SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Fujio, K. Articles by Kitamura, T. Search for Related Content PubMed PubMed Citation Articles by Fujio, K. Articles by Kitamura, T. Related Collections Plenary Papers Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 95 No. 7 (April 1), 2000: pp. 2204-2210 PLENARY PAPER Molecular cloning of a novel type 1 cytokine receptor similar to the common gamma chain Keishi Fujio, Tetsuya Nosaka, Tetsuo Kojima, Toshiyuki Kawashima, Takashi Yahata, Neal G. Copeland, Debra J. Gilbert, Nancy A. Jenkins, Kazuhiko Yamamoto, Takashi Nishimura, and Toshio Kitamura From the Department of Hematopoietic Factors, the Institute of Medical Science, the University of Tokyo, Tokyo, Japan; the Department of Immunology, Tokai University School of Medicine, Isehara, Japan; Mammalian Genetics Laboratory, Advanced Bioscience Laboratories (ABL)-Basic Research Program, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD; and the Department of Allergy and Rheumatology, Graduate School of Medicine, the University of Tokyo, Tokyo, Japan.     Abstract Top Abstract Introduction Materials and methods Results Discussion References In a complementary DNA (cDNA) screening of murine Th2-skewed lymphocytes with our recently developed signal sequence trap method termed SST-REX, a novel type 1 cytokine receptor, Delta1 (1), was identified. Although 1 is ubiquitously expressed in multiple tissues, the expression level is higher in Th2-skewed lymphocytes than in Th1-skewed ones. The 1 cDNA encodes a 359-amino acid type 1 membrane protein. The extracellular domain of 206 amino acids showed 24% identity with the murine common  receptor that is shared among the receptors for interleukin(IL)-2, IL-4, IL-7, IL-9, and IL-15. The membrane-proximal region of 1 includes a box1 motif, which is important for association with Janus kinases (JAKs), and showed a significant homology with that of the mouse erythropoietin receptor (EPOR). A box2 motif was also found in close proximity to the box1 region. Dimerization of the cytoplasmic region of 1 alone did not transduce proliferative signals in IL-3-dependent cell lines. However, the membrane-proximal region of 1 could substitute for that of human EPOR in transmitting proliferative signals and activating JAK2. These results suggest that 1 is a subunit of cytokine receptor that may be involved in multiple receptor systems and play a regulatory role in the immune system and hematopoiesis. (Blood. 2000;95:2204-2210) © 2000 by The American Society of Hematology.     Introduction Top Abstract Introduction Materials and methods Results Discussion References Cytokine systems regulate cellular growth and differentiation in hematopoiesis, immune systems, tissue development, and morphogenesis.1,2 Identification of novel members of the cytokine family and their receptors is of great importance because they play key roles in regulating a broad-range biological response. Cytokines have a highly conserved 4-helix bundle tertiary structure but have a low homology in the primary amino acid sequence.3 Therefore, identification of novel cytokines using homology-based cloning methods has been rather difficult. Cytokine signals are mediated through specific receptor complexes, including type 1 and type 2 cytokine receptors, the tumor necrosis factor receptor superfamily, the tumor growth factor receptor superfamily, and tyrosine kinase receptors.4-8 The type 1 cytokine receptors transmit signals of the group of cytokines involved in hematopoiesis and blood cell functions, and they are also known as the hemopoietin receptor family. Members of the type 1 cytokine receptor family are readily identified by a cytokine receptor module comprising 2 fibronectin type III-like domains containing the N-terminal domain with conserved cysteine residues and by the highly conserved Trp-Ser-X-Trp-Ser (WSXWS) sequence present above the transmembrane domain.9-12 Structural alterations of these receptors occur in tumorigenesis,13 immunodeficiency,14 genetic susceptibility to some pathologic conditions such as allergic sensitivity,15,16 and metabolic disorders such as alveolar proteinosis.17 Therefore, the molecular cloning of a novel cytokine receptor may help to understand the pathogenesis of some disease and to tailor treatments accordingly. Most members of the type 1 cytokine receptor family have been cloned using ligand binding as an assay. Alternatively, oligonucleotides for the WSXWS motif were used as hybridization probes, and degenerate polymerase chain reaction (PCR) with primers for the highly conserved region of type 1 cytokine receptors was also used. Nowadays, some cytokine receptors can be identified in a search of expressed sequence tag (EST) database as a result of homology with known cytokine receptors.18,19 We developed a method termed SST-REX (signal sequence trap by retrovirus-mediated expression screening)20 that detects signal sequences in complementary DNA (cDNA) fragments based on their ability to redirect a constitutively active mutant of a cytokine receptor21 to the cell surface, thereby allowing interleukin-3 (IL-3)-independent growth of otherwise IL-3-dependent Ba/F3 cells.20 SST-REX is an improved version of the signal sequence trap methods originally described by Tashiro et al22 and modified by Klein et al23 by which cDNAs for secreted molecules and surface proteins are selectively isolated. We now report isolation and characterization of a novel type 1 cytokine receptor, Delta 1 (1), cloned using SST-REX.     