|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 6 (March 15), 2000:
pp. 2037-2043
IMMUNOBIOLOGY
A critical role for PI 3-kinase in cytokine-induced Fc -receptor
activation
Madelon Bracke,
Evert Nijhuis,
Jan-Willem J. Lammers,
Paul J. Coffer, and
Leo Koenderman
From the Department of Pulmonary Diseases, University Medical
Center, Utrecht, The Netherlands.
 |
Abstract |
Fc-receptors, such as Fc R and Fc RII, play an important role in
leukocyte activation, and rapid modulation of ligand binding ("activation") is critical for receptor regulation. We have
previously demonstrated that ligand binding to Fc-receptors on human
eosinophils is dependent on cytokine stimulation. Utilization of
pharmacological inhibitors provided evidence that the phenomenon of
interleukin (IL)-5 induced immunoglobulin A (IgA) binding to human
eosinophils requires activation of phosphatidylinositol 3-kinase
(PI3K). However, eosinophils are refractory to manipulation by
molecular techniques such as DNA transfection or viral infection. Here
we utilize an IL-3 dependent pre-B cell line to investigate the
molecular mechanism of cytokine-mediated ligand binding to Fc R. In
this system, IgA binding is dependent on IL-3, similarly to the
requirement for IL-5 of eosinophils. We show that IL-3-mediated
activation of Fc R (CD89) requires the activation of PI3K,
independent of p21ras activation. Co-expression of dominant negative
( p85) and active (p110_K227E) forms of PI3K demonstrate that the
affinity switch regulating Fc R activation requires PI3K. Moreover,
overexpression of PI3K is both necessary and sufficient for activation
of Fc R. Furthermore, we show that IL-3/IL-5/GM-CSF induced
inside-out signaling pathways activating Fc R require the involvement
of protein kinase C downstream of PI3K. Finally, we show that these inside-out signaling pathways responsible for Fc -receptor modulation require CD89, independent of its association with the FcR chain.
(Blood. 2000;95:2037-2043)
© 2000 by The American Society of Hematology.
 |
Introduction |
Transmembrane receptors specific for the Fc-region of
immunoglobulins, Fc-receptors (FcRs), play an important role in
leukocyte activation by the recognition and binding of opsonized
targets during inflammatory processes.1 Interaction of FcRs
on effector cells with immunoglobulins present on opsonized particles
triggers a variety of processes, including phagocytosis, superoxide
generation, antibody-dependent cytotoxicity, and release of
inflammatory mediators and cytokines.2 FcR function has
also been demonstrated to be involved in a variety of immune
disorders.3,4 For example, engagement of functional FcRs on
phagocytes triggers the destruction of autologous erythrocytes or
platelets in the presence of auto-antibodies directed against these cells.
FcRs exist for all five classes of human immunoglobulins. The
best-studied FcRs are the leukocyte receptors for immunoglobulin G
(IgG) (Fc R) and IgE (Fc R), due to early isolation of their genes
and the availability of anti-FcR antibodies.2,5,6 Relatively little is known about the receptors for IgA (Fc R/CD89), despite the fact that IgA is the most abundant human immunoglobulin isotype.5 IgA appears to play a critical role in protecting the host against environmental pathogens and antigens encountered at
mucosal surfaces. Failure to clear IgA complexes has been proposed to
lead to their deposition in the kidney where they are associated with
inflammation and chronic tissue damage.6 Although Fc R has been described to be expressed on many cell types, including monocytes/macrophages, neutrophils, and eosinophils,7-9 at
present little is known concerning the activation of Fc R and its functioning.
We have previously demonstrated that activation of the FcRs for IgA
(Fc R) and IgG (Fc RII) on primary human eosinophils is regulated
by Th2-derived cytokines, such as interleukin (IL)-4 and
IL-5.10,11 Cytokine stimulation leads to an
increase in ligand binding without changing the levels of receptor
expression, suggesting that stimulation with cytokines regulates either
the affinity or avidity of FcRs.10-12 Utilization of
specific pharmacological inhibitors led to the suggestion that
selective regulation of either Fc R or Fc RII on eosinophils is
dependent on cytokine-induced activation of distinct signal
transduction pathways.13 Because human eosinophils are
refractory to manipulation by molecular techniques such as DNA
transfection and viral infection, utilization of a model system was
required to further analyze the signal transduction pathways involved
in Fc R activation. Therefore, we have studied the regulation of the
human FcR for IgA (Fc R/CD89) by cytokines in a murine pre-B (Ba/F3)
model system. In addition to utilizing specific pharmacological
inhibitors, receptor mutants and dominant negative and active mutants
of critical signaling components could be analyzed in this model
system. By using Ba/F3_Fc R cells, we studied the involvement of
various signaling pathways in Fc R activation as suggested for
eosinophils. Here we show that activation of phosphatidylinositol
3-kinase (PI3K) is critical for IL-5/IL-3/GM-CSF induced Fc R
activation. Furthermore, inhibition of downstream targets of PI3K
suggests that PI3K exerts its role in Fc R modulation most likely
through activation of protein kinase C (PKC).
 |
Materials and methods |
Reagents and antibodies
Purified human serum IgA (>20 mg/mL) was obtained from Cappel
(Malvern, PA). It contained no detectable trace of IgG, IgM, or
non-immunoglobulin serum proteins. Recombinant mouse IL-3 was produced
in COS cells.14 For the detection of Fc R (CD89) with a
FACS vantage flow cytometer, we used a specific PE-conjugated monoclonal antibody A59 (A59-PE, Pharmingen). Pharmacological inhibitors wortmannin, LY294002, PD98059, and SB203580 were purchased from BioMol (Plymouth Meeting, PA). LXSN-vectors containing Ras mutants
(RasV12, RasN17, RasV12S35, and RasV12C40) and PI3K constructs (p110-K227E and p85) were a kind gift of Dr J. Downward (ICRF, London, UK).
