| |
|
|
|
|
|
|
|||
|
Blood, Vol. 95 No. 6 (March 15), 2000:
pp. 2098-2103
NEOPLASIA
From the Max Delbrück Center for Molecular Medicine,
Berlin-Buch, Germany; Department of Internal Medicine,
Robert-Rössle-Klinik, University Medical Center Charité,
Humboldt University of Berlin, Berlin, Germany; and Institute of
Immunology, University of Munich, Munich, Germany.
Although bispecific antibodies directed against malignant lymphoma
have been shown to be effective in vitro and in vivo, extended clinical
trials so far have been hampered by the fact that conventional approaches to produce these antibodies suffer from low yields, ill-defined byproducts, or laborious purification procedures. To
overcome this problem, we have generated a small, recombinant, lymphoma-directed, bispecific single-chain (bsc) antibody according to
a novel technique recently described. The antibody
consists of 2 different single-chain Fv fragments joined by a
glycine-serine linker. One specificity is directed against the CD3
antigen of human T cells, and the other antigen-binding site engages
the pan-B-cell marker CD19, uniformly expressed on the vast majority of B-cell malignancies. The construct was expressed in Chinese hamster
ovary cells and purified by its C-terminal histioline tag. Specific
binding to CD19 and CD3 was demonstrated by fluorescence-activated cell
sorter analysis. By redirecting unstimulated primary human T cells
derived from the peripheral blood against CD19-positive lymphoma cells,
the bscCD19 × CD3 antibody showed significant cytotoxic activity at
very low concentrations of 10 to 100 pg/mL and at effector to target
cell ratios as low as 2:1. Moreover, strong
lymphoma-directed cytotoxicity at low antibody concentrations was
rapidly induced during 4 hours even in experiments without any T-cell
prestimulation. Thus, this particular antibody proves to be much more
efficacious than the bispecific antibodies described until now.
Therefore, the described bscCD19 × CD3 molecule should be a
suitable candidate to prove the therapeutic benefit of bispecific antibodies in the treatment of non-Hodgkin lymphoma.
(Blood. 2000;95:2098-2103)
The overall survival of patients with high-grade
non-Hodgkin lymphoma has been increased considerably over recent years
by the introduction of high-dose chemotherapy as primary treatment. Nevertheless, about 50% of the patients ultimately succumb to their
tumor.1-3 Moreover, patients with low-grade non-Hodgkin lymphoma, such as chronic lymphatic leukemia and mantle cell lymphoma, are still incurable. This bleak situation has stimulated the search for
alternative therapeutic strategies, among which antibodies against
B-lymphocyte differentiation antigens are playing an increasing role.
Through the International Leukocyte Differentiation Workshops, these CD
antigens are well defined as to their lineage specificity and overall
tissue distribution. In addition, because most of the antigens have
been cloned, their structures and functions are well known. Among them,
CD19 holds an eminent place as a functional receptor molecule on B
lymphocytes. With the important exception of stem cells, it is
expressed by virtually all developmental stages of B-cell lineage,
including mature B lymphocytes.4,5 Thus far, CD19
antibodies have been used in various forms for in vitro and in vivo
therapeutic studies.4,6-14 Considerable effort also has
been spent on the bispecific-antibody approach by joining 2 different
antigen-binding sites in 1 antibody molecule to redirect effector cells
to the predefined tumor target. Although bispecific antibodies are
extremely efficient in recruiting cytotoxic effector cells against
tumor cells in vitro and in vivo,15-19 larger randomized
clinical trials as a final test of efficacy are still lacking. The main
reason why these interesting antibody constructs are dramatically
lagging behind intact antibodies in clinical testing is the difficulty
in producing sufficient amounts of clinical-grade material. Until
recently, the production and purification process has been extremely
inefficient, with low yields, regardless of whether the
hybrid-hybridoma approach, chemical linkage, or renaturation from
bacterial inclusion bodies of recombinant Fab or Fv fragment was
followed. In addition, nearly all of these procedures are plagued by
contamination with ill-defined byproducts.15,16,20-23
As previously shown with a bsc17-1A × CD3 antibody, these
handicaps can be overcome by the development of a molecular format linking 4 variable regions in the configuration
VL1-VH1-VH2-VL2 on 1 peptide chain.24-26 The resulting recombinant 60-kd
molecule produced by mammalian cells is secreted at high yield in a
fully active form that requires no further renaturation. This small and
compact molecule with 1 of the antigen-binding sites directed against
the CD3 molecule induces remarkable and fast T-cell cytotoxicity against epithelial tumor cells without any intentional prestimulation and costimulation. Therefore, the attempt was warranted to apply the
same strategy for the generation of a bscCD19 × CD3 construct for a therapeutic trial in patients with B-cell lymphomas.
Cloning of variable (V) immunoglobulin domains
Construction of bispecific single-chain fragments and eukaryotic
expression
List of primers Primers were as follows: 5'L1: GAAGCACGCGTAGATATCG/TTG(AC)T(GC)ACCCAA(TA)CTCCA; 3'K: GAAGATGGATCCAGCGGCCGCAGCATCAGC; 5'H1: CAGCCGGCCATGGCGCAGGT(CG)CAGCTGCAG(CG)AG; 3'G: ACCAGGGGCCAGTGGATAGACAAGCTTGGGTGTCGTTTT; 5'VLB5RRV: AGGTGTACACTCCGATATCCAGCTGACCCAGTCTCCA; 3'VLGS15: GGAGCCGCCGCCGCCAGAACCACCACCACCTTTGATCTCGAGCTTGGTCCC; 5'VHGS15: GGCGGCGGCGGCTCCGGTGGTGGTGGTTCTCAGGT(GC)(AC)A(AG)CTGCAG(GC)AGTC(AT)GG; 3'VHBspE1: AATCCGGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG.Purification The bsc antibody (Ab) was purified via its C-terminal H tail by affinity chromatography on a nickel-nitrilotriacetic acid (Ni-NTA) column (Qiagen, Hilden, Germany), as described previously.24Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analysis SDS-PAGE was carried out according to Laemmli31 with a 12% gel for analyzing the purification of the bsc-Ab. For immunoblotting, standard procedures were applied. For detection of the bsc-Ab, we used a monoclonal anti-HisTag antibody (Dianova, Hamburg, Germany). Blots were developed with the Enhanced Chemiluminescence (ECL) system (Amersham, Braunsweig, Germany).Flow cytometric analysis A total of 1 × 106 cells were washed with phosphate-buffered saline (PBS), resuspended in 200 µL PBS with 10% Venimmun (Centeon, Marburg, Germany) and 0.1% NaN3, and incubated for 30 minutes at 4°C. After centrifugation (100 × g, 5 minutes), the cells were incubated in 50 µL bscCD19 × CD3 (200 µg/mL in PBS with 10% Venimmun and 0.1% NaN3) for 30 minutes at 4°C. The cells were washed twice with PBS. For detection of the bsc-Ab, a fluorescein isothiocyanate (FITC)-conjugated antibody against the His-tag (Dianova, Hamburg, Germany) was used. Either the irrelevant bsc17-1A × CD3, produced by the same expression system as bscCD19 × CD3, or the His-tag antibody alone served as negative controls. Flow cytometry was performed with fluorescence-activated cell sorter analysis (FACScan, Becton Dickinson, Heidelberg, Germany).Cell lines The CD19-positive B-cell lines Daudi, Raji, BJAB (Burkitt lymphoma), SKW6.4 (human Epstein-Barr virus-transformed B cell), and Blin-1 (pre-B-cell line) were used in flow cytometric analysis and chromium-release assays. Jurkat is a CD3-positive T-cell line; the plasmacytoma cell lines NCI and L363 are negative for both surface molecules, CD3 and CD19. Cell lines were cultured in complete RPMI 1640 (Biochrom, Berlin, Germany) with 10% fetal calf serum (FCS) (GIBCO, Karlsruhe, Germany).Induction of T-cell proliferation Proliferation of unstimulated human peripheral blood mononuclear cells (PBMCs), after the addition of either phytohemagglutinin (PHA, Roche, Pensberg, Germany) + interleukin (IL)-2 (Chiton, Ratingen, Germany) (as positive control) or bispecific antibodies, was measured in a standard 3H-thymidine proliferation assay. Ninety-six-well flat-bottom plates were incubated with 250 µL PBS containing 10% FCS per well for 2 hours at 37°C. The plates were washed, and freshly isolated human PBMCs (1 × 106 cells/mL) were added in a volume of 180 µL to each well, containing 20 µL of different antibodies or PHA + IL-2. As controls, the same PBMCs depleted of B cells were used (B-cell depletion by Dynabeads M-450 CD19 [Dynal, Hamburg, Germany] according to the manufacturer's protocol). After 24 hours' incubation at 37°C, 5% CO2, 20 µL of 3H-thymidine was added to each well. Cells were incubated for an additional 16 hours at 37°C, 5% CO2. The cells were then harvested and assayed for incorporated 3H-thymidine in a TopCount (Canberra Packard, Dreieich, Germany). Tests were carried out in