|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 6 (March 15), 2000:
pp. 2150-2156
PHAGOCYTES
Recombination events between the p47-phox
gene and its highly homologous pseudogenes are the main cause of
autosomal recessive chronic granulomatous disease
Joachim Roesler,
John T. Curnutte,
Julie Rae,
David Barrett,
Pablo Patino,
Stephen J. Chanock, and
Agnes Goerlach
From the Department of Immunology, Genentech Inc, South San
Francisco, CA; The Scripps Research Institute, Department of
Molecular and Experimental Medicine, La Jolla, CA; the Pediatric
Oncology Branch, National Cancer Institute, National Institutes of
Health, Bethesda, MD; and the University of Antioquia School of
Medicine, Medellin, Colombia, South America.
 |
Abstract |
Chronic granulomatous disease (CGD) is an inherited disease caused
by defects in the superoxide-generating nicotinamide adenine dinucleotide phosphate (NADPH) oxidase of phagocytes. Genetic lesions
in any of 4 components of this antimicrobial enzyme have been detected.
Family-specific mutations are found in 3 of 4 forms of CGD due to
deficiencies of the gp91-phox, p22-phox, and
p67-phox genes. In p47-phox-deficient CGD (autosomal
recessive form A47°) patients, a GT deletion ( GT) at the
beginning of exon 2 of the p47-phox gene has been reported in
19 of 20 alleles. This GT deletion is also characteristic for the
recently identified p47-phox pseudogenes. To explore a possible
link between these findings, a sequence analysis of 28 unrelated,
racially diverse A47° CGD patients and 37 healthy individuals was
performed. The GT deletion in exon 2 was present on all alleles in 25 patients. Only 3 patients but all healthy individuals contained the
GTGT and GT sequences. A total of 22 patients carried additional
pseudogene-specific intronic sequences on all alleles, either only in
intron 1 or in intron 1 and intron 2, which lead to different types of
chimeric DNA strands. It is concluded that recombination events between the p47-phox gene and its highly homologous pseudogenes result in the incorporation of GT into the p47-phox gene, thereby
leading to the high frequency of GT deletion in A47° CGD patients.
(Blood. 2000;95:2150-2156)
© 2000 by The American Society of Hematology.
| |
Introduction |
Phagocytic cells play a central role in the cellular
host defense system due to their ability to release large amounts of superoxide in the respiratory burst upon stimulation with bacterial toxins and other reagents. The subsequent conversion of superoxide to
toxic oxygen radical derivatives, such as hydrogen peroxide, hydroxyl
radicals, and hypochlorous acid, is critical for microbicidal activity.1 The multicomponent enzyme nicotinamide adenine
dinucleotide phosphate (NADPH) oxidase is largely responsible for this
antimicrobial defense system.2 Upon activation, the
cytosolic factors p47-phox and p67-phox and the low
molecular weight GTP-binding protein Rac translocate to the membrane,
where they associate with the 2 membrane-bound subunits of cytochrome
b558, p22-phox and gp91-phox.3-7 This allows
electron flux from NADPH via the flavin-containing heme protein to
molecular oxygen leading to the generation of superoxide.8,9 Recently an additional protein, p40-phox, was identified, and it associates with p47-phox and p67-phox in a
240-kd preformed complex within the cytoplasm of neutrophils under resting conditions.10 This newly identified protein
may have a negative regulatory role on NADPH oxidase
function.11
The essential role of NADPH oxidase in cellular host defense is clearly
demonstrated by patients suffering from a rare inherited disorder known
as chronic granulomatous disease (CGD).12 Due to genetic
lesions affecting any of the 4 components, gp91-phox, p22-phox, p47-phox, or p67-phox, phagocytes
from CGD patients are unable to generate superoxide upon
stimulation.13,14 Typically, these patients
suffer from recurrent and life-threatening bacterial and fungal
infections.15 The study of patients with CGD has highlighted the functional importance of each of the 4 NADPH oxidase components and has led to the identification of their respective gene
structure. In turn, this has permitted analysis of individual patients
and provided insight into the molecular genetics of each subtype of CGD.
Mutations in the X-linked gp91-phox gene, leading to functional
impairment or complete loss of gp91-phox, account for
approximately 60% of all CGD cases. A spectrum of mutations
distributed over the gp91-phox gene has been reported including
insertions, substitutions, or deletions within exons, at splice
junctions, or within the 5' upstream regulatory
region.13,16-18 In contrast to this
heterogeneous group of patients, in the second most common form of CGD
(autosomal recessive form A47° CGD), which accounts for 25%-30%
of all cases, the lack of functional p47-phox is caused by an unusually
uniform mutation pattern. A single defect in the p47-phox gene,
such as a GT deletion ( GT) at the beginning of exon 2, which
predicts for a premature stop codon at amino acid 51, has been
identified in 19 of 20 alleles reported to date.19-21
Remarkably, these A47° CGD patients were unrelated and of different
racial backgrounds.
Several hypotheses have been raised to explain this peculiarity. The
hypotheses mainly focus on the tandem repeat at the beginning of exon 2 and the surrounding sequence, which could represent a mutational hot
spot for either DNA strand slippage or the formation of hair pin
loops.18-21 However, these speculations do not sufficiently explain the unusually high frequency of GT in A47° CGD patients.