Fc R constructs
Fc Rwt was cloned into a pMT2 vector, containing a VSV-epitope
tag. Human Fc R (in pSG513)15 was used as a template for polymerase chain reaction (PCR), using the following primers: Fc Rwt
(Fwt: GCTGTCAGCACGATGGAC and Rwt: TTCACCTCCAGGTGTTTA). A Fc R (R209D)
mutant was constructed via a two-step PCR mutagenesis: primers sets
Fwt/RR > D (GATCAAGTTCTGCGTCGT) and FR > D
(CGCAGAACTTGATCGATATGGCCGTGGCAG)/Rwt were used for the first step.
Subsequently, the products of this PCR reaction were annealed at
38°C, and a second PCR was performed with primers to Fwt/Rwt to
obtain a full-length Fc RR209D.
Generation of stable transfectants
Ba/F3 cells were cultured at a cell density of
105-106 cells/mL in RPMI 1640 supplemented with
8% Hyclone serum (Gibco) and recombinant mouse IL-3. For the
generation of polyclonal transfectants, pMT2_VSV containing Fc Rwt or
Fc RR209D were electroporated into Ba/F3 cells (0.28 V; capacitance
960 µFD) together with pSG5-CMV-Hygro containing the hygromycin
resistance gene. Cells were cultured in the presence of IL-3 and
selected in 500 µg/mL hygromycin (Boehringer Mannheim, Germany).
After 2 weeks of selection, cells were tested for Fc R expression,
and positive cells were sorted with a FACS vantage flow cytometer
(Becton & Dickinson immunocytometry systems, Mountain View, CA).
Briefly, Fc R transfected Ba/F3 cells were incubated with the
PE-conjugated monoclonal antibody A59 (A59-PE) for 30 minutes at
4°C. Fluorescence of the cells was quantified with the flow
cytometer, and A59-positive cells were sorted and cultured. Polyclonal
cell lines were generated, expressing either Fc Rwt or the
substitution mutant R209D. Ba/F3_Fc Rwt cells, expressing Fc Rwt_VSV, were subsequently used for transfection of pLXSN (neo) containing mutants of H-Ras (RasV12, RasV12C40, RasN17)16
or PI3K (p110_K227E, p85 )17,18 or for transfection of
myc-PTEN (Dijkers et al, submitted). Cells were cultured with mouse
IL-3 and 500 µg/mL G418 (Boehringer Mannheim, Germany) to select for resistance. Stable cell lines were grown continually on mIL3, G418, and
Hygromycin. Expression of Fc R was checked regularly with the flow cytometer.
IgA-binding assays
IgA-binding assays were performed either with cytokine-starved Ba/F3
cells or with purified human eosinophils. For IL-3 starvation, Ba/F3
cells were washed twice with phosphate-buffered saline and left in
medium (RPMI 1640 with 0.5% serum) without IL-3 for 4 hours. Prior to
performing a binding assay, Ba/F3 cells or purified eosinophils were
washed with Ca++-free incubation buffer containing 0.5 mmol/L ethylene glycol bis ( -amino ethylether) N, N, N', N'-tetra
acetic acid (EGTA) and brought to a concentration of 8 × 106 cells/mL. A cell suspension of 50 µL
(0.4 × 106 cells) was incubated at 37°C, with or
without cytokines. Ba/F3 cells were pre-incubated with IL-3 (1:1000; 15 minutes). Human eosinophils were stimulated with IL-5 with a final
concentration of 10 9 mol/L. After stimulation of the
cells, dynabeads coated with serum IgA (10 mg/mL) as described
previously10 were added in a ratio of 3.5 beads/cell. After
briefly mixing, the cells and beads were pelleted for 15 seconds at 100 rpm and incubated for 30 minutes at 37°C. After incubation, cells
were resuspended vigorously, and IgA binding was evaluated under a
microscope. All cells that had bound two beads or more were defined as
rosettes. One hundred cells were scored, and the number of beads that
were bound to the cells was counted. The amount of beads bound to a
total of 100 cells (bound and unbound to beads) was designated as the
rosette index.
Inhibition of IgA binding with pharmacological inhibitors or
peptides
For inhibition studies, cytokine-starved cells were pre-incubated
with specific inhibitors prior to incubation with IL-3. Cells were
incubated with PI3K inhibitors, wortmannin, or LY294002 for 15 minutes
at final concentrations of 20 nmol/L and 1 µmol/L, respectively. The
p38 inhibitor SB203580 was incubated for 15 minutes at a concentration
of 1 µmol/L, while incubation with the MEK inhibitor PD98059 was for
30 minutes at a concentration of 50 µmol/L. Rapamycin, the p70S6K
inhibitor, was incubated for 10 minutes at a concentration of 20 ng/mL.
PKC inhibitors GF109203X and Ro31-8220 were used at a concentration of
1 µmol/L for 10 minutes.
STAT5, PKB, ERK2, and p38 MAPK phosphorylation
Ba/F3 cells were washed twice with phosphate-buffered saline and
left in IL-3-depleted medium (RPMI 1640 with 0.5% serum) for 4 hours.
To investigate the effect of IL-3 stimulation on activation of STAT,
MAPK, and PI3K pathways, cells were stimulated at 37°C, for a time
course as indicated (0-30'). For detection of phosphorylation of
STAT5, ERK, p38 MAPK, or PKB, Ba/F3 cells (0.2 × 106 per condition) were washed twice in
ice-cold phosphate-buffered saline after stimulation and lyzed in lysis
buffer (1% Triton-X100, 50 mmol/L Tris-Cl, pH 8.0, 100 mmol/L NaCl)
with phosphatase inhibitors. Subsequently, 5x Laemmli sample buffer was
added, and the lysates were boiled for 5 minutes. Total cell lysates
were analyzed on 15% SDS-polyacrylamide gels. Proteins were
transferred to Immobilon-P and incubated with blocking buffer (Tris
Buffered Saline/Tween 20 supplemented with 1 mmol/L EDTA and 0.6%
bovine serum albumin) with either polyclonal phospho-STAT5
(Tyr694), phospho-p38 MAPK (Thr180/182), phospho-ERK1/2, or phospho-PKB
(Ser473) antisera (NEB). Detection was with ECL (Amersham, UK).
 |
Results |
Murine Ba/F3 cells as a model for FcR regulation
We have previously demonstrated that the IgA receptor on human
eosinophils can be regulated by cytokines, such as IL-5 and GM-CSF, to
become optimally functional.10,13,19 To
understand the mechanism by which cytokines can modulate Fc R (CD89)
function, we have utilized a model system to study FcR activation. The
murine pre-B cell line, Ba/F3, lacks CD89 expression, and these cells require IL-3 to survive, similarly to the requirement for
IL-5/IL-3/GM-CSF for human eosinophil survival. Cells transfected with
Fc R were stained with CD89 antibody (A59-PE) and sorted with a FACS
flow cytometer to obtain polyclonal cell lines expressing high levels of Fc R (CD89) (Figure 1A). To confirm
the functionality of the receptor expressed by Ba/F3 cells, we
performed IgA-binding assays as previously
described.10,13,19 Although untransfected cells did not
bind IgA-coated particles, Ba/F3_Fc R did bind IgA beads (Figure
2A). To determine whether IL-3 was
necessary for this IgA binding, comparable to IL-5 induced IgA binding
to human eosinophils, Ba/F3_Fc R cells were cytokine-deprived, and we
investigated the effect of IL-3 stimulation. As shown in Figure 2,
removal of IL-3 led to a dramatic decrease in rosette formation within
15 minutes (Figure 2B), whereas binding of IgA-coated beads is rapidly
restored after addition of IL-3 to the cytokine-starved cells (Figure
2C). These findings suggest that the "default" binding state of
the receptor is high but suppressed in unstimulated cells. Cytokine stimulation may release or overrule this suppression, switching the
receptor to a ligand-binding state. As shown in Figure 2B, this
cytokine-dependent increase of Fc R functionality was maximal within
15 minutes of IL-3 stimulation. This time course is identical to IL-5-induced IgA binding to human
eosinophils,10 thus Ba/F3_Fc R cells serve as a
model to study the molecular mechanisms of cytokine-mediated regulation
of the human Fc R.

View larger version (28K):
[in this window]
[in a new window]
| Fig 1.
FACS analysis of Fc R expression in transfected Ba/F3
cells.
In (A), expression of Fc R and a Fc R mutant, Fc R_R209D, was
analyzed by flow cytometry. In (B), the effect of co-expression of Ras,
phosphatidylinositol 3-kinase, PTEN, and gag constructs on Fc R_wt
expression was analyzed. Polyclonal stable cell lines were tested for
expression of Fc R with PE-labeled A59, a monoclonal antibody against
Fc R (CD89). Levels of Fc R expression are indicated as relative
fluorescence, and nontransfected Ba/F3 cells were used as a control in
each panel (gray line).
|
|

View larger version (16K):
[in this window]
[in a new window]
| Fig 2.
Cytokine-induced activation of Fc R in Ba/F3 cells.
Immunoglobulin A (IgA)-binding assays were performed with Ba/F3_Fc R
cells. In (A), the binding of IgA beads to Ba/F3_Fc Rwt cells was
compared with that of untransfected cells (Ba/F3). To study the effect
of interleukin 3 (IL-3) on IgA binding, cells were washed and
resuspended in IL-3-free medium with 0.5% fetal calf serum. In (B),
time points indicate the period of IL-3 withdrawal prior to performing
the assay (n = 2). In (C), the effect of IL-3 addition is shown, and
the time points indicate for how long cells were stimulated with IL-3
prior to being incubated with IgA beads (n = 3). Subsequent to
cytokine stimulation, IgA binding was performed. In all panels, results
are expressed as rosette index (number of beads/100 cells) and as
means ± SE.
|
|
IL-3 induced IgA binding requires activation of PI3K but not
MAPKs
For eosinophils, we have shown that activation of distinct signal
transduction pathways was required for specific cytokine-induced activation of different FcRs. IL-5 stimulation results in a fast activation of several signal transduction pathways in human
eosinophils, including the phosphorylation and activation of ERK2 and
p38 MAPK as well as PI3K13,20 To investigate
whether the PI3K, p38 MAPK, or ERK1/2 could be involved in the
IL-3-induced activation of Fc R on Ba/F3 cells, we first studied the
ability of IL-3 to activate these pathways. Cytokine-starved Ba/F3
cells were stimulated with IL-3, and phosphorylation of ERK1/2 and p38
MAPK was detected. As shown in Figure 3,
phosphorylation of ERK2 was already detected in unstimulated cells,
which could be slightly further increased by IL-3 stimulation.
Furthermore, IL-3 stimulation of cytokine-starved Ba/F3 cells resulted
in a rapid phosphorylation of ERK1 (Figure 3A) and p38 MAPK (Figure
3B). Detection of phosphorylated protein kinase B (PKB), a downstream
effector of PI3K, was used as a measurement for PI3K activation. As
shown in Figure 3C, IL-3 stimulation also resulted in rapid
phosphorylation of PKB, suggesting that PI3K was activated on cytokine
stimulation. To investigate the relevance of the activation of these
signaling pathways in IL-3 mediated Fc R functioning in Ba/F3 cells,
we studied the effect of specific pharmacological inhibitors on
receptor-ligand interactions. IL-3-induced binding of IgA beads to
Ba/F3_Fc R cells was not blocked by inhibitors of MAPKs (Figure
4). Ba/F3_Fc R cells incubated with
either the MEK inhibitor PD98059 (50 µmol/L), or with the p38 MAPK
inhibitor SB203580 (1 µmol/L), showed normal IgA binding after IL-3
stimulation (Figure 4). In contrast, the effect of IL-3-induced IgA
binding was completely abrogated by incubation with the PI3K
inhibitors, LY294002 and wortmannin. These findings suggest that,
although IL-3 is able to activate multiple pathways in Ba/F3 cells,
activation of PI3K, but not ERK or p38 MAP kinases, is necessary for
IL-3-induced activation of Fc R.

View larger version (41K):
[in this window]
[in a new window]
| Fig 3.
Effect of interleukin 3 (IL-3) stimulation on the
phosphorylation of ERK1/2, p38 MAPK, and protein kinase B (PKB) in
Ba/F3 cells.
Cytokine-starved Ba/F3 cells were stimulated with IL-3 for the
indicated time. After stimulation, cells (0.2 × 106
per sample) were washed with ice-cold phosphate-buffered saline, lyzed
in lysis buffer, and heated for 5 minutes after addition of 5x sample
buffer. Phosphorylation of ERK1/2 (A), p38 MAPK (B), and PKB (C) was
detected, using polyclonal anti-phospho-ERK1/2, anti-phospho-p38, or
anti-phospho-PKB antiserum for Western blotting.
|
|

View larger version (17K):
[in this window]
[in a new window]
| Fig 4.
Interleukin 3 (IL-3)-induced immunoglobulin A (IgA)
binding is inhibited by the phosphatidylinositol 3-kinase (PI3K)
inhibitors, wortmannin and LY294002.
Cytokine-starved Ba/F3_Fc R cells were pretreated for 15 minutes at
37°C with buffer, 50 µmol/L MEK inhibitor PD98059, 1 µmol/L p38
MAPK inhibitor SB203580, 20 nmol/L wortmannin, or 1 µmol/L LY294002,
and subsequently stimulated at 37°C with buffer (white bars) or
IL-3 (1:1000; gray bars) for 15 minutes. Binding of IgA beads to these
cells was measured, and results are expressed as rosette index (number
of beads/100 cells) and as means ± SE (n = 3).
|
|
Because p21ras has been demonstrated to activate multiple downstream
signaling events,21 we evaluated the role of p21ras signaling in the activation of Fc R. We stably overexpressed dominant negative and constitutively activated p21ras constructs (RasN17 and
RasV12, respectively) and studied the effect of their expression on
Fc R functioning. As shown in Figure 5A,
expression of RasV12 greatly enhanced IgA binding to levels comparable
with cytokine stimulation, and this binding could not be further
enhanced by cytokine treatment. However, overexpression of dominant
negative Ras (RasN17) only partly reduced IL-3-mediated IgA binding.
Because overexpression of p21ras is known to activate a plethora of
intracellular signaling pathways, we also used two Ras effector mutants
that have specific mutations within the amino-terminal effector domain (amino acids 32-40 in Ha-Ras), eliminating binding to specific effectors without disturbing binding to others.21 In an
activated RasV12 context, the mutants Ha-RasV12S35 and Ha-RasV12C40
retain only the ability to interact with either Raf122,23
or p110-PI3K,22,24 respectively. Stable cell lines were
generated, overexpressing either RasV12S35 or RasV12C40 (Figure 1B). As
shown in Figure 5A, the IL-3-dependent IgA binding was unaffected in
Ba/F3_Fc R (RasV12S35) cells, suggesting no role for Raf/MEK/ERK.
This finding is in line with the lack of PD98059
inhibition of IL-3-induced Fc R activation (Figure 4). In contrast,
overexpression of RasV12C40, which specifically activates PI3K
signaling, conferred cytokine-independent IgA binding. These data
suggest that enhanced IgA binding seen by overexpression of active Ras
is due to activation of PI3K and not via activation of the Raf/MEK/ERK
signaling. To determine if PI3K activation is not only necessary but
also sufficient for the cytokine-mediated regulation of Fc R
activation, we overexpressed p110K227E, a catalytic subunit mutant,
that acts as a constitutively active form of PI3K.18 As
shown in Figure 5B, overexpression of this active PI3K construct led to
an IL-3-independent activation of Fc R. Moreover, inhibition of PI3K
signaling by either co-expression of dominant negative p85 adapter
subunit17 or of the recently described PI-lipid phosphatase
PTEN25 resulted in inhibition of IL-3-mediated IgA binding
(Figure 5B).


View larger version (1229K):
[in this window]
[in a new window]
| Fig 5.
Activation of phosphatidylinositol 3-kinase (PI3K) is
critical for interleukin 3 (IL-3)-mediated immunoglobulin A (IgA)
binding.
IgA-binding studies were performed with Ba/F3_Fc R cells,
co-expressing p21ras mutants (RasV12, V12S35, V12C40, or N17) (A), PI3K
mutants (p110K227E or p85) or active PTEN (B). Cells were
cytokine-starved for 4 hours and treated with buffer (white bars) or
IL-3 (1:1000; gray bars) for 15 minutes. Binding of IgA beads to the
cells was measured, and results are expressed as rosette index (number
of beads/100 cells) and as means ± SE (n = 4). (C)
Cytokine-starved Ba/F3 stable cell lines were stimulated with or
without IL-3 for 15 minutes. After stimulation, cells
(0.2 × 106 per sample) were washed with ice-cold
phosphate-buffered saline, lyzed in lysis buffer, and heated for 5 minutes after addition of 5x sample buffer. Phosphorylation STAT5 was
detected, using polyclonal anti-phospho-STAT5 (Tyr694) antiserum for
Western blotting.
|
|
To be sure that the effects observed by co-transfection of active and
dominant negative signaling molecules was not simply due to an
aspecific block in IL-3 signaling in general, we analyzed the
phosphorylation of STAT5 by IL-3 in the various cell lines. As is
clearly demonstrated in Figure 5C, there was no effect on IL-3-induced
STAT5 tyrosine phosphorylation in the various cell lines utilized,
arguing against any aspecific modulation of IL-3 signal transduction in
these Ba/F3 lines.
Downstream targets of PI3K involved in IL-3-induced Fc R
activation
We further investigated which pathway(s) downstream of PI3K could be
involved in the IL-3-induced Fc R activation. Known targets of PI3K
are p70 S6 Kinase (p70S6K),26 PKB,27 and PKC
isoforms.28,29 We excluded PKB as a major
effector of PI3K-mediated Fc R activation, since overexpression of
active or dominant negative PKB-mutants did not influence IgA binding
(data not shown). A role for p70S6K in Fc R stimulation is also
unlikely, since inhibition of p70S6K activation by rapamycin did not
affect IgA binding to Ba/F3_Fc R (Figure
6). Interestingly, however, treatment with
either GF109203X or RO31-8220 resulted in a decreased IgA binding to
IL-3-stimulated cells (Figure 6A). Furthermore, these PKC inhibitors
also blocked the binding of IgA beads to Ba/F3_Fc R (p110_K227E)
cells (Figure 6B), suggesting that activation of PKC downstream of PI3K
is necessary for Fc R activation.

View larger version (11K):
[in this window]
[in a new window]
| Fig 6.
Inhibition of protein kinase C (PKC) results in abolished
immunoglobulin A (IgA) binding on interleukin 3 (IL-3) stimulation.
IL-3-starved Ba/F3_Fc R (A) or Ba/F3_Fc R (p110K227E) cells (B)
were pretreated for 10 minutes with buffer (white), p70S6K inhibitor
rapamycin (20 ng/mL; gray), or PKC inhibitors GF109203X (1µmol/L;
black) or Ro-31-8220 (1µmol/L; arched) and subsequently incubated
with or without IL-3 for 15 minutes. Binding of IgA beads to these
cells was measured, and results are expressed as rosette index (number
of beads/100 cells) and as means ± SE (n = 3).
|
|
IL-3-mediated regulation of Fc R does not involve the FcR -chain
It is clear that the activation of PI3K and PKC is critical for
Fc R activation by cytokines. Fc R has been shown to be associated with a FcR -chain homodimer,30,31 and it is suggested
that formation of Fc R/ chain complex is necessary for Fc R
functioning.32 Although the short intracellular domain of
Fc R does not contain any known signaling motifs, the FcR chain
contains specific immunoreceptor tyrosine-based activation motifs that
might be essential for Fc R-mediated signal transduction. The
association between Fc R and FcR occurs via a positively charged
arginine in the predicted transmembrane domain of Fc R.30
To rule out the possibility that the cytokine-mediated activation of
Fc R occurs via the FcR chain, which is present on Ba/F3 cells
(not shown), we constructed a cell line expressing a Fc R_R > D
mutant. In this mutant, the positively charged arginine (Arg209) in the
transmembrane region of Fc R was substituted by a negatively charged
aspartic acid, resulting in a Fc R mutant that cannot associate with
the FcR -chain homodimer.30 As shown in Figure
7, stimulation with IL-3 leads to
comparable levels of IgA binding to both cells expressing the wild type
Fc R or Ba/F3_Fc R-R > D cells. Therefore, association of Fc R
with the FcR chain is not necessary for cytokine-induced modulation
of the receptor, suggesting that the PI3K-mediated mechanism by which IL-3/IL-5/GM-CSF regulate Fc R functioning specifically requires the
Fc chain.

View larger version (14K):
[in this window]
[in a new window]
| Fig 7.
Interleukin 3 (IL-3)-induced Fc R activation is
independent of association with the Fc-receptor (FcR) chain.
The effect of cytokine stimulation on immunoglobulin A (IgA) binding
was investigated in Ba/F3 cells expressing the Fc R_R209D mutant,
which is unable to interact with the FcR chain. Cells were
cytokine-starved for 4 hours and treated for 15 minutes with IL-3 (gray
bars) or left untreated (white bars), and subsequently IgA-binding
assays were performed. Binding of IgA beads was scored under a
microscope, and results are expressed as rosette index (number of
beads/100 cells) and as means ± SE (n = 3).
|
|
 |
Discussion |
FcRs are present on both lymphoid- and myeloid-derived hematopoietic
cells and provide a crucial link between the humoral and cellular
branches of the immune system. Activation of FcRs on inflammatory
effector cells results in the triggering of immune responses. It is
known that immunoglobulins are potent triggers of granulocyte
activation, and binding of immunoglobulin to FcRs results in the
activation of cellular responses such as degranulation, respiratory
burst, and antibody-dependent
cytotoxicity.12,33 Inappropriate activation
of human granulocytes can lead to local tissue damage of the
respiratory epithelium and airway hyperresponsiveness as observed
during allergic inflammatory reactions. Because uncontrolled activation
of effector cells can be deleterious, regulation of cellular activation
is crucial for correct functioning of the immune system. Cytokines,
such as interleukins, are important mediators of cellular activation,
and it has been described for human eosinophils that cytokines are
involved in the regulation of many effector functions (reviewed in
34).
For the FcRs for IgA (Fc R) and IgG (Fc RII), we have previously
shown that binding of immunoglobulin-coated targets to FcRs on
eosinophils is dependent on cytokine stimulation of the
cells.10,13,19 Although the FcRs on eosinophils do not bind
monomeric ligand, the functional status of both Fc R and Fc RII for
complexed ligand is altered by Th2-derived cytokines such as IL-5.
Because this cytokine-mediated modulation is very rapid,10
this switch is not likely to be due to de novo receptor synthesis.
Moreover, analysis by flow cytometer revealed that levels of receptor
expression on the membrane are not altered by cytokine
stimulation11 (unpublished results).
In this study, we have utilized Ba/F3 cells as a model to study the
molecular mechanism of cytokine-induced ligand binding to Fc R
(CD89). In contrast with other cell lines commonly used for FcR
studies, such as the murine pre-B IIA1.6 cells, Ba/F3_Fc R cells
interact with IgA-coated targets in a cytokine-dependent fashion,
providing an excellent system to study FcR regulation. In addition to
the utilization of pharmacological inhibitors, overexpression of
dominant negative or constitutively active signaling molecules has made
it possible to analyze the involvement of specific signaling pathways
in IL-3-mediated inside-out signaling regulating Fc R. We demonstrate
that overexpression of active Ras (V12) can enhance Fc R
dramatically. In contrast, ectopic expression of dominant negative
RasN17 can only partially inhibit IL-3-induced IgA binding (Figure 5A),
suggesting that activation of p21ras is sufficient but not necessary to
activate Fc R. This finding is in line with the
observation that incubation with the MEK inhibitor PD98059 did not
influence IL-3-stimulated IgA binding. Therefore, activation of the
Ras/Raf/ERK pathway is not required to mediate IL-3-induced Fc R
regulation. Indeed, utilization of specific activated p21ras effector
mutants (RasV12S35 via Raf1 and RasV12C40 via PI3K) revealed that
p21ras-mediated Fc R activation occurs only when p21ras can activate
PI3K (Figure 4A). The p110 catalytic subunit of PI3K has been described
as a direct target of p21ras,21 whereby the level of PI3K
activity obtained by direct p21ras stimulation is dependent on the
p110-isoform.35 Interaction of PI3K with p21ras probably
targets p110 to the membrane, allowing access to phospholipid
substrates. However, PI3K activation is not wholly dependent on p21ras,
since recruitment to the membrane can also occur via translocation of
the regulatory p85 subunit to phosphotyrosine residues of protein
tyrosine kinase receptors36 or via G subunits to
G-protein coupled receptors. Because p21ras is not the only intermediate utilized to activate PI3K, it explains the observation that RasN17 only partially inhibited IL-3-induced IgA binding.
In addition to pharmacologically inhibiting PI3K activation and
overexpression of constitutively active and dominant negative forms of
PI3K, we also analyzed the effect of ectopically expressing the
recently identified phosphatidylinositol lipid phosphatase PTEN.25 This phosphatase has been shown to dephosphorylate
the 3-phospholipid products of PI3K, thus counteracting the lipid kinase, but not the protein kinase activity of PI3K and preventing activation of downstream targets. Indeed, blocking the PI3K pathway by
inhibitors or by overexpression of either the dominant negative p85
or PTEN completely abolished the effect of IL-3 on IgA binding. These
data indeed demonstrate PI3K is necessary for IL-3-stimulated Fc R
function. Moreover, activation of PI3K is sufficient for Fc R
activation, since expression of a constitutively active p110_K227E results in a functional Fc R. Because PTEN counteracts the lipid, but
not the protein kinase activity, it suggests that the production of
3-phospholipids is involved in the Fc R activation.
On activation of PI3K at the membrane, downstream targets can be
recruited to the membrane and activated by phosphorylation. PI3,4,5P3-dependent kinases are direct targets
of PI3K-generated products and are responsible for the phosphorylation
of recruited PI3K effectors, including PKB27 and p70 S6
Kinase (p70S6K).26 Also activation of PKC isoforms have
recently been described to be activated by
PI3,4,5P3-dependent kinases,28,29
including Ca++-independent PKCs (PKC / / ) and the
atypical PKC .37 PI3K-mediated Fc R regulation appears
to require activation of a PKC isoform and not PKB or p70S6 kinase,
since IgA binding was not influenced by overexpression of active or
negative PKB mutants (not shown) nor by incubation with rapamycin
(Figure 6). However, PKC inhibitors RO31-8220 and GF109203X did inhibit
the cytokine-induced IgA binding (Figure 6). Moreover, these PKC
inhibitors also inhibit the IgA binding to Ba/F3_Fc R
(p110_K227E) cells (Figure 6, right panel), suggesting that activation
of PKC downstream of PI3K indeed is required for IL-3-induced Fc R activation.
Mechanisms of Fc R activation by cytokines may include regulation of
Fc R via direct activation on the receptor, including processes such
as phosphorylation, conformational changes, or association with
additional proteins involved in signal transduction. An alternative
explanation would suggest indirect activation of Fc R, when
activation of PI3K-PKC results in the phosphorylation or cytoskeletal
reorganization, leading to clustering or activation of FcRs. Also,
regulation of Fc R activation might occur via the associated
-chain homodimer. Because the FcR chain could be detected on
Ba/F3 cells (unpublished observations), it needed to be investigated
whether cytokine-mediated Fc R activation relied on the association
with this subunit. Substitution of the transmembrane residue 209R to an
aspartic acid prevents Fc R to associate with the chain.30 As shown in Figure 7, cytokine-dependent IgA binding to a cell line expressing Fc R_R209D was similar to binding to Fc R. These data suggested that an interaction with the chain is not critical for cytokine-induced ligand binding. Therefore, it is
likely that the induction of IgA binding via IL-3-induced inside-out
signaling is mediated via the Fc R, while FcR is likely to be
critical for ligand-induced outside-in signaling of Fc R. This is the
first publication demonstrating a critical role for the Fc chain
(CD89) in the regulation of ligand binding.
Cytokine-induced inside-out signaling switches Fc R to an active
state and subsequent ligand binding will lead to FcR chain mediated
outside-in signaling, resulting in cell activation. In this way,
leukocytes can respond very rapidly and efficiently on their
environment, a process that requires tight regulation. A greater
understanding of cytokine-mediated modulation of FcR functioning on
leukocytes will generate insight into the regulation of leukocyte
activation and the pathogenesis of inflammation, possibly providing
novel therapeutic options.
 |
Acknowledgments |
The authors would like to thank Pascale Dijkers for generating the PTEN
constructs and critically reading the manuscript, Jan van der Linden
and Deon Kanters for assistance with the FACS and cell sorting, and
Julian Downward for the Ras and PI3K constructs.
 |
Footnotes |
Submitted July 9, 1999; accepted November 17, 1999.
Supported by a research grant of the Netherlands Asthma Foundation (AF
94.44).
Reprints: L. Koenderman, Dept. of Pulmonary Diseases, F02.333,
University Medical Centre, Heidelberglaan 100 3584 CX Utrecht, The
Netherlands; e-mail: L.Koenderman{at}hli.azu.nl.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
 |
References |
1.
van de Winkel JG, Anderson CL.
Biology of human immunoglobulin G Fc receptors.
J Leukoc Biol.
1991;49:511[Medline]
[Order article via Infotrieve].
2.
Ravetch JV, Kinet JP.
Fc receptors.
Annu Rev Immunol.
1991;9:457[Medline]
[Order article via Infotrieve].
3.
Gessner JE, Heiken H, Tamm A, Schmidt RE.
The IgG Fc receptor family.
Ann Hematol.
1998;76:231[Medline]
[Order article via Infotrieve].
4.
Hulett MD, Hogarth PM.
Molecular basis of Fc receptor function.
Adv Immunol.
1994;57:1[Medline]
[Order article via Infotrieve].
5.
Mestecky J, McGhee JR.
Immunoglobulin A (IgA): molecular and cellular interactions involved in IgA biosynthesis and immune response.
Adv Immunol.
1987;40:153[Medline]
[Order article via Infotrieve].
6.
Mestecky J, Tomana M, Czerkinsky C, et al.
IgA-associated renal diseases: immunochemical studies of IgA1 proteins, circulating immune complexes, and cellular interactions.
Semin Nephrol.
1987;7:332[Medline]
[Order article via Infotrieve].
7.
Maliszewski CR, Shen L, Fanger MW.
The expression of receptors for IgA on human monocytes and calcitriol-treated HL-60 cells.
J Immunol.
1985;135:3878[Abstract].
8.
Monteiro RC, Kubagawa H, Cooper MD.
Cellular distribution, regulation, and biochemical nature of an Fc alpha receptor in humans.
J Exp Med.
1990;171:597[Abstract/Free Full Text].
9.
Monteiro RC, Hostoffer RW, Cooper MD, Bonner JR, Gartland GL, Kubagawa H.
Definition of immunoglobulin A receptors on eosinophils and their enhanced expression in allergic individuals.
J Clin Invest.
1993;92:1681.
10.
Bracke M, Dubois GR, Bolt K, et al.
Differential effects of the T helper cell type 2-derived cytokines IL-4 and IL-5 on ligand binding to IgG and IgA receptors expressed by human eosinophils.
J Immunol.
1997;159:1459[Abstract].
11.
Koenderman L, Hermans SW, Capel PJ, van de Winkel JG.
Granulocyte-macrophage colony-stimulating factor induces sequential activation and deactivation of binding via a low-affinity IgG Fc receptor, hFc gamma RII, on human eosinophils.
Blood.
1993;81:2413[Abstract/Free Full Text].
12.
Weisbart RH, Kacena A, Schuh A, Golde DW.
GM-CSF induces human neutrophil IgA-mediated phagocytosis by an IgA Fc receptor activation mechanism.
Nature.
1988;332:647[Medline]
[Order article via Infotrieve].
13.
Bracke M, Coffer PJ, Lammers JW, Koenderman L.
Analysis of signal transduction pathways regulating cytokine-mediated Fc receptor activation on human eosinophils.
J Immunol.
1998;161:6768[Abstract/Free Full Text].
14.
Caldenhoven E, van Dijk T, Raaijmakers JA, Lammers JW, Koenderman L, de Groot RP.
Activation of the STAT3/acute phase response factor transcription factor by interleukin-5.
J Biol Chem.
1995;270:25,778[Abstract/Free Full Text].
15.
van Dijk TB, Bracke M, Caldenhoven E, et al.
Cloning and characterization of Fc alpha Rb, a novel Fc alpha receptor (CD89) isoform expressed in eosinophils and neutrophils.
Blood.
1996;88:4229[Abstract/Free Full Text].
16.
Rodriguez-Viciana P, Warne PH, Khwaja A, et al.
Role of phosphoinositide 3-OH kinase in cell transformation and control of the actin cytoskeleton by Ras.
Cell.
1997;89:457[Medline]
[Order article via Infotrieve].
17.
Dhand R, Hara K, Hiles I, et al.
PI 3-kinase: structural and functional analysis of intersubunit interactions.
EMBO J.
1994;13:511[Medline]
[Order article via Infotrieve].
18.
Rodriguez-Viciana P, Warne PH, Vanhaesebroeck B, Waterfield MD, Downward J.
Activation of phosphoinositide 3-kinase by interaction with Ras and by point mutation.
EMBO J.
1996;15:2442[Medline]
[Order article via Infotrieve].
19.
Koenderman L, Kok PT, Hamelink ML, Verhoeven AJ, Bruijnzeel PL.
An improved method for the isolation of eosinophilic granulocytes from peripheral blood of normal individuals.
J Leukoc Biol.
1988;44:79[Abstract].
20.
Coffer PJ, Schweizer RC, Dubois GR, Maikoe T, Lammers JW, Koenderman L.
Analysis of signal transduction pathways in human eosinophils activated by chemoattractants and the T-helper 2-derived cytokines interleukin-4 and interleukin-5.
Blood.
1998;91:2547[Abstract/Free Full Text].
21.
Rodriguez-Viciana P, Warne PH, Dhand R, et al.
Phosphatidylinositol-3-OH kinase as a direct target of Ras.
Nature.
1994;370:527[Medline]
[Order article via Infotrieve].
22.
Khosravi-Far R, White MA, Westwick JK, et al.
Oncogenic Ras activation of Raf/mitogen-activated protein kinase-independent pathways is sufficient to cause tumorigenic transformation.
Mol Cell Biol.
1996;16:3923[Abstract/Free Full Text].
23.
White MA, Nicolette C, Minden A, et al.
Multiple Ras functions can contribute to mammalian cell transformation.
Cell.
1995;80:533[Medline]
[Order article via Infotrieve].
24.
Joneson T, White MA, Wigler MH, Bar-Sagi D.
Stimulation of membrane ruffling and MAP kinase activation by distinct effectors of RAS.
Science.
1996;271:810[Abstract].
25.
Maehama T, Dixon JE.
The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate.
J Biol Chem.
1998;273:13,375[Abstract/Free Full Text].
26.
Proud CG.
p70 S6 kinase: an enigma with variations.
Trends Biochem Sci.
1996;21:181[Medline]
[Order article via Infotrieve].
27.
Coffer PJ, Jin J, Woodgett JR.
Protein kinase B (c-Akt): a multifunctional mediator of phosphatidylinositol 3-kinase activation.
Biochem J.
1998;335:1.
28.
Chou MM, Hou W, Johnson J, et al.
Regulation of protein kinase C zeta by PI 3-kinase and PDK-1.
Curr Biol.
1998;8:1069[Medline]
[Order article via Infotrieve].
29.
Le Good JA, Ziegler WH, Parekh DB, Alessi DR, Cohen P, Parker PJ.
Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1.
Science.
1998;281:2042[Abstract/Free Full Text].
30.
Morton HC, van den Herik-Oudijk IE, Vossebeld P, et al.
Functional association between the human myeloid immunoglobulin A Fc receptor (CD89) and FcR gamma chain. Molecular basis for CD89/FcR gamma chain association.
J Biol Chem.
1995;270:29,781[Abstract/Free Full Text].
31.
Pfefferkorn LC, Yeaman GR.
Association of IgA-Fc receptors (Fc alpha R) with Fc epsilon RI gamma 2 subunits in U937 cells. Aggregation induces the tyrosine phosphorylation of gamma 2.
J Immunol.
1994;153:3228[Abstract].
32.
Kinet JP.
The gamma-zeta dimers of Fc receptors as connectors to signal transduction.
Curr Opin Immunol.
1992;4:43[Medline]
[Order article via Infotrieve].
33.
Abu-Ghazaleh RI, Fujisawa T, Mestecky J, Kyle RA, Gleich GJ.
IgA-induced eosinophil degranulation.
J Immunol.
1989;142:2393[Abstract].
34.
Coffer PJ, Koenderman L.
Granulocyte signal transduction and priming: cause without effect?
Immunol Lett.
1997;57:27[Medline]
[Order article via Infotrieve].
35.
Rubio I, Rodriguez-Viciana P, Downward J, Wetzker R.
Interaction of Ras with phosphoinositide 3-kinase gamma.
Biochem J.
1997;326:891.
36.
McGlade CJ, Ellis C, Reedijk M, et al.
SH2 domains of the p85 alpha subunit of phosphatidylinositol 3-kinase regulate binding to growth factor receptors.
Mol Cell Biol.
1992;12:991[Abstract/Free Full Text].
37.
Toker A, Meyer M, Reddy KK, et al.
Activation of protein kinase C family members by the novel polyphosphoinositides PtdIns-3,4-P2 and PtdIns-3,4,5-P3.
J Biol Chem.
1994;269:32,358[Abstract/Free Full Text].

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. E. Bakema, A. Bakker, S. de Haij, H. Honing, M. Bracke, L. Koenderman, G. Vidarsson, J. G. J. van de Winkel, and J. H. W. Leusen
Inside-Out Regulation of Fc{alpha}RI (CD89) Depends on PP2A
J. Immunol.,
September 15, 2008;
181(6):
4080 - 4088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. C. Boyle, N. F. Brown, J. H. Brumell, and B. B. Finlay
Src homology domain 2 adaptors affect adherence of Salmonella enterica serovar Typhimurium to non-phagocytic cells
Microbiology,
October 1, 2007;
153(10):
3517 - 3526.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Myou, A. R. Leff, S. Myo, E. Boetticher, A. Y. Meliton, A. T. Lambertino, J. Liu, C. Xu, N. M. Munoz, and X. Zhu
Activation of Group IV Cytosolic Phospholipase A2 in Human Eosinophils by Phosphoinositide 3-Kinase Through a Mitogen-Activated Protein Kinase-Independent Pathway
J. Immunol.,
October 15, 2003;
171(8):
4399 - 4405.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhu, B. Jacobs, E. Boetticher, S. Myou, A. Meliton, H. Sano, A. T. Lambertino, N. M. Munoz, and A. R. Leff
IL-5-induced integrin adhesion of human eosinophils caused by ERK1/2-mediated activation of cPLA2
J. Leukoc. Biol.,
November 1, 2002;
72(5):
1046 - 1053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Pilette, Y. Ouadrhiri, V. Godding, J-P. Vaerman, and Y. Sibille
Lung mucosal immunity: immunoglobulin-A revisited
Eur. Respir. J.,
September 1, 2001;
18(3):
571 - 588.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. D. Wines, C. T. Sardjono, H. M. Trist, C.-S. Lay, and P. M. Hogarth
The Interaction of Fc{{alpha}}RI with IgA and Its Implications for Ligand Binding by Immunoreceptors of the Leukocyte Receptor Cluster
J. Immunol.,
February 1, 2001;
166(3):
1781 - 1789.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bracke, E. van de Graaf, J.-W. J Lammers, P. J Coffer, and L. Koenderman
In vivo priming of Fc{alpha}R functioning on eosinophils of allergic asthmatics
J. Leukoc. Biol.,
November 1, 2000;
68(5):
655 - 661.
[Abstract]
[Full Text]
|
 |
|
|
|