triplicate.Cytotoxicity assay Human PBMCs were isolated from fresh buffy coats of random donors using Lymphoprep (Nycomed, Oslo, Norway) gradient centrifugation with subsequent 100g centrifugation steps to remove thrombocytes. CD19-positive B cells were depleted using Dynabeads M-450 CD19 (Dynal). The depleted cell populations were analyzed by flow cytometry (FACScan; Becton Dickinson), which showed 99% depletion of CD19-positive cells. The PBMCs were incubated overnight at 37°C, 5% CO2 leading to the adherence of monocytes. CD19-positive B-cell lines (Raji, Blin I, Daudi, BJAB, and SKW6.4) were used as target cells.
Western blot analysis Purification of bscCD19 × CD3 from the supernatant of transfected CHO cells yielded 4 mg per liter culture supernatant. The bsc-Ab was eluted from the Ni-NTA column as a distinct peak at a concentration of 200 mmol/L imidazole. The results of Western blot analysis show the expected size of the bsc-Ab at 60 kd (Figure 1A).
Binding properties Binding specificities of the bsc-Ab to CD3 and CD19 were shown by flow cytometric analysis on CD3-positive Jurkat cells, human PBLs, and a number of different CD19-positive B-cell lymphoma cell lines, including Blin-1, SKW6.4, Daudi, BJAB, and Raji. No binding was detectable on the plasmacytoma cell line L363, which expresses neither CD19 nor CD3 (Figure 1B).Induction of T-cell proliferation in the presence of autologous B cells In a standard 3H-thymidine proliferation assay, the bscCD19 × CD3 induced proliferation of unstimulated primary human T cells only in the presence of autologous B cells. In a T-cell population depleted of B cells by immunomagnetic beads, the bscCD19 × CD3 exerted almost no proliferative stimulus. The proliferation in response to PHA and IL-2 was defined as 100%. Almost no proliferation was seen in the medium control and with the irrelevant bsc17-1A × CD3 (Figure 2A).
Cytotoxic activity against CD19-positive lymphoma cell lines The bscCD19 × CD3 antibody proved to be highly cytotoxic for several lymphoma cell lines in a 51Cr-release assay. As a control, a bsc-Ab with different tumor specificity (bsc17-1A × CD3) showed lysis activity not significantly above medium background, although generated by the same system as the bscCD19 × CD3 antibody (Figure 2B). To approximate the in vivo conditions, we used unstimulated PBLs from healthy donors as effector cells. Rapid induction of cytotoxicity within 4 hours was observed without T-cell prestimulation. In addition, no cytotoxic activity was observed using the plasmacytoma cell lines NCI and L363 as target cells, neither of which expresses CD19 (Figure 3C). In competition assays using increasing amounts of the CD19-specific parental monoclonal antibody HD37 or the CD3-specific monoclonal antibody OKT-3, cytotoxic activity of the bscCD19 × CD3 was completely blocked (Figures 3B, 3C). A CD22-specific monoclonal antibody did not affect the bscCD19 × CD3-mediated cytotoxicity (data not shown). These experiments show that bscCD19 × CD3-mediated cytotoxic effects are antigen specific. To obtain more information on the molecular mechanisms of target cell killing, we tried to block bscCD19 × CD3-mediated cytotoxicity by EGTA. Cytotoxic activity induced by bscCD19 × CD3 was completely blocked by EGTA (data not shown), indicating that lysis is mediated by T cells (probably through the perforin pathway) rather than through a direct (eg, apoptosis-inducing) effect of the antibody itself. Consistent with this observation is the finding that isolated CD8 T cells containing preformed cytolytic granules accounted for the rapid cytotoxic effect, whereas CD4 T cells remained largely inactive during the 4-hour incubation (Figure 4A).
Other bispecific CD19 × CD3 antibodies, retargeting cytotoxic T cells at lymphoma cells, have already been shown to be effective in vitro,6,7,9-11,14 in animal models,8,33,34 and in first clinical trials.12,35,36 Those antibodies, however, were constructed either by hybrid-hybridoma techniques or by chemical linkage,37 which yield only low amounts of clinical-grade material. Therefore, it is not surprising that more extended clinical studies are still lacking. The new technique developed previously relies on the production of recombinant bispecific single-chain antibodies in mammalian cells, which circumvents the above mentioned difficulties.24 The CD19 × CD3 single-chain antibody described here was isolated to high purity from the culture supernatant of transfected CHO cells. The molecule with the 4 V-regions tightly packed (B. Steipe, unpublished results) showed several unexpected properties. (1) It induced high lymphoma-directed T-cell cytotoxicity at ultra-low concentrations (10-100 pg/mL), requiring E-T ratios of 4:1 and 2:1 only, which is in contrast to other CD19 × CD3 antibodies produced by the hybrid-hybridoma technique, which require concentrations of several nanograms per milliliter.6-8,32 Whether this surprisingly high activity is due to the peculiar anti-CD3 antibody or to the unique structure of the single-chain molecule still needs to be clarified. (2) At the indicated low concentrations, the lymphoma-directed cytotoxicity was triggered without any detectable prestimulation or costimulation of T cells. In contrast, the previously published CD19 × CD3 bispecific antibodies all require prestimulation.6-8,32 In the case of 1 other conventional CD19 × CD3 antibody, a somewhat similar effect was obtained, albeit at much higher concentrations (100 ng/mL) and with E-T ratios of 27:1.9 In addition, that antibody also depended on a 24-hour preincubation with T cells. This is in stark contrast to the rapid onset of cytotoxicity detected within 4 hours after the addition of our bispecific construct. We are not aware of a similar behavior of other bispecific antibodies. The recently described anti-p185HER2/anti-CD3 bispecific F(ab)2 antibody also required 24 hours of prestimulation with T cells and IL-2.19 Similarly, a bispecific CD19 × CD3 diabody38 needed prestimulation of the T cells with a highly mitogenic anti-CD3 antibody in the presence of IL-2 and diabody concentrations of 0.25 µg/mL or 2.5 µg/mL.
Submitted August 5, 1999; accepted November 15, 1999.
A.L. and P.K. contributed equally to this work.
Reprints: Peter Kufer, Institute of Immunology, University of Munich, Goethestrasse. 31, D-80336 München, Germany; e-mail: kufer{at}ifi.med.uni-muenchen.de.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1. Urba WJ, Duffey PL, Longo DL. Treatment of patients with aggressive lymphomas: an overview. J Natl Cancer Inst Monogr. 1990;10:29-37.
2.
Gianni AM, Bregni M, Siena S, et al.
High-dose chemotherapy and autologous bone marrow transplantation compared with MACOP-B in aggressive B-cell lymphoma.
N Engl J Med.
1997;336:1290-1297 3. Fisher RI. Treatment of aggressive non-Hodgkin lymphomas. Lessons from the past 10 years. Cancer. 1994;74:2657-2661[Medline] [Order article via Infotrieve]. 4. Haagen IA, van de Griend R, Clark M, Geerars A, Bast B, de Gast B. Killing of human leukaemia/lymphoma B cells by activated cytotoxic T lymphocytes in the presence of a bispecific monoclonal antibody (alpha CD3/alpha CD19). Clin Exp Immunol. 1992;90:368-375[Medline] [Order article via Infotrieve].
5.
Uckun FM, Ledbetter JA.
Immunobiologic differences between normal and leukemic human B-cell precursors.
Proc Natl Acad Sci U S A.
1988;85:8603-8607
6.
Bohlen H, Hopff T, Manzke O, et al.
Lysis of malignant B cells from patients with B-chronic lymphocytic leukemia by autologous T cells activated with CD3 × CD19 bispecific antibodies in combination with bivalent CD28 antibodies.
Blood.
1993;82:1803-1812
7.
Bohlen H, Manzke O, Patel B, et al.
Cytolysis of leukemic B-cells by T-cells activated via two bispecific antibodies.
Cancer Res.
1993;53:4310-4314
8.
Bohlen H, Manzke O, Titzer S, et al.
Prevention of Epstein-Barr virus-induced human B-cell lymphoma in severe combined immunodeficient mice treated with CD3 × CD19 bispecific antibodies, CD28 monospecific antibodies, and autologous T cells.
Cancer Res.
1997;57:1704-1709 9. Haagen IA, de Lau WB, Bast BJ, Geerars AJ, Clark MR, de Gast BC. Unprimed CD4+ and CD8+ T cells can be rapidly activated by a CD3 × CD19 bispecific antibody to proliferate and become cytotoxic. Cancer Immunol Immunother. 1994;39:391-396[Medline] [Order article via Infotrieve].
10.
Haagen IA, Geerars AJ, de Lau WB, et al.
Killing of autologous B-lineage malignancy using CD3 × CD19 bispecific monoclonal antibody in end stage leukemia and lymphoma.
Blood.
1994;84:556-563
11.
Haagen IA, Geerars AJ, de Lau WB, Bast BJ, de Gast BC.
The efficacy of CD3 × CD19 bispecific monoclonal antibody (BsAb) in a clonogenic assay: the effect of repeated addition of BsAb and interleukin-2.
Blood.
1995;85:3208-3212 12. Haagen IA. Performance of CD3 × CD19 bispecific monoclonal antibodies in B cell malignancy. Leuk Lymphoma. 1995;19:381-393[Medline] [Order article via Infotrieve]. 13. Weiner GJ, De Gast GC. Bispecific monoclonal antibody therapy of B-cell malignancy. Leuk Lymphoma. 1995;16:199-207[Medline] [Order article via Infotrieve]. 14. Csoka M, Strauss G, Debatin KM, Moldenhauer G. Activation of T cell cytotoxicity against autologous common acute lymphoblastic leukemia (cALL) blasts by CD3 × CD19 bispecific antibody. Leukemia. 1996;10:1765-1772[Medline] [Order article via Infotrieve].
15.
Staerz UD, Bevan MJ.
Hybrid hybridoma producing a bispecific monoclonal antibody that can focus effector T-cell activity.
Proc Natl Acad Sci U S A.
1986;83:1453-1457 16. Lanzavecchia A, Scheidegger D. The use of hybrid hybridomas to target human cytotoxic T lymphocytes. Eur J Immunol. 1987;17:105-111[Medline] [Order article via Infotrieve]. 17. Nitta T, Sato K, Yagita H, Okumura K, Ishii S. Preliminary trial of specific targeting therapy against malignant glioma. Lancet. 1990;335:368-371[Medline] [Order article via Infotrieve]. 18. Kroesen BJ, ter Haar A, Spakman H, et al. Local antitumour treatment in carcinoma patients with bispecific-monoclonal-antibody-redirected T cells. Cancer Immunol Immunother. 1993;37:400-407[Medline] [Order article via Infotrieve]. 19. Zhu Z, Lewis GD, Carter P. Engineering high affinity humanized anti-p185HER2/anti-CD3 bispecific F(ab')2 for efficient lysis of p185HER2 overexpressing tumor cells. Int J Cancer. 1995;62:319-324[Medline] [Order article via Infotrieve]. 20. Mallender WD, Ferreira ST, Voss EJ, Coelho ST. Inter-active-site distance and solution dynamics of a bivalent-bispecific single-chain antibody molecule. Biochemistry. 1994;33:10,100-10,108[Medline] [Order article via Infotrieve].
21.
Mallender WD, Voss EJ.
Construction, expression, and activity of a bivalent bispecific single-chain antibody.
J Biol Chem.
1994;269:199-206 22. Kostelny SA, Cole MS, Tso JY. Formation of a bispecific antibody by the use of leucine zippers. J Immunol. 1992;148:1547-1553[Abstract]. 23. Gruber M, Schodin BA, Wilson ER, Kranz DM. Efficient tumor cell lysis mediated by a bispecific single chain antibody expressed in Escherichia coli. J Immunol. 1994;152:5368-5374[Abstract].
24.
Mack M, Riethmuller G, Kufer P.
A small bispecific antibody construct expressed as a functional single-chain molecule with high tumor cell cytotoxicity.
Proc Natl Acad Sci U S A.
1995;92:7021-7025 25. Kufer P, Mack M, Gruber R, Lutterbuse R, Zettl F, Riethmuller G. Construction and biological activity of a recombinant bispecific single-chain antibody designed for therapy of minimal residual colorectal cancer. Cancer Immunol Immunother. 1997;45:193-197[Medline] [Order article via Infotrieve]. 26. Mack M, Gruber R, Schmidt S, Riethmuller G, Kufer P. Biologic properties of a bispecific single-chain antibody directed against 17-1A (EpCAM) and CD3: tumor cell-dependent T cell stimulation and cytotoxic activity. J Immunol. 1997;158:3965-3970[Abstract]. 27. Pezzutto A, Dorken B, Rabinovitch PS, Ledbetter JA, Moldenhauer G, Clark EA. CD19 monoclonal antibody HD37 inhibits anti-immunoglobulin-induced B cell activation and proliferation. J Immunol. 1987;138:2793-2799[Abstract].
28.
Orlandi R, Gussow DH, Jones PT, Winter G.
Cloning immunoglobulin variable domains for expression by the polymerase chain reaction.
Proc Natl Acad Sci U S A.
1989;86:3833-3837 29. Dübel S, Breitling F, Fuchs P, et al. Isolation of IgG antibody Fv-DNA from various mouse and rat hybridoma cell lines using the polymerase chain reaction with a simple set of primers. J Immunol Methods. 1994;175:89-95[Medline] [Order article via Infotrieve]. 30. Traunecker A, Lanzavecchia A, Karjalainen K. Bispecific single chain molecules (Janusins) target cytotoxic lymphocytes on HIV infected cells. EMBO J. 1991;10:3655-3659[Medline] [Order article via Infotrieve]. 31. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680-685[Medline] [Order article via Infotrieve]. 32. Bohlen H, Manzke O, Engert A, et al. Differentiation of cytotoxicity using target cells labelled with europium and samarium by electroporation. J Immunol Methods. 1994;173:55-62[Medline] [Order article via Infotrieve].
33.
Daniel PT, Kroidl A, Kopp J, et al.
Immunotherapy of B-cell lymphoma with CD3 × 19 bispecific antibodies: costimulation via CD28 prevents "veto" apoptosis of antibody-targeted cytotoxic T cells.
Blood.
1998;92:4750-4757 34. Demanet C, Brissinck J, Moser M, Leo O, Thielemans K. Bispecific antibody therapy of two murine B-cell lymphomas. Int J Cancer Suppl. 1992;7:67-68[Medline] [Order article via Infotrieve]. 35. De Gast GC, Van Houten AA, Haagen IA, et al. Clinical experience with CD3 × CD19 bispecific antibodies in patients with B cell malignancies. J Hematother. 1995;4:433-437[Medline] [Order article via Infotrieve]. 36. Weiner GJ, Kostelny SA, Hillstrom JR, et al. The role of T cell activation in anti-CD3 × antitumor bispecific antibody therapy. J Immunol. 1994;152:2385-2392[Abstract].
37.
Anderson PM, Crist W, Hasz D, Carroll AJ, Myers DE, Uckun FM.
G19.4(alpha CD3) × B43(alpha CD19) monoclonal antibody heteroconjugate triggers CD19 antigen-specific lysis of t(4;11) acute lymphoblastic leukemia cells by activated CD3 antigen-positive cytotoxic T cells.
Blood.
1992;80:2826-2834 38. Kipriyanov SM, Moldenhauer G, Strauss G, Little M. Bispecific CD3 × CD19 diabody for T cell- mediated lysis of malignant human B cells. Int J Cancer. 1998;77:763-772[Medline] [Order article via Infotrieve].
39.
Hartmann F, Renner C, Jung W, et al.
Treatment of refractory Hodgkin's disease with an anti-CD16/CD30 bispecific antibody.
Blood.
1997;89:2042-2047 40. Valone FH, Kaufman PA, Guyre PM, et al. Clinical trials of bispecific antibody MDX-210 in women with advanced breast or ovarian cancer that overexpresses HER-2/neu. J Hematother. 1995;4:471-475[Medline] [Order article via Infotrieve].
41.
Valone FH, Kaufman PA, Guyre PM, et al.
Phase Ia/Ib trial of bispecific antibody MDX-210 in patients with advanced breast or ovarian cancer that overexpresses the proto-oncogene HER-2/neu.
J Clin Oncol.
1995;13:2281-2292
42.
Canevari S, Stoter G, Arienti F, et al.
Regression of advanced ovarian carcinoma by intraperitoneal treatment with autologous T lymphocytes retargeted by a bispecific monoclonal antibody.
J Natl Cancer Inst.
1995;87:1463-1469 43. Bolhuis RL, Lamers CH, Goey SH, et al. Adoptive immunotherapy of ovarian carcinoma with bs-MAb-targeted lymphocytes: a multicenter study. Int J Cancer Suppl. 1992;7:78-81[Medline] [Order article via Infotrieve].
44.
Yokota T, Milenic DE, Whitlow M, Schlom J.
Rapid tumor penetration of a single-chain Fv and comparison with other immunoglobulin forms.
Cancer Res.
1992;52:3402-3408 45. Davis T, Levy R, White CA, et al. Retreatments with Rituxan (rituximab, IDEC-C2B8) have significant efficacy, do not cause HAMA and are viable minimally toxic alternatives in relapsed or refractory non-Hodgkin's lymphoma (NHL). Blood. 1997;90, 10(Suppl 1, Part 1):509a. Abstract 2269.
| ||||||||||
![]() |
M. Amann, K. Brischwein, P. Lutterbuese, L. Parr, L. Petersen, G. Lorenczewski, E. Krinner, S. Bruckmeier, S. Lippold, R. Kischel, et al. Therapeutic Window of MuS110, a Single-Chain Antibody Construct Bispecific for Murine EpCAM and Murine CD3 Cancer Res., January 1, 2008; 68(1): 143 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Hammond, R. Lutterbuese, S. Roff, P. Lutterbuese, B. Schlereth, E. Bruckheimer, M. S. Kinch, S. Coats, P. A. Baeuerle, P. Kufer, et al. Selective Targeting and Potent Control of Tumor Growth Using an EphA2/CD3-Bispecific Single-Chain Antibody Construct Cancer Res., April 15, 2007; 67(8): 3927 - 3935. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Natsume, M. Wakitani, N. Yamane-Ohnuki, E. Shoji-Hosaka, R. Niwa, K. Uchida, M. Satoh, and K. Shitara Fucose Removal from Complex-Type Oligosaccharide Enhances the Antibody-Dependent Cellular Cytotoxicity of Single-Gene-Encoded Bispecific Antibody Comprising of Two Single-Chain Antibodies Linked to the Antibody Constant Region J. Biochem., September 1, 2006; 140(3): 359 - 368. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schlereth, I. Fichtner, G. Lorenczewski, P. Kleindienst, K. Brischwein, A. da Silva, P. Kufer, R. Lutterbuese, I. Junghahn, S. Kasimir-Bauer, et al. Eradication of Tumors from a Human Colon Cancer Cell Line and from Ovarian Cancer Metastases in Immunodeficient Mice by a Single-Chain Ep-CAM-/CD3-Bispecific Antibody Construct Cancer Res., April 1, 2005; 65(7): 2882 - 2889. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Grosse-Hovest, S. Muller, R. Minoia, E. Wolf, V. Zakhartchenko, H. Wenigerkind, C. Lassnig, U. Besenfelder, M. Muller, S. D. Lytton, et al. Cloned transgenic farm animals produce a bispecific antibody for T cell-mediated tumor cell killing PNAS, May 4, 2004; 101(18): 6858 - 6863. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-B. Wang, B.-F. Zhao, Q. Zhao, J.-H. Piao, J. Liu, Q. Lin, and H.-L. Huang A New Recombinant Single Chain Trispecific Antibody Recruits T Lymphocytes to Kill CEA (Carcinoma Embryonic Antigen) Positive Tumor Cells In Vitro Efficiently J. Biochem., April 1, 2004; 135(4): 555 - 565. [Abstract] [Full Text] [PDF] |
||||