We reported the presence of at least 1 duplicated copy of the
p47-phox pseudogene, which localizes to the identical region of
chromosome 7q11.23 as the p47-phox gene.22
Hockenhull et al23 have established that there are 2 copies
of the highly homologous pseudogene in this region. The possibility
exists that there might be 3 or more copies in selected individuals. By
definition, all pseudogenes contain GT at the beginning of exon 2, exactly at the same position as is found in A47° CGD patients. The
aim of this study was to elucidate a probable relationship between the
high frequency of detecting only the GT in nearly all A47° CGD
patients and the closely linked p47-phox pseudogenes. We
performed a genomic sequence analysis of exon 2 in a series of 28 A47° CGD patients and a group of 37 healthy individuals. In
addition we concentrated on characterizing previously identified
pseudogene markers in intron 1 and intron 2 in our cohort of 28 A47° CGD patients and looking for possible sites or patterns of
recombination. Our findings provide strong evidence that the high
frequency of GT in A47° CGD patients is due to recombination
events between the gene and pseudogenes.
| |
Materials and methods |
Patient samples
A total of 28 A47° CGD patients from 28 racially divergent
families was studied. Blood samples were obtained from CGD patients and
family members by one of the investigators (J.T.C.). Procedures and
consent forms were approved by the Committees on the Protection of
Human Subjects Research of the Scripps Research Institute (La Jolla,
CA) and the Stanford University School of Medicine (Stanford, CA).
Neutrophils from these patients did not contain p47-phox by Western
blot analysis. The control group comprised 37 healthy individuals
representing a comparable racial mix.
Polymerase chain reaction
Genomic DNA from A47° CGD patients and control donors was
isolated from whole blood stored in ethylenediaminetetraacetic acid (EDTA) using a DNA extractor (Applied Biosystems, Foster City, CA).
Similarly, genomic DNA from 6 chimpanzees and 1 rhesus monkey was
obtained by standard methods. Oligonucleotide primers were synthesized
(DNA synthesizer Model 394, Applied Biosystems). Polymerase chain
reaction (PCR) using 100 ng genomic DNA as a template was performed in
100-µL reactions containing the following: 5 µL
20 × PCR buffer with 670 mmol/L Tris-HCl (tris[hydroxymethyl]
aminomethane hydrochloride; pH 8.8), 67 mmol/L MgCl2
(magnesium dichloride), 166 mmol/L
(NH4)2SO4, and 1.7 µL/µL BSA
(bovine serum albumin); 0.5 mmol/L dNTP (nucleoside
5'-triphosphate) mix (Pharmacia, Piscataway, NJ); 5% DMSO
(dimethyl sulfoxide) (Sigma Chemical, St. Louis, MO); and 5 ng of each
primer (Table 1). DNA was denatured at 98°C for 7 minutes prior to the addition of 1 unit Thermus
aquaticus (Taq) polymerase (Boehringer Mannheim,
Indianapolis, IN). PCR was performed (GeneAmp 9600 thermal cycler;
Perkin Elmer, Norwalk, CT) for 30 cycles using the following
amplification conditions: 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 45 seconds followed by an extension at
72°C for 7 minutes.
View this table:
[in this window]
[in a new window]
|
Table 1.
Oligonucleotide primers for exon 2 and the flanking
intronic regions of the p47-phox gene and its
pseudogene(s)
|
|
Sequencing
Cycle sequencing was performed using an fmol DNA cycle
sequencing system (Promega, Madison, WI). Oligonucleotide primers (82.5 ng) were labeled in an 11-µL reaction containing 1 µL
32P  ATP (adenosine 5'-triphosphate;
22.2×1013 Bq/mmol [6000 Ci/mmol]) (DuPont), 1 µL
10 × T4 polynucleotide kinase buffer containing 500 mmol/L
Tris-HCl (pH 8.3), 100 mmol/L MgCl2, 50 mmol/L
dithiothreitol, and 1 mmol/L spermidine; and 1 µL T4 polynucleotide
kinase (equal to 1 unit). The reaction was run for 30 minutes at
37°C and stopped at 90°C for 2 minutes. Genomic DNA was
amplified by PCR as described above, and an aliquot of 2.5 µL from
the first 100-µL PCR reaction was amplified with a set of nested
primers under identical conditions. PCR fragments were purified over
microcon 100 filters (Amicon, Beverly, MA) by centrifuging
at 500g for 10 minutes. The eluate (1 µL) was diluted in a 100 µL
solution of 10 mmol/L Tris-HCl (pH 8.3) and 1 mmol/L EDTA. The eluate
was then precipitated with 260 µL ethanol and 7.3 µL 3 M ammonium acetate at  80°C for 10 minutes. The precipitate
was centrifuged for 12 minutes at 16 000g at 4°C. The pellet was
vacuum dried, dissolved in 14.5 µL 5 × sequencing buffer (250 mmol/L Tris-HCl [pH 9] and 10 mmol/L MgCl2), and then
mixed with 5 units sequencing grade Taq polymerase and 2.5 µL
labeled sequencing primer. Aliquots of this mixture (4 µL) were added
to 2 µL of each d/ddNTP. After an initial denaturing step at 95°C for 1 minute, 30 cycles were performed of the
following: 95°C for 20 seconds, 42°C for 20 seconds, and
70°C for 30 seconds, and a 7-minute extension at 72°C completed
the process. Stop solution (3 µL) provided with the kit was used to
terminate each reaction. The samples were heated at 72°C for 2 minutes, immediately chilled on ice, and then loaded on an 8%
denaturing polyacrylamide gel. Electrophoresis was performed with a
constant current of 50 W in 1 × Tris-borate/EDTA (TBE).
Sequencing gels were vacuum dried, and autoradiography was performed
overnight at 70°C.