Materials and methods Top Abstract Introduction Materials and methods Results Discussion References Reagents Recombinant murine IL-3 (mIL-3) was produced in silkworm. Recombinant human erythropoietin (hEPO) was a gift from the Chugai Pharmaceutical Co (Tokyo, Japan). Recombinant human thrombopoeitin (hTPO) was obtained from R & D Systems (Minneapolis, MN). Antibodies directed against TYK2, Janus kinase (JAK)1, and JAK2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies raised against JAK3 and the 4G10 antibody, raised against phosphotyrosine, were purchased from UBI (Lake Placid, NY). The anti-FLAG M2 antibody was purchased from Eastman Chemical Company (Kingsport, TN). Cell lines and cell culture Ba/F3,24 FDC-P1,25 LG, LGM,26 and 32D 27 cells were maintained in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS), 2 mmol/L glutamine, 100 U/mL penicillin, 100 µg/mL streptomycin, and 1 ng/mL mIL-3. CTLL-2 cells28 were maintained in RPMI 1640 supplemented with 10% FCS, 2 mmol/L glutamine, 50 µmol/L 2-mercaptoethanol, 100 U/mL penicillin, 100 µg/mL streptomycin, and 20 ng/ml mIL-2. NIH3T3 fibroblast cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% FCS (DMEM/10%FCS). An ecotropic retrovirus packaging cell line BOSC23 29 was maintained in DMEM containing 10% FCS (DMEM/10%FCS) and guanine phosphoribosyl transferase selection reagents (Speciality Media, Lavallette, NJ). The cells were transferred to DMEM/10%FCS without guanine phosphoribosyl transferase selection reagents 2 days before transfection. Construction of the cDNA library for SST-REX Induction of antigen-specific activation of Th1/Th2 cells was performed using DO11.10 transgenic mice as described,30 and poly(A)+ RNA samples were prepared from resting or activated Th1 and Th2 cells using FastTrack2.0 Kit (Invitrogen Carlsbad, CA). Complementary DNA (cDNA) was synthesized from poly(A)+ RNA of resting Th1 and Th2 cells with random hexamers using SuperScript Choice System (Gibco-BRL, Rockville, MD) according to the manufacturer's instructions. The synthesized cDNA was size-separated through SizeSep 400 Spun Column (Pharmacia, Uppsala, Sweden) and inserted into BstXI sites of pMX-SST using BstXI adaptors (Invitrogen). The ligated DNA was electroporated into DH10B cells (Electromax, Gibco-BRL) using an E-coli Pulser (Bio-Rad, Hercules, CA) at 1.8 kV. Plasmid DNA was prepared using JETstar (Genomed, Research Triangle Park, NC) from 200-ml Escherichia coli culture. Infection of Ba/F3 cells with high-titer retroviruses derived from the library for SST and, also, isolation of cDNA fragments by PCR from factor-independent clones were performed as described. 20 Construction of a cDNA library from resting Th2 cells Complementary DNA was synthesized from poly(A)+ RNA from resting Th2 cells with oligo-dT primers, using SuperScript Choice System, as described above, and inserted into BstXI sites of pME18S,31 using BstXI adaptors. The ligated DNA was electroporated, and plasmid DNA was prepared as described above. Cloning of 1 cDNAs A biotinylated probe of 407 base pairs (bp) was made by PCR from the 1 cDNA with oligoprimers 5'GGTGATGTCACAGTCGTCTGCCATG3' and 5' TGCCAGGCGTCCTCATCGTCATT3' using 50-µM Biotin-21-dUTP (Clontech Laboratories, Palo Alto, CA), 200-µM dATP, 200-µM dGTP, 200-µM dCTP, and 10-µM dTTP. An oligo-dT-primed cDNA library of resting Th2 cells was screened using RecA protein coated with biotinylated linear DNA probes as described.32-34 Northern blot analysis A Mouse Multiple Tissue Northern Blot (Clontech) was probed with the 407-bp 1-specific PCR fragments generated with the same set of primers as described above. The blots were hybridized overnight in 50% formamide, 5 × SSC, 1% sodium dodecyl sulfate (SDS), 6 × Denhardt's reagent, and 100 µg/ml of salmon sperm DNA at 42°C with a 32P-labeled randomly primed probe and washed at 55°C in 0.1 × SSC and 0.1% SDS, followed by exposure to radiographic film. Poly(A)+ RNA samples (3 µg) prepared from various mouse cell lines using FastTrack2.0 Kit were separated by electrophoresis through a 1% agarose formaldehyde gel and transferred to Hybond-N+ (Amersham, Arlington Heights, IL) nylon filter. The Northern blot was hybridized and washed as described above. Construction and expression of chimeric receptors consisting of the human receptor for EPO or TPO and 1 For expression of the wild type hEPOR (hEPO receptor), a full-length hEPOR35 was cloned into the EcoRI and NotI sites of the pMX-puro retrovirus vector.36 For construction of chimeric receptors hEPOR-1R and hMPL-1R, an EcoRI site was inserted between the extracellular and transmembrane domains of each cDNA. Then, the cytoplasmic domain of 1 cDNA generated by PCR with high-fidelity DNA polymerase Pyrobest (Takara Otsu, Shiga, Japan) was cloned into pMX-puro at 5'-EcoRI and 3'-NotI sites, and the EcoRI fragment containing the extracellular domain of hEPOR or hMPL37 was cloned into a 5'-EcoRI site). The primers used to create EcoRI and NotI sites in the 1 cDNA were 5'-AAAGAATTCCCGCCCCTCCTGCCCCTGGGC-3' and 5'-GCTGGCGGCCGCACCTGCAGGCGC-3'. The primers used to create EcoRI sites in hEPOR cDNA were 5'-AAAGAATTCGGGGGCTGTATCATGGAC-3' and 5'-AAAGAATTCGGGGTCCAGGTCGCTAGG-3'. The primers used to create EcoRI sites in hMPL cDNA were 5'-GGTAGGGAATTCCGGAATTTCCTCGAGATG-3' and 5'-AAAGAATTCCCAGGCGGTCTCGGTGGCGGT-3'. To construct a chimeric receptor EDER, a 57-amino acid stretch covering the transmembrane domain and the box1 region of hEPOR was replaced with the corresponding region of 1; first, an HpaI site was inserted between the extracellular and transmembrane domains, and an XhoI site was inserted downstream of the conserved tryptophan residue in the cytoplasmic domain of hEPOR. Second, the box1 region of 1 cDNA was cloned into the EcoRI and NotI sites of the pMX-puro. Then, the cytoplasmic region of hEPOR was cloned into the XhoI and NotI sites, and the extracellular domain of hEPOR was cloned into the EcoRI and HpaI sites. The primers used to create 5'-EcoRI and HpaI sites and 3'-XhoI and NotI sites at the end of the 1 cDNA spanning the transmembrane and the membrane-proximal region were 5'-AAAGAATTCGTTAACCCGCCCCTCCTGCCCCTGGGG-3' and 5'-AAAGCGGCCGCCTCGAGCCAGGCCTGGAAGTTCCC-3'. The primers used to create 5'-XhoI and 3'-NotI sites in the cytoplasmic region of hEPOR were 5'-AAACTCGAGCTGTACCAGAATGATGGC-3' and 5'-AAAGCGGCCGCTCACTTGTCGTCATCGTCCTTGTAATCAGAG- CAAGCCACATAGCT-3'. The primers used to create 5'-EcoRI and 3'-HpaI sites in the extracellular region of hEPOR were 5'-AAAGAATTCGGGGGCTGTATCATGGAC-3' and 5'-AAAGTTAACGGGGTCCAGGTCGCTAGG-3'. All constructs were confirmed by restriction enzyme analyses and sequencing. The resulting expression plasmids were introduced into FDC-P1 via retrovirus infection as described.38 Infected cell lines were selected in the presence of 1 µg/ml of puromycin (Sigma, St. Louis, MO) to obtain a stable transfectant. Construction and expression of a tagged molecule of 1 To construct the tagged 1, 1-FLAG was designed by fusing the FLAG-sequence (DYKDDDDK) to the C-terminus of 1. A PCR fragment of the 1-FLAG was cloned into pMX-puro retrovirus vector at 5'-EcoRI and 3'-NotI sites. The primers used to add the FLAG sequence to the C-terminus of 1 was 5'-AGGGAATTCCGGAATTTCCTCGAGATC-3' and 5'-AAAGCGGCCGCTCACTTGTCGTCATCGTCCTTGTAATCC- AGGGTCATGTAGCCGCTGTC-3'. Immunoprecipitation and Western blotting Cells were lysed in the lysis buffer (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 1% Triton X-100; 1 mM EDTA; 0.2 mM Na3VO4; and 2 mM PMSF). For surface labeling of the cells, NHS-LC-Biotin (Pierce, Rockford, IL) was added prior to cell lysis. Lysates were cleared of debris by centrifugation at 12 000g for 40 minutes, and the supernatants were incubated with antibodies at 4°C for 2 hours. Immune complexes were precipitated with protein A-Sepharose (Pharmacia), washed with the lysis buffer, and proteins were eluted with the sample buffer (62.5 mM Tris-HCl, pH 6.8; 2% SDS; 10% glycerol; 5% 2-mercaptoethanol; and 0.02% bromophenol blue) for SDS-PAGE (SDS-polyacrylamide gel electrophoresis). The eluted proteins were electrophoresed on an 8%-to-16% gradient gel (Gradipore, North Ryde, Australia). Membranes were probed with antibodies or streptavidin-horseradish peroxidase (Vector Laboratories, Burlingame, CA) and visualized using the enhanced chemiluminescence detection system (Amersham) as described by the manufacturer. Chromosomal localization Interspecific backcross progenies were generated by mating (C57BL/6J × Mus spretus) F1 females and C57BL/6J males.39 A total of 205 N2 mice were used to map the 1 locus. DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, Southern blot transfer, and hybridization were performed essentially as described.40 All blots were prepared with Hybond-N+ nylon membrane (Amersham). The probe, a 407-bp fragment of mouse cDNA, was labeled with [32P] dCTP using a random primed labeling kit (Stratagene, La Jolla, CA); washing was done to a final stringency of 1.0 × standard saline citrate (SSC), 0.1% SDS, 65°C. C57BL/6J and M. spretus DNAs were digested with several enzymes and analyzed by Southern blot hybridization for informative restriction fragment length polymorphisms (RFLPs) using a mouse cDNA 1 probe. An ScaI fragment of 8.7 kilobases (kb) or 11.0 kb was detected in C57BL/6J DNA or M. spretus DNA, respectively. The presence or absence of 11.0-kb ScaI M. spretus-specific fragment was followed in backcross mice. A description of the probes and RFLPs for the loci linked to 1, including Fgf5, Dmp1, Gfi1, and Crybb2 has been reported elsewhere.41,42 Recombination distances were calculated using Map Manager, version 2.6.5. Gene order was determined by minimizing the number of recombination events required to explain the allele distribution patterns.     Results Top Abstract Introduction Materials and methods Results Discussion References Isolation and sequencing of the 1 cDNA clone encoding a novel cytokine receptor In the screening using the SST-REX system,20 Ba/F3 clones, which are transduced with cDNAs containing signal sequences, showed factor-independent growth through surface expression of a constitutively active MPL21 as a fusion protein. Among cDNA clones that we obtained from either a Th1 or a Th2 cell library using SST-REX, 1 of the clones, f215 clone, showed a significant homology with the murine common  receptor (c)43 at the amino acid level. A full-length cDNA was obtained from an oligo-dT-primed cDNA library derived from resting Th2 cells using the RecA screening system32-34 and was confirmed to contain a sequence that was identical to f215 (Figure 1A). View larger version (868K): [in this window] [in a new window]   Fig 1. Complementary DNA for the murine 1. (A) Schematic representation of 2 independent cDNAs for murine 1 and a short form of 1. The box represents the open reading frame. TM represents the transmembrane region. A clone obtained by SST-REX is also shown in the panel. (B) Nucleotide and deduced amino acid sequences of the cloned 1 cDNA. Numbers at the right margin indicate positions of nucleotides. Thick underlines indicate a putative signal sequence and a transmembrane region. Thin underlines indicate the box1 and box2 regions. The boxed region is a WSXWS box-like sequence. This cDNA contains an open reading frame of 1077 nucleotides, which encoded a putative protein of 359 amino acids (Figure 1B). The predicted amino acid sequence included a potential hydrophobic signal peptide, followed by a classical cytokine receptor module containing 2 of the 4 conserved cysteine residues, fibronectin type III-like domains, a WS boxlike sequence PSEWT, a 23-amino acid transmembrane domain, and a 106-amino acid cytoplasmic domain. Examination of the cytoplasmic domain of 1 identified a membrane-proximal box1 motif (Apolar-X-X-X-Aliphatic-Pro-X-Pro) (residues 262-269),44 which is known to be important for association with JAKs. 1 showed a moderate homology at the extracellular domain with the mouse c (24% identical, 36% similar; Figure 2A). The membrane-proximal region of 1, including the box1 region, showed a significant homology with those of the mouse EPOR and other receptor subunits, including the common  chain (c) (Figure 2B), and harbored the conserved tryptophan W287, which localized downstream of the box1 and is required for JAK2 association.45 The 12-amino acid sequence from A311 to L322 had a considerable similarity with the box2 region, which is also important for signal transduction in many cytokine receptors (Figure 2B). View larger version (4432K): [in this window] [in a new window]   Fig 2. Identity and similarity of 1 to other known cytokine receptors. (A) Alignment of the extracellular domains of 1 and the mouse common  receptor (c). (B) Comparison of the sequences of various hematopoietic growth factor receptors. A match of the amino acid residue between 1 and other receptors is indicated by "*" (identical) or ":" (similar). Previously defined regions of homology, termed homology box1 and 2, are shown. The box1 and box2 are short characteristic motifs found in the membrane-proximal regions of type 1 cytokine receptors.44 The box1 motif is defined by the PXP motif (proline, X, proline) preceded by hydrophobic sequences. Box2 is defined as a cluster of hydrophobic amino acids harboring some negatively charged amino acids. A truncated form of 1 was also cloned from an oligo-dT-primed Th2 cDNA library (Figure 1). The short form lacked membrane-proximal and transmembrane domains, and potentially encoded a soluble form of 1. Expression of 1 Expression of 1 was examined by Northern blots for several mouse cell lines and Th1- and Th2-skewed cells (Figure 3A). A single transcript of 1.4 kb was identified in all myeloid cell lines examined, CTLL2, and resting and activated murine Th1 and Th2 cells but not in 2 fibroblast cell lines, including NIH3T3 cells. Th2-skewed cells showed a much higher expression than Th1-skewed cells. Slight up-regulation of the expression by T-cell activation was observed in both T-cell cultures. View larger version (5051K): [in this window] [in a new window]   Fig 3. Expression of 1 in cell lines and mouse tissues. (A) Northern blot hybridization of murine cell lines; 3 µg of poly(A)+ RNA were separated through 1.0% agarose formaldehyde gel and then blotted using a 32P-labeled 1 probe. Mobilities of the RNA molecular weight marker are given in kilobases. (B) Northern blot hybridization of a mouse multiple tissue blot. View larger version (3622K): [in this window] [in a new window]   Fig 4. Structure of chimeric receptors and factor responsiveness of FDC-P1 transfectants. (A) Shown schematically are the wild type 1 and EPOR together with the chimeras hEPO-1R, hEDER, and hMPL-1R. Fused domains are designated by restriction sites generated within cognate cDNAs. (B) Time course of growth of the FDC-P1 cells retrovirally transduced with various receptor constructs. Parental FDC-P1 and FDC-P1 cells expressing hEPOR, hEPOR-1R, EDER, and hMPL-1R were cultivated in the presense of 1 ng/mL of mIL-3, 2 U/mL of hEPO, 2 U/mL of hEPO, 2 U/mL of hEPO, and 100 ng/mL of hTPO, respectively, and the cell number was counted at the indicated times. In Northern blot analysis of multiple tissues, a single transcript of 1.4 kb was identified in heart, brain, spleen, lung, kidney, and testis but not in skeletal muscle (Figure 3B). Functional analysis of 1 First, we overexpressed 1 in Ba/F3 cells that proliferate or survive in response to IL-3 or IL-4, respectively. However, the overexpression of 1 did not enhance Ba/F3 response to these cytokines. Moreover, these cytokines did not induce tyrosine phosphorylation of 1-FLAG in Ba/F3 cells overexpressing 1, suggesting that 1 was not involved in IL-3 and IL-4 signaling (data not shown). We next examined the function of the cytoplasmic domain of 1; chimeric receptors between 1 and hEPOR or hMPL were generated to characterize the effect of homodimerization of the cytoplasmic domain of 1. EDER chimera was made by substitution of the membrane-proximal region of hEPOR with that of the 1 (Figure 4A) to evaluate function of the membrane-proximal region of 1, including box1, as described in "Materials and methods." With regard to mitogenic properties, FDC-P1 cells expressing the EDER proliferated efficiently in response to hEPO (Figure 4B), while FDC-P1 cells expressing a chimeric receptor hEPO-1R or hMPL-1R did not transmit proliferative signals in response to EPO or TPO, respectively. Phosphorylation of Janus kinases by the EDE chimeric receptor The mitogenic activity of the EDER suggested that JAK was activated by hEPO-induced dimerization. Indeed, Western blot analysis detected hEPO-dependent JAK2 phosphorylation in cells expressing the EDER (Figure 5). JAK1, JAK3, and TYK2 were not phosphorylated in response to hEPO stimulation in the cells expressing the EDER. None of the 4 JAKs were phosphorylated in response to EPO or TPO stimulation in cells expressing a chimeric receptor hEPO-1R or hMPL-1R, respectively (data not shown). View larger version (29K): [in this window] [in a new window]   Fig 5. Activation of JAK2 kinase through the ectopically expressed chimeric EDE receptor in FDC-P1 cells. The ability of the chimeric receptor EDER to mediate hEPO- dependent activation of JAK kinases was assayed by immunoprecipitation with antibody to JAK2 and Western blotting with antibody to phosphotyrosine (monoclonal antibody 4G10). Reprobing was carried out using the anti-JAK2 antibody after stripping. Similar analyses were also performed using anti-JAK1, anti-JAK3, and anti-TYK2 antibodies. Expression of 1 protein A retrovirus construct, pMX-puro 1-FLAG, was designed to express a tagged molecule of 1 and was introduced into Ba/F3 cells via retrovirus infection. The cell lysate was immunoprecipitated by the anti-FLAG antibody (Figure 6). The expressed 1 protein had a molecular mass of 50 kd, which is larger than the calculated molecular mass of 37 791 d. The difference is probably due to attachment of sugar moieties to some of the 2 predicted potential N-linked glycosylation sites found in the extracellular domain of 1. View larger version (16K): [in this window] [in a new window]   Fig 6. Immunoprecipitation of tagged-1 expressed on Ba/F3 cells, under reducing conditions. Ba/F3 cells transduced with tagged-1 and parenteral cells were surface-labeled with sulfo-NHS-LC-biotin, and the cell lysates were precipitated with anti-FLAG antibody followed by the blotting with streptavidin-horseradish peroxidase. Positions of 1-FLAG (arrowhead) and molecular weight markers are indicated. Chromosomal mapping of the 1 gene The mouse chromosomal location of 1 was determined by interspecific backcross analysis using progeny derived from matings of ([C57BL/6J x M. spretus] F1 x C57BL/6J) mice. This interspecific backcross mapping panel has been typed for more than 2900 loci that are well distributed among all the autosomes as well as the X chromosome.39 The 11.0-kb ScaI M. spretus RFLP (see "Materials and methods") was used to follow segregation of the 1 locus in backcross mice. The mapping results indicated that 1 is located in the central region of mouse chromosome 5 linked to Fgf5, Dmp1, Gfi1, and Crybb2. Although 106 mice were analyzed for every marker and are shown in the segregation analysis (Figure 7), up to 154 mice were typed for some pairs of markers. Each locus was analyzed in pairwise combinations for recombination frequencies using the additional data. The ratios of the total number of mice exhibiting recombinant chromosomes to the total number of mice analyzed for each pair of loci and the most likely gene order are as follows: centromere  Fgf5-4/151  Dmp1-0/136  1-0/154  Gfi1-4/145  Crybb2. The recombination frequencies [expressed as genetic distances in centiMorgans (cM) ± the standard error] are: centromere  Fgf5-2.7 ± 1.3  [Dmp1, 1, Gfi1]  2.8 ± 1.4  Crybb2. No recombinants were detected between Dmp1 and 1 in 136 or between 1 and Gfi1 in 154 mice typed in common, suggesting that 2 loci in each pair are within 2.2 and 1.9 cM of each other, respectively (upper 95% confidence limit). View larger version (17K): [in this window] [in a new window]   Fig 7. 1 maps in the central region of mouse chromosome 5.  1 was placed on mouse chromosome 5 by interspecific backcross analysis. The segregation patterns of 1 and flanking genes in 106 backcross animals that were typed for all loci are shown at the top. For individual pairs of loci, more than 106 mice were typed. Each column represents the chromosome identified in the backcross progeny that was inherited from the (C57BL/6J x M. spretus) F1 parental. The shaded boxes represent the presence of a C57BL/6J allele, and white boxes represent the presense of an M. spretus allele. The number of offspring inheriting each type of chromosome is listed at the bottom of each column. A partial chromosome 5 linkage map showing the location of 1 in relation to linked genes is shown at the bottom. Recombination distances between loci (in centimorgans) are shown to the left of the chromosome, and the positions of loci in human chromosomes, where known, are shown to the right. References for the human map positions of loci cited in this study can be obtained from GDB (Genome Data Base), a computerized database of human linkage information maintained by The William H. Welch Medical Library of The Johns Hopkins University (Baltimore, MD).     Discussion Top Abstract Introduction Materials and methods Results Discussion References We isolated and characterized a novel member of the type 1 cytokine receptor family, 1, from a cDNA library of the murine Th2-skewed cells using SST-REX; 1 has a WS box-like sequence, PSEWT, and the box1 and box2 motifs in its membrane-proximal region. 44 When compared to other members of the type 1 cytokine receptor family, 1 showed the closest similarity to the murine c in the extracellular domain, with a 24% identity at the amino acid level. Its overall structure is also similar to that of c, not only in total amino acid length (1 359 vs c 369) but also in length of the extracellular domain (1 206 vs c 232) and the cytoplasmic domain (1 106 vs c 86). Moreover, the expression of 1 is ubiquitous in hematopoietic cells, as is the case for c. Although the WS box of 1 is diversed from the typical sequence of WSXWS, the presence of box1 and box2 domains and the similarity to the c indicated that 1 constitutes a member of the type 1 cytokine receptor family. Because a membrane-proximal 50-amino acid segment of the cytoplasmic domain includes both box1 and box2 regions that are essential for supporting signaling and cell proliferation,45-49 it is likely that 1 is involved in signal transduction. We were not able to obtain a human homologue of 1 in cross-hybridization screening using the mouse 1 as a probe under low stringent conditions; nor did we find any human ESTs homologous to 1 (unpublished results), suggesting that the human counterpart of 1 has a low homology with that of the mouse or that there is not a corresponding gene in the human. The central region of mouse chromosome 5, where we identified 1, shares regions of homology with human chromosomes 4q, 1p, and 22q (summarized in Figure 7), suggesting that the human homologue of 1, if any, will map to 1 of these chromosomal regions. In the functional analysis of 1, hEPOR-1R or hMPL-1R, the 2 chimeric receptors in which the extracellular domain of 1 was replaced by the human EPO or TPO receptors, did not transduce proliferative signals in response to hEPO or hTPO, respectively. These results suggested that homodimerization of 1 could not transduce proliferating signals, while other cytokine receptors, including glycoprotein130, c, and IL-2R, containing both the box1 and box2 regions were able to transduce proliferating signals upon homodimerization.50-52 On the other hand, the EDER chimera, in which the box1 region of the human EPOR was replaced with that of 1, induced phosphorylation of JAK2 and cell proliferation in response to human EPO, indicating that the membrane-proximal region of 1 can substitute for that of the EPOR. It is known that EPO stimulation induces tyrosine phosphorylation of JAK253 and that the box1 motif of EPOR is required for association with JAK2.46 In addition, the membrane-proximal region of the EPOR specifies JAK2 activation within a heterologous IL-2 receptor complex.54 The present data indicate that the box1 motif of 1 is capable of activating JAK2 in heterologous receptor complexes. We speculate that 1 may be a shared receptor subunit like c and is involved in signal transduction through JAK2 activation. Whether 1 has its own ligand remains to be determined. Although the expression of 1 is ubiquitous in the immune and the hematopoietic cells, it is clearly up-regulated in Th2-skewed cells, when compared to Th1-skewed cells, suggesting that up-regulation of 1 expression has something to do with differentiation into Th2 cells. In addition, activation of these cells by antibody stimulation significantly enhanced the expression of  both in Th1- and Th2-skewed cells, implicating 1 in the regulation of the immune system. These data lead us to examine whether 1 is involved in the IL-4 receptor system; however, overexpression of 1 did not alter cellular response to IL-4, and tyrosine phosphorylation of 1-FLAG was not induced in response to IL-4 (data not shown). These results suggested that 1 was not involved in the IL-4 receptor system, but potential involvement of 1 in IL-4 signaling cannot be ruled out at present. Thus, it is suggested that a novel cytokine receptor 1, which is similar to c in its structure and ubiquitous expression, is a receptor subunit that plays some roles in signal transduction of the immune system and hematopoiesis.     Acknowledgments We thank M. Ohara for critical reading of the manuscript and Dr S. Asano for continuous encouragement.     Footnotes Submitted October 12, 1999; accepted December 10, 1999. Supported in part by Chugai Pharmaceutical Company Ltd and grants from the Ministry of Education, Science, Sports, and Culture of Japan. The nucleotide sequence data for this cDNA will appear in the DNA Databank of Japan/European Molecular Biology Laboratory/Genbank nucleotide sequence database with accession number AB031333. Reprints: Toshio Kitamura, Department of Hematopoietic Factors, the Institute of Medical Science, the University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan; e-mail: kitamura{at}ims.u-tokyo.ac.jp. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.     References Top Abstract Introduction Materials and methods Results Discussion References 1. Arai K, Lee F, Miyajima A, Miyatake S, Arai N, Yokota T. Cytokines: coordinators of immune and inflammatory responses. Annu Rev Biochem. 1990;59:783[Medline] [Order article via Infotrieve]. 2. Paul WE, Seder RA. Lymphocyte responses and cytokines. Cell. 1994;76:241[Medline] [Order article via Infotrieve]. 3. Rozwarski DA, Gronenborn AM, Clore GM, et al. Structural comparisons among the short-chain helical cytokines. Structure. 1994;2:159[Medline] [Order article via Infotrieve]. 4. Miyajima A, Kitamura T, Harada N, Yokota T, Arai K. Cytokine receptors and signal transduction. Annu Rev Immunol. 1992;10:295[Medline] [Order article via Infotrieve]. 5. Kaushansky K, Karplus PA. Hematopoietic growth factors: understanding functional diversity in structural terms. Blood. 1993;82:3229[Free Full Text]. 6. Stahl N, Yancopoulos GD. The alphas, betas, and kinases of cytokine receptor complexes. Cell. 1993;74:587[Medline] [Order article via Infotrieve]. 7. Kishimoto T, Taga T, Akira S. Cytokine signal transduction. Cell. 1994;76:253[Medline] [Order article via Infotrieve]. 8. Ihle JN. STATs: signal transducers and activators of transcription. Cell. 1996;84:331[Medline] [Order article via Infotrieve]. 9. Bazan JF. A novel family of growth factor receptors: a common binding domain in the growth hormone, prolactin, erythropoietin, and IL-6 receptors, and the p75 IL-2 receptor b chain. Biochem Biophys Res Commum. 1989;164:788[Medline] [Order article via Infotrieve]. 10. D'Andrea AD, Fasman GD, Lordish HF. Erythropoietin receptor and interleukin-2 receptor beta chain: a new receptor family. Cell. 1989;58:1023[Medline] [Order article via Infotrieve]. 11. Bazan JF. Structural design and molecular evolution of a cytokine receptor superfamily. Proc Natl Acad Sci U S A. 1990;87:6934[Abstract/Free Full Text]. 12. Cosman D, Lyman SD, Idzerda RL, et al. A new cytokine receptor superfamily. Trends Biochem Sci. 1990;15:265[Medline] [Order article via Infotrieve]. 13. Dong F, Brynes RK, Tidow N, Welte K, Lowenberg B, Touw IP. Mutations in the gene for the granulocyte colony-stimulating-factor receptor in patients with acute myeloid leukemia preceded by severe congenital neutropenia [see comments]. N Engl J Med. 1995;333:487[Abstract/Free Full Text]. 14. Noguchi M, Yi H, Rosenblatt HM, et al. Interleukin-2 receptor gamma chain mutation results in X-linked severe combined immunodeficiency in humans. Cell. 1993;73:147[Medline] [Order article via Infotrieve]. 15. Hershey GK, Friedrich MF, Esswein LA, Thomas ML, Chatila TA. The association of atopy with a gain-of-function mutation in the alpha subunit of the interleukin-4 receptor [see comments]. N Engl J Med. 1997;337:1720[Abstract/Free Full Text]. 16. Mitsuyasu H, Izuhara K, Mao XQ, et al. Ile50Val variant of IL4R alpha upregulates IgE synthesis and associates with atopic asthma [letter]. Nat Genet. 1998;19:119[Medline] [Order article via Infotrieve]. 17. Dirksen U, Hattenhorst U, Schneider P, et al. Defective expression of granulocyte-macrophage colony-stimulating factor/interleukin-3/interleukin-5 receptor common beta chain in children with acute myeloid leukemia associated with respiratory failure. Blood. 1998;92:1097[Abstract/Free Full Text]. 18. Sprecher CA, Grant FJ, Baumgartner JW, et al. Cloning and characterization of a novel class I cytokine receptor. Biochem Biophys Res Commun. 1998;246:82[Medline] [Order article via Infotrieve]. 19. Elson GC, Graber P, Losberger C, et al. Cytokine-like factor-1, a novel soluble protein, shares homology with members of the cytokine type 1 receptor family. J Immunol. 1998;161:1371[Abstract/Free Full Text]. 20. Kojima T, Kitamura T. A novel signal sequence trap method using retrovirus-mediated gene transfer. Nat Biotechnol. 1999;17:487[Medline] [Order article via Infotrieve]. 21. Onishi M, Mui ALF, Morikawa Y, et al. Identification of an oncogenic form of the thrombopoietin receptor MPL using retrovirus-mediated gene transfer. Blood. 1996;88:1399[Abstract/Free Full Text]. 22. Tashiro K, Tada H, Heilker R, Shirozu M, Nakano T. Signal sequence trap: a cloning strategy for secreted proteins and type 1 membrane proteins. Science. 1993;261:600[Abstract/Free Full Text]. 23. Klein RD, Gu Q, Goddard A, Rosenthal A. Selection for genes encoding secreted proteins and receptors. Proc Natl Acad Sci U S A. 1996;93:7108[Abstract/Free Full Text]. 24. Palacios R, Steinmetz M. IL-3-dependent mouse clones that express B-220 surface antigen, contain Ig genes in germ-line configuration, and generate B lymphocytes in vivo. Cell. 1985;41:727[Medline] [Order article via Infotrieve]. 25. Dexter TM, Garland J, Scott D, Scolnick E, Metcalf D. Growth of factor dependent haemopoietic cell lines. J Exp Med. 1980;152:1036[Abstract/Free Full Text]. 26. Lee KH, Kinashi T, Tohyama K, et al. Different stromal cell lines support lineage-selective differentiation of the multipotential bone marrow stem cell clone LyD9. J Exp Med. 1991;173:1257[Abstract/Free Full Text]. 27. Greenberger JS, Sakakeeny MA, Humphries RK, Eaves CJ, Eckner RJ. Demonstration of permanent factor-dependent multipotential (erythroid/neutrophil/basophil) hematopoietic progenitor cell line. Proc Natl Acad Sci U S A. 1983;80:2931[Abstract/Free Full Text]. 28. Cerottini J-C, Engers HD, MacDonald HR, Brunner KT. Generation of cytotoxic T lymphocytes in vitro. I. Response of normal and immune mouse spleen cells in mixed leukocyte cultures. J Exp Med. 1974;140:703[Abstract]. 29. Pear WS, Nolan GP, Scott ML, Baltimore D. Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci U S A. 1993;90:8392[Abstract/Free Full Text]. 30. Ohta A, Sato N, Yahata T, et al. Manipulation of Th1/Th2 balance in vivo by adoptive transfer of antigen- specific Th1 or Th2 cells. J Immunol Methods. 1997;209:85[Medline] [Order article via Infotrieve]. 31. Kitamura T, Hayashida K, Sakamaki K, Yokota T, Arai K, Miyajima A. Reconstitution of functional human granulocyte/macrophage colony-stimulating factor (GM-CSF): evidence that AIC2B is a subunit of murine GM-CSF receptor. Proc Natl Acad Sci U S A. 1991;88:5082[Abstract/Free Full Text]. 32. Honigberg SM, Rao BJ, Radding CM. Ability of RecA protein to promote a search for rare sequences in duplex DNA. Proc Natl Acad Sci U S A. 1986;83:9586[Abstract/Free Full Text]. 33. Rigas B, Welcher AA, Ward DC, Weissman SM. Rapid plasmid library screening using RecA-coated biotinylated probes. Proc Natl Acad Sci U S A. 1986;83:9591[Abstract/Free Full Text]. 34. Teintze M, Arzimanoglou II, Lovelace CI, Xu ZJ, Rigas B. RecA-assisted rapid enrichment of specific clones from model DNA libraries. Biochem Biophys Res Commun. 1995;211:804[Medline] [Order article via Infotrieve]. 35. Noguchi CT, Bae KS, Chin K, Wada Y, Schechter AN, Hankins WD. Cloning of the human erythropoietin receptor gene. Blood. 1991;78:2548[Abstract/Free Full Text]. 36. Onishi M, Nosaka T, Misawa K, et al. Identification and characterization of a constitutive active STAT5 mutant that promotes cell proliferation. Mol Cell Biol. 1998;18:3871[Abstract/Free Full Text]. 37. Vigon I, Mornon JP, Cocault L, et al. Molecular cloning and characterization of MPL, the human homolog of the v-mpl oncogene: identification of a member of the hematopoietic growth factor receptor superfamily. Proc Natl Acad Sci U S A. 1992;89:5640[Abstract/Free Full Text]. 38. Kitamura T, Onishi M, Kinoshita S, Shibuya A, Miyajima A, Nolan GP. Efficient screening of retroviral cDNA expression libraries. Proc Natl Acad Sci U S A. 1995;92:9146[Abstract/Free Full Text]. 39. Copeland NG, Jenkins NA. Development and applications of a molecular genetic linkage map of the mouse genome. Trends Genet. 1991;7:113[Medline] [Order article via Infotrieve]. 40. Jenkins NA, Copeland NG, Taylor BA, Lee BK. Organization, distribution, and stability of endogenous ecotropic murine leukemia virus DNA sequences in chromosomes of Mus musculus. J Virol. 1982;43:26[Abstract/Free Full Text]. 41. Liao X, Buchberg AM, Jenkins NA, Copeland NG. Evi-5, a common site of retroviral integration in AKXD T-cell lymphomas, maps near Gfi-1 on mouse chromosome 5. J Virol. 1995;69:7132[Abstract]. 42. George A, Bannon L, Sabsay B, et al. The carboxyl-terminal domain of phosphophoryn contains unique extended triplet amino acid repeat sequences forming ordered carboxyl-phosphate interaction ridges that may be essential in the biomineralization process. J Biol Chem. 1996;271:32,869[Abstract/Free Full Text]. 43. Kobayashi N, Nakagawa S, Minami Y, Taniguchi T, Kono T. Cloning and sequencing of the cDNA encoding a mouse IL-2 receptor gamma. Gene. 1993;130:303[Medline] [Order article via Infotrieve]. 44. Murakami M, Narazaki M, Hibi M, et al. Critical cytoplasmic region of the interleukin 6 signal transducer gp130 is conserved in the cytokine receptor family. Proc Natl Acad Sci U S A. 1991;88:11,349[Abstract/Free Full Text]. 45. Miura O, Cleveland JL, Ihle JN. Inactivation of erythropoietin receptor function by point mutations in a region having homology with other cytokine receptors. Mol Cell Biol. 1993;13:1788[Abstract/Free Full Text]. 46. Tanner JW, Chen W, Young RL, Longmore GD, Shaw AS. The conserved box 1 motif of cytokine receptors is required for association with JAK kinases. J Biol Chem. 1995;270:6523[Abstract/Free Full Text]. 47. Goldsmith MA, Xu W, Amaral MC, Kuczek ES, Greