
, rVWF wild-type; 
,
Thr791Met. In 4A: 
, rVWF C788R; ×, rVWF wild-type/C788R. In
4B, 
1-antitrypsin.
J Biol Chem.
1994;269:7514