Single-strand configuration polymorphism analysis
Single-strand configuration polymorphism (SSCP) analysis of each of
the 11 exons of the p47-phox gene was performed using amplicons
generated by nested intronic primers according to the standard
protocol, as described previously, but with only 15 cycles. Oligonucleotide primers (1 µg) were labeled in a 5-µL reaction containing 6.105 MBq (165 µCi) 32P ATP
(DuPont), 0.5 µL 10 × T4 polynucleotide kinase buffer, and
0.6 units T4 polynucleotide kinase by incubation for 30 minutes at
37°C. The reaction was stopped at 90°C for 2 minutes, and 10 µL H2O were added. Using the conditions
described previously, 1 µL primary PCR product was reamplified for 30 cycles with the following: 0.5 µL 20 × PCR buffer, 0.2 µL 10 mmol/L dNTP, 1 µL of each labeled sense and antisense
oligonucleotide, 0.25 units Taq polymerase, and 6.3 µL
H2O. The labeled PCR products were diluted 1:50 in SSCP gel
loading buffer containing 20 mmol/L EDTA, 0.1% SDS, 0.04% xylene
cyanol, and 0.4% Bromophenol blue dissolved in formamide. After
denaturation at 80°C for 5 minutes, samples were loaded on a 4.9%
acrylamide/1% bis-acrylamide gel in 0.5 × TBE containing 5%
glycerol and 0.05% ammonium persulfate and then electrophoresed in
0.5 × TBE at 35 W for 3 hours while cooling the gel. After the
gels were vacuum dried, autoradiography was performed overnight at
70°C.
Reverse transcriptase-polymerase chain reaction
Poly(A)-RNA was isolated from 107-108
peripheral lymphocytes and/or monocytes or Epstein-Barr
virus-transformed (EBV-transformed) B cell
lines derived from healthy individuals and patients (FastTrack kit;
Invitrogen, San Diego, CA) according to the manufacturer's instructions. Briefly, the cells were lysed with the provided buffer,
and poly(A)-RNA was isolated by binding to oligo(dT) cellulose. After 2 washing steps with high and low salt buffers (to remove DNA, proteins,
cell debris, and nonpolyadenylated RNA), RNA was eluted under nonsalt
conditions, precipitated, dissolved in ribonuclease-free (RNase-free)
H2O, and stored at 70°C until used. Reverse
transcriptase-PCR (RT-PCR) was performed (Strata Script RT-PCR kit;
Stratagene, La Jolla, CA) according to the manufacturer's
instructions. In a 59-µL reaction, 20-200 µg poly(A)-RNA was
reverse transcribed with 50 units of RNase H reverse transcriptase
using random primers to generate first-strand complimentary DNA (cDNA).
PCR amplification of first-strand cDNA (1µL) was followed by
sequence analysis using the same conditions described above for genomic
DNA. For this analysis, the following nested primers were used:
(1) 2 from exon 1: 5'-ATGGGGGACACCTTCATCCGTCACA and
5'-TCGCCCTGCTGGGCTTTGAGAAGCGC, (2) 1 from exon 9:
5'-CGTTGGGCCTGGGACACGTCTTG, and (3) 1 from the 3'UTR:
5'-CGTCCAGACGCCAGGCTCTATAC.
Restriction analysis
Restriction digest analysis was performed in a 10-µL reaction
using 1-µL labeled PCR products of either genomic or cDNA material amplified with nested primers (as described above). The following enzymes were used in each reaction: 5 units Bsp
1407l (MBI Ferments, Buffalo, NY) and 2.5 units Aci1 or
1.5 units DraIII (New England Bolas, Beverly, MA). Commercially
available buffers supplied by the manufacturers were used for
restriction digestion at 37°C for 3 hours. The reaction products
were analyzed by electrophoresis on a 4.9% acrylamide/1%
bis-acrylamide gel in 0.5 × TBE containing 5% glycerol and
0.05% ammonium persulfate.
| |
Results |
Genomic DNA derived from a total of 28 A47° CGD patients and 37 healthy donors was analyzed following nested amplification (Table 1
primers) of the region flanking and including exon 2 (Figures
1 and 2). Because the
p47-phox wild type gene and pseudogenes are highly homologous
in exonic and intronic regions, DNA strands from wild-type genes and
pseudogenes were necessarily coamplified. Indeed, consistent with
previous findings,22 sequence analysis of these PCR
products revealed that all 37 healthy donors contained both wild-type
gene and pseudogene sequences. In 25 of the 28 CGD patients, on the
other hand, only the GT characteristically found in the pseudogenes
was detected on all alleles (Figures 2 and
3). The remaining 3 patients had both the
GT and wild-type GTGT sequences. SSCP analysis of exon 2 showed that
all A47° CGD patients with GT/GT sequences were lacking a
band seen in all normal controls who had both the GTGT and GT
sequence (Figure 4). There were no
consistent differences observed in the other 10 exons of the
p47-phox gene, which suggests that SSCP is a reliable method to
screen for GT/GT sequences in A47° CGD patients. In addition,
these data were confirmed by restriction analysis with Bsp
1407I, an enzyme known to digest only the wild type GTGT sequences (not shown). However, this latter method is complicated by heteroduplex formation between the p47-phox gene and pseudogene DNA strands, which cannot be cut.
View larger version (4K):
[in this window]
[in a new window]
| Fig 1.
Localization of oligonucleotide primers.
The arrows indicate the position and direction of the primers used to
amplify exon 2 and the flanking intronic regions.
|
|
View larger version (85K):
[in this window]
[in a new window]
| Fig 2.
Sequence analysis of the intron 1/exon 2 border of the
p47-phox gene.
Genomic DNA derived from a normal donor and an A47° CGD patient was
amplified using primers 2LA, 2LB, 2RC, and 2RD. The PCR product
contained the 3' end of intron 1 (small letters) and the 5'
end of exon 2 (capital letters). The position of the GT deletion is
marked as GT.
|
|
View larger version (21K):
[in this window]
[in a new window]
| Fig 3.
Distribution of p47-phox wild-type
and pseudogene markers.
The distribution of wild-type-specific (w) and pseudogene-specific (p)
sequence markers is shown at each sequence location in intron 1, exon
2, and intron 2 in a total of 28 A47° CGD patients, 37 healthy
donors, 6 chimpanzees, and 1 rhesus monkey. Intron 2 could not be
amplified in the primates with human primers, and the CG sequence was
not conserved in the rhesus monkey.
|
|
View larger version (123K):
[in this window]
[in a new window]
| Fig 4.
SSCP of PCR amplified genomic DNA strands of exon 2.
SSCP was performed on genomic DNA samples from normal donors (n1, n2,
and n3) and A47° CGD patients (p1, p2, and p3) using the nested
primer pairs 2LA/2LB and 2RC/2RD. The amplification products containing
the 3' end of intron 1 and the 5' end of exon 2 were
electrophoresed on a nondenaturing polyacrylamide gel. The figure shows
a typical SSCP analysis, where the diagnostic band (>) was
missing in all patients carrying GT.
|
|
Because the transcript for the p47-phox gene is detected in all
normal controls, we analyzed the p47-phox transcripts in
A47° CGD patients.22 Sequence analysis of cDNA derived
from samples of 12/25 GT/GT patients confirmed the importance of
the GT sequence; it was seen exclusively in each of the 12 patients
analyzed, which indicates that the GT transcript is highly expressed
(Figure 5). In cDNA samples derived from
mononuclear white blood cells (n = 5) or EBV-transformed B
cells (n = 2) from healthy donors, the GTGT and the GT sequences
were always detected. This is consistent with our previous findings
that at least 1 p47-phox pseudogene is
transcribed.22 Restriction digestion with DraIII,
which only recognizes the wild type cDNA sequence
(CACNNN/GTG),22 confirmed the sequence analysis (data not
shown). Taken together, these findings demonstrate that the majority of
A47° CGD patients investigated in this study had only the
p47-phox pseudogene sequence in exon 2 at the genomic and
messenger RNA (mRNA) levels.
View larger version (68K):
[in this window]
[in a new window]
| Fig 5.
Sequence analysis of the exon 1/exon 2 border of
p47-phox.
cDNA from an A47° CGD patient and a normal donor was PCR amplified
and sequenced. The position of the GT deletion is marked as GT.
|
|
In control and A47° CGD patients with only the GT/GT, we
analyzed the flanking regions of exon 2, in intron 1 and intron 2, looking for specific sequence differences between the gene and the
pseudogenes previously characterized.22 We concentrated on
2 sites: (1) intron 1, where there is a CG in the wild type gene and TG
in the pseudogenes, 122-base pair (bp) upstream from the 5' end
of exon 2, and (2) a 20-bp duplication in the pseudogenes but not the
wild-type gene, 176-bp downstream from the 5' end of intron 2. As
predicted in all control samples, both the wild-type gene and the
pseudogene sequences in intron 1 (Figure
6) and intron 2 (Figure 7)
were detected easily. In 22 of the 28 CGD patients, only the pseudogene
marker TG in intron 1 was detected in all alleles, whereas in 6 patients both CG and TG were seen (Figure 6). Restriction digestion
with Aci1, which specifically cuts the wild type C/CGC
sequence, was consistent with the sequence analysis (data not shown).
View larger version (83K):
[in this window]
[in a new window]
| Fig 6.
Identification of the "pseudogene marker" TG in
intron 1.
Genomic DNA from a normal individual (n) and an A47° CGD patient
(p) was amplified using the primers 1LA, 1LB, 2RC, and 2RD. The PCR
products contained the 3' end of intron 1 and the entire exon 2. In the patient sample, only the "pseudogene marker" TG located in
intron 1 122-bp upstream from the 5' end of exon 2 is present.
The normal individual typically showed both sequences, the wild type CG
and the pseudogene TG (arrow). Sequence analysis of the antisense DNA
strand or restriction analysis with Aci1 (c/cgc) confirmed
these data (not shown).
|
|
View larger version (69119K):
[in this window]
[in a new window]
| Fig 7.
Sequence analysis of the 5' region of intron 2.
(A) Genomic DNA from healthy individuals (n1 and n2) and A47° CGD
patients (p1 and p2) was amplified using the primers 2LA, 2LB, 2RA, and
2RB. The PCR product of the pseudogene contained the 20-bp duplication
located 176-bp downstream of the 5' end of intron 2. Patient p1
had only the 20-bp duplication characteristic for the pseudogenes,
whereas patient p2 and healthy individuals showed both the single 20-bp
sequence of the wild-type gene and the 20-bp duplication, as indicated
by 2 overlying sequences in intron 2. (B) Direct sequence analysis of
fragments amplified across the 5' region of intron 2 using the
above primers and directly subcloned into pTA (Invitrogen). Sequence
analysis used the reverse primer, and the orientation of the
nucleotides is T, G, C, and A across the 4 lanes for each reaction. The
DNA template for PCR was normal genomic DNA, and individual clones were
analyzed in lanes 1, 2, 4, 5, and 6. Lane 3 represents a 1:1 mixing of
the clones sequenced in lanes 1 and 4. Lanes 1 and 2 demonstrate the
wild-type sequence, which includes only 1 copy of the 20-bp repeat unit
CAGGGTCTTGCTCTGTCACC, whereas lanes 4, 5, and 6 show the
repeat (indicated by brackets).
|
|
Agarose gel electrophoresis of PCR products containing exon 2 and the
flanking region of intron 2 revealed 2 fragments in all control samples
that differed by 20 bp, again indicating the presence of wild-type gene
and pseudogene sequences (Figure 8). Sequence analysis confirmed that the larger fragment contained the
20-bp duplication specific for the pseudogenes. In 10 of the 25 GT/GT patients, only 1 band the size of the pseudogene fragment was detected (Figure 8). This suggests that only the pseudogene sequence with the 20-bp duplication was present in these patients. Analysis of the remaining 18 patients indicates that each one has both
the wild-type and pseudogene sequences in intron 2, as shown by the
presence or absence of the 20-bp duplication beginning 176-bp
downstream of the 5' end of intron 2.
View larger version (59K):
[in this window]
[in a new window]
| Fig 8.
PCR amplification of intron 2.
Genomic DNA from a healthy individual (n1) and 3 A47° CGD patients
(p1, p2, and p3) was amplified using primers 2LB and 2RC. A 330-bp
amplification product containing the single bp sequence 176-bp
downstream from the 5' end of intron 2 (B) as well as a 350-bp
fragment containing the 20-bp duplicated sequence from the pseudogene
(C) were detected in normal individuals. Only the 350-bp fragment
indicative for the pseudogene sequence was amplified from patients p1
and p2, whereas patient p3 showed both the 330- and 350-bp PCR product
indicating the presence of wild-type and pseudogene alleles.
|
|
In summary, in 10 of 25 GT/GT patients, only the pseudogene
marker sequences, the TG in intron 1, the GT in exon 2, and the
20-bp duplication in intron 2 were detected in all alleles (Figure 3).
There were 12 patients who had only pseudogene sequences in intron 1 and exon 2 (but not in intron 2), whereas 3 patients showed both
wild-type and pseudogene sequences in intron 1 and 2 flanking the GT
mutation. Our data indicate that there is a heterogeneity in the
flanking markers around the GT in patients who appear to have only
the GT sequence in A47° CGD (Figure 3). Some strands were pure
pseudogene alleles identical in this region to previously characterized
genomic pseudogene clones.22 On other strands, GT was
variably linked to either wild-type or pseudogene sequences in the
flanking introns leading to wild-type and/or pseudogene chimers. In 3 patients, both wild-type and pseudogene sequences were present at all 3 positions, which suggests that these patients have other mutations than
GT. The precise mutation analysis of these patients is currently
under investigation.
Whereas at least 2 p47-phox pseudogenes are present in the
human genome, nothing is known about the presence of p47-phox
pseudogenes in other primates. We therefore performed sequence analysis
of genomic DNA from 6 chimpanzees and 1 rhesus monkey using human primers. The wild-type p47-phox sequence of exon 2 and the
flanking region of intron 1 were completely conserved in the
chimpanzees. In the rhesus monkey, several nucleotide exchanges were
found in exon 2, and the sequence surrounding the CG TG
pseudogene marker in intron 1 was not conserved (Figure
9). Both primates, however, showed the GTGT
sequence in exon 2, and the chimpanzees also contained the wild- type
CG sequence in intron 1. No evidence for the presence of pseudogene
sequences could be found, indicating that these primates only have the
p47-phox wild-type gene. These results suggest that the
p47-phox gene duplications (or at least the formation of
pseudogenes) occurred late in evolution after the branching of the
hominids from the common line of ancestors. This evolutionarily recent
event is a possible explanation for the high homology between wild-type
genes and pseudogenes and the presence of pseudogene mRNA in all normal
controls.
View larger version (25K):
[in this window]
[in a new window]
| Fig 9.
Sequence comparison of exon 2 and adjacent intronic
regions of p47-phox genes.
Sequence of exon 2 (capital letters) and the flanking introns is shown
from the human p47-phox wild-type gene (N), the human
p47-phox pseudogenes (P), the chimpanzee p47-phox gene
(C), and the rhesus monkey p47-phox gene (R). The start of the
sequence available is indicated by 5', and 3' indicates the
end of the sequence. Note that the CG sequence in intron 1 was not
conserved in the rhesus monkey and that intron 2 could not be amplified
with human primers in the chimpanzee nor the rhesus monkey.
|
|
| |
Discussion |
We recently demonstrated the presence of more than 1 highly
homologous p47-phox pseudogene, which characteristically
contains GT at the beginning of exon 2, leading to a premature
termination codon at amino acid 51.22 In previous studies,
9 of 10 A47° CGD patients were found to be "homozygous" for
GT.19-21 In this study, we confirm that in the majority
of A47° CGD patients, only the GT allele in exon 2 can be
detected. We provide an explanation at the molecular level for the
unusually high frequency of a single mutation in an unrelated racially
diverse population. Previously, the high number of A47° CGD
patients with the GT mutation had been ascribed to the sequence
surrounding the beginning of exon 2. It has been hypothesized that the
dinucleotide repeat might be especially susceptible to mutations by DNA
strand slippage at this site by DNA polymerase, thereby generating
deletions of the dinucleotide unit.19,21 Furthermore, it
has been speculated that the palindromic sequence surrounding the
tandem repeat might allow the formation of a hairpin loop, with a
mismatch resulting in the dinucleotide deletion by slipped
mispairing during DNA replication.21 However,
the GT deletion appears too small to be caused by the deletion of an
entire hairpin loop. Moreover, small hairpin loops require a large
amount of energy to form and are consequently not
favored.24
Although these mechanisms cannot be completely ruled out, they do not
explain the finding that the majority of our patients carried at least
1 additional pseudogene marker in the flanking intronic regions on all
alleles present (Figures 3 and 9). Since the highly homologous
p47-phox pseudogenes carrying GT colocalize to the same
chromosomal band 7q11.23, it appears very likely that recombination
events between the p47-phox gene and pseudogenes, such as
crossing-over and/or gene conversion, take place. Such mechanisms would
allow the incorporation of the GT mutation into the p47-phox
wild-type gene, thus rendering p47-phox nonfunctional. Crossing-over leads to reciprocal exchange of homologous DNA stretches, and gene conversion leads to nonreciprocal exchange of these stretches. Such exchanges involve an alteration of an allele at a specific locus
in such a way that an internal portion of its sequence has been
replaced by a homologous segment copied from another allele or
locus.25 Possible recombination events include
crossing-over and/or gene conversion with or without deletions at
various breakpoints, leading to chimeric genes with pseudogene
fragments of different sizes. Such mechanisms would be consistent with
our observation that different combinations of intronic gene and
pseudogene markers occur in A47° CGD patients with only the GT
allele. Gene conversion events between genes and their homologous
pseudogenes have also been described in the pathogenesis of several
other genetic disorders such as 21-hydroxylase
deficiency,26 von Willebrand disease,27 Gaucher
disease,28 and Hunter syndrome.29
The size of the putative converted sequence element can be estimated
for those patients who contain GT but do demonstrate wild-type and
pseudogene sequences in the flanking intronic sites. The gene
conversion product in these patients could be as small as 377 bp, based
upon the subsets of patients who are heterozygous for the CG to GT
exchange in intron 1 and the presence of both the duplicated and
nonduplicated region in intron 2. The size of 377 bp is approximately
the same as that reported for a microconversion confined to a tract of
no more than 390 nucleotides in a subset of patients with
21-hydroxylase deficiency.30 On the other hand, in those
patients who have pseudogene sequences exclusively in all 3 marker
positions on all alleles, the converted element must be larger than 377 bp. Alternatively, the p47-phox wild-type gene might be
partially or completely deleted in these cases. However, the complete
deletion of the wild-type gene can be ruled out in those patients who
carry only GT or GT and TG in intron 1 but who also carry the
wild-type sequence in intron 2. These findings would be again
consistent with the presence of chimeric DNA strands resulting from
recombination events of a sequence stretch of a yet unknown size. They
can also be explained by the presence of fusion DNA strands with or
without a partial deletion of the 5' portion of the
p47-phox wild-type gene. However, to further elucidate the
mechanisms leading to chimeric DNA strands in A47° CGD patients, it
will be necessary to study the presence of additional pseudogene markers upstream of the TG sequence in intron 1 and downstream of the
20-bp duplication in intron 2.
Several observations further support our hypothesis that recombination
events occur between the p47-phox wild-type gene and pseudogenes. First, the degree of sequence similarity appears to be
closely related to the frequency of recombination events.31 The p47-phox wild-type gene and pseudogenes are approximately 99% homologous in exonic and intronic regions.22 The
21-hydroxylase gene and its pseudogene, for example, are 98%
homologous in their exonic and 96% homologous in their intronic
regions.26 Second, hot spots for
recombination, such as the Chi sequence and the human minisatellite,
repeat sequences, and repetitive elements (such as Alu repeats)
appear to stimulate and facilitate recombination events.32-34 Indeed, recombination hot spots and
Alu sequences are frequently found in the p47-phox gene
and pseudogenes.22 Third, the p47-phox wild-type
gene and pseudogenes are located within a cluster of duplicated
sequences at chromosomal band 7q11.23.22 Most importantly,
there is no explanation other than recombination events for the
presence of chimeric DNA strands composed of wild-type and pseudogene
sequences in most of our A47° CGD patients.
In contrast to other diseases caused by recombination events between
the wild-type gene and pseudogene, where multiple deleterious mutations
are found within the pseudogene,26,27 only 1 deleterious mutation, namely GT, is present in the p47-phox pseudogenes. All other sequence differences between wild type and pseudogenes in the
exonic regions are single bp substitutions. Most of them are silent and
would therefore, when transformed to the wild-type gene, not be
expected to cause a notable loss of function of p47-phox. However, in
those cases where the converted element contains GT in exon 2, a
truncated p47-phox will be encoded, assuming that the transcription is
initiated at the same site as in the wild-type gene. The presence of
only 1 putative deleterious mutation in the p47-phox
pseudogenes would explain the unusually high incidence of a single
mutation affecting unrelated, racially diverse patients with a rare
autosomal recessive disease.
Frequently occurring recombination events between the p47-phox
gene and its pseudogenes within different populations provides not only
an explanation for the increased incidence of the GT mutation but
might also explain the high frequency of carriers for A47° CGD.
Because A47° CGD accounts for approximately 25% of CGD patients,
and the incidence for CGD is estimated at 1:500 000,14
approximately 1 in 2 million newborns suffer from p47-phox-deficient CGD. The carrier frequency can then be calculated to be approximately 1 in 700. In the other autosomal inherited CGD forms, A22° CGD (p22-phox deficiency) and A67° CGD (p67-phox deficiency), carrier frequencies are estimated to be 1:5000 and below, respectively. In
contrast to the reports of these latter forms, the parents of A47°
CGD patients are rarely consanguineous (none of our families were). At
present, there appears to be no evolutionary advantage for A47° CGD
carriers. Furthermore, no founder effect has been observed.
Whereas there is evidence that recombination events are involved in 25 of 28 patients, 3 of these patients had a detectable wild-type sequence
in exon 2; no other mutations in the coding region have been found that
could explain the absence of the p47-phox protein in these patients.
Although we currently do not know the genetic defects in these
patients, we speculate that they might have de novo mutations.
In previous reports of A47° CGD patients, only 1 of 10 patients had
a second mutation, namely deletion of a G at bp
502.19-21 These data are consistent with our observations that approximately 10% of A47° CGD patients might have de
novo mutations. Considering that approximately 25% of all CGD
patients do not have functional p47-phox, approximately 2.5% of all
CGD patients might carry new mutations in the p47-phox gene
other than the homozygous state for the GT mutation. Thus, the
incidence of de novo mutations in A47° CGD would be in a
similar range as that observed in the other autosomal recessive CGD
forms deficient of p22-phox or p67-phox, where the incidence of de
novo mutations is below 5%.12-14
Lastly, it is possible to diagnose A47° CGD patients who have only
the GT mutation by using a combination of sequence, restriction digest, and SSCP analysis. However, the diagnosis of a carrier state is problematic because the pseudogene alleles are present in all
normal individuals. Further elucidation of the molecular mechanism of
A47° CGD will perhaps identify other significant changes or
differences within or linked to the p47-phox gene and pseudogenes that will be useful for developing an acceptable test to
detect p47-phox carriers.
| |
Acknowledgments |
The authors wish to thank Drs Pauline Lee, Andrew Cross, and Paul
Heyworth for helpful suggestions. Special thanks to Inga Roesler for
helping type the manuscript.
| |
Footnotes |
Submitted July 21, 1999; accepted November 29, 1999.
Supported by a grant from Deutscher Akademischer
Austauschdienst, Bonn, Germany (A. Goerlach), and a grant from
Deutsche Forschungsmeinschaft, Bonn, Germany (J. Roesler).
Reprints: John T. Curnutte, Department of Immunology, Genentech
Inc, 1 DNA Way, Building 12, Mailstop 34, South San Francisco, CA
94080; e-mail: curnutte.john{at}gene.com.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Babior BM, Kipnes RS, Curnutte JT.
Biological defense mechanisms: the production by leukocytes of superoxide, a potential bactericidal agent.
J Clin Invest.
1973;52:741.
2.
Cross AR, Jones OTG.
Enzymic mechanisms of superoxide production.
Biochim Biophys Acta.
1991;853:65.
3.
Clark RA, Volpp BD, Leidal KG, Nauseef WM.
Two cytosolic components of the human neutrophil respiratory burst oxidase translocate to the plasma membrane during cell activation.
J Clin Invest.
1990;85:714.
4.
Heyworth PG, Curnutte JT, Nauseef WM.
Neutrophil nicotinamide adenine dinucleotide phosphate (reduced form) oxidase assembly: translocation of p47-phox and p67-phox requires interaction between p47-phox and cytochrome b558.
J Clin Invest.
1991;87:352.
5.
Leto TL, Adams AG, De Mendez I.
Assembly of the phagocyte NADPH oxidase: binding of src homology 3 domains to proline rich targets.
Proc Nat Acad Sci U S A.
1994;91:10,650[Abstract/Free Full Text].
6.
DeLeo FR, Quinn M.
Assembly of the phagocyte NADPH oxidase: molecular interaction of oxidase proteins.
J Leukoc Biol.
1996;60:677[Abstract].
7.
Leusen JHW, Verhoeven AJ, Roos D.
Interactions between the components of the human NADPH oxidase: intrigues in the phox family.
J Lab Clin Med.
1996;128:461[Medline]
[Order article via Infotrieve].
8.
Cross AR, Curnutte JT.
The cytosolic activation factors p47-phox and p67-phox have distinct roles in the regulation of electron flow in NADPH oxidase.
J Biol Chem.
1995;270:6543[Abstract/Free Full Text].
9.
Knaus UG, Heyworth PG, Evans T, Curnutte JT, Bokoch GM.
Rac 2 is a regulator of phagocyte oxygen radical production.
Science.
1991;254:1512[Abstract/Free Full Text].
10.
Wientjes FB, Hsuan JJ, Totty NF, Segal AW.
p40-phox, a third cytosolic component of the activation complex of the NADPH oxidase to contain src homology 3 domains.
Biochem J.
1993;296:557.
11.
Sathyamoorthy M, De Mendez I, Adams AG, Leto TL.
p40-phox down-regulates NADPH oxidase activity through interactions with its SH3 domain.
J Biol Chem.
1997;272:9141[Abstract/Free Full Text].
12.
Curnutte JT.
Chronic granulomatous disease: The solving of a clinical riddle at the molecular level [review].
Clin Immunol Immunopathol.
1993;67:S2[Medline]
[Order article via Infotrieve].
13.
Roos D, de Boer M, Kuribayashi F.
Mutations in the X-linked and autosomal recessive forms of chronic granulomatous disease.
Blood.
1996;87:166.
14.
Thrasher AJ, Keep NH, Wientjes F, Segal AW.
Chronic granulomatous disease.
Biochem Biophys Acta.
1994;1227:1[Medline]
[Order article via Infotrieve].
15.
Fisher A, Segal AW, Seger RA, Weening RS.
The management of chronic granulomatous disease.
Eur J Pediatr.
1993;15:896.
16.
Dinauer MC.
The respiratory burst oxidase and the molecular genetics of chronic granulomatous disease.
Crit Rev Clin Lab Sci.
1993;30:329[Medline]
[Order article via Infotrieve].
17.
Roos D, Curnutte JT, Hossle JP.
X-CGDbase: a database of X-CGD-causing mutations.
Immunol Today.
1996;17:517[Medline]
[Order article via Infotrieve].
18.
Cross AR, Curnutte JT, Rae J, Heyworth PG.
Hematologically important mutations: X-linked chronic granulomatous disease.
Blood Cells Mol Dis.
1996;22:90[Medline]
[Order article via Infotrieve].
19.
Casimir CM, Bu-Ghanuim HN, Rosaway ARF, Bentley DL, Rowe P, Segal AW.
Autosomal recessive chronic granulomatous disease caused by deletion at a dinucleotide repeat.
Proc Natl Acad Sci U S A.
1993;88:2753[Abstract/Free Full Text].
20.
Volpp BD, Lin Y.
In vitro reconstitution of the respiratory burst in B lymphoblasts from p47-phox-deficient chronic granulomatous disease.
J Clin Invest.
1993;91:210.
21.
Iawata M, Nunoi H, Yamzaki H.
Homologous dinucleotide (GT or TG) deletion in Japanese patients with chronic granulomatous disease with p47-phox deficiency.
Biochem Biophys Res Comm.
1994;199:1372[Medline]
[Order article via Infotrieve].
22.
Goerlach A, Lee PL, Roesler J.
A p47-phox pseudogene carries the most common mutation causing p47-phox deficient chronic granulomatous disease.
J Clin Invest.
1997;100:1907[Medline]
[Order article via Infotrieve].
23.
Hockenhull EL, Carette MJ, Metcalfe K, Donnai D, Read AP, Tassabehji M.
A complete physical contig and partial transcript map of Williams syndrome critical region.
Genomics.
1999;58:138[Medline]
[Order article via Infotrieve].
24.
Krawzak M, Cooper DN.
Gene deletions causing human genetic disease: mechanisms of mutagenesis and the role of the local DNA sequence environment.
Hum Genet.
1991;86:425[Medline]
[Order article via Infotrieve].
25.
Kourilsky P.
Molecular mechanisms for gene conversion in higher cells.
Trends Genet.
1986;2:60.
26.
Helmberg A.
Twin genes and endocrine disease: CYP21 and CYP11B genes.
Acta Endocrinologica.
1993;129:97[Abstract/Free Full Text].
27.
Eikenboom JCJ, Vink T, Briet E, Sixma JJ, Reitsma PH.
Multiple substitutions in the von Willebrand factor gene that mimic the pseudogene sequence.
Proc Natl Acad Sci U S A.
1994;91:2221[Abstract/Free Full Text].
28.
Beutler E.
Gaucher disease as a paradigm of current issues regarding single gene mutations of humans.
Proc Natl Acad Sci U S A.
1993;90:5384[Abstract/Free Full Text].
29.
Bondeson ML, Dahl N, Malmgren H.
Inversion of the IDS gene resulting from recombination with IDS-related sequences is a common cause of the Hunter syndrome.
Hum Mol Genet.
1995;4:615[Abstract/Free Full Text].
30.
Collier S, Tassabehij M, Strachnan T.
A de novo pathological point mutation at the 21-hydroxylase locus: implications for gene conversions in the human genome.
Nature Genetics.
1993;3:260[Medline]
[Order article via Infotrieve].
31.
Liskay RM, Letsou A, Stachelek JL.
Homology requirement for efficient gene conversion between duplicated chromosomal segments in mammalian cells.
Genetics.
1987;115:161[Abstract/Free Full Text].
32.
Smith GR.
Hotspots of homologous recombination.
Experientia.
1994;50:234[Medline]
[Order article via Infotrieve].
33.
Jeffreys AJ, Wilson V, Thein SL.
Hypervariable "minisatellite" regions in human DNA.
Nature.
1985;314:67[Medline]
[Order article via Infotrieve].
34.
Lehrmann MA, Russel DW, Goldstein JL, Brown MS.
Alu-Alu recombination deletes splice acceptor sites and produces secreted low density lipoprotein receptor in a subject with familial hypercholesterolemia.
J Biol Chem.
1987;262:3354[Abstract/Free Full Text].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Harbord, A. Hankin, S. Bloom, and H. Mitchison
Association between p47phox pseudogenes and inflammatory bowel disease
Blood,
April 15, 2003;
101(8):
3337 - 3337.
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. G. Heyworth, D. Noack, and A. R. Cross
Identification of a novel NCF-1 (p47-phox) pseudogene not containing the signature GT deletion: significance for A47{degrees} chronic granulomatous disease carrier detection
Blood,
August 13, 2002;
100(5):
1845 - 1851.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Noack, J. Rae, A. R. Cross, B. A. Ellis, P. E. Newburger, J. T. Curnutte, and P. G. Heyworth
Autosomal recessive chronic granulomatous disease caused by defects in NCF-1, the gene encoding the phagocyte p47-phox: mutations not arising in the NCF-1 pseudogenes
Blood,
January 1, 2001;
97(1):
305 - 311.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. C. Dinauer, J. A. Lekstrom-Himes, and D. C. Dale
Inherited Neutrophil Disorders: Molecular Basis and New Therapies
Hematology,
January 1, 2000;
2000(1):
303 - 318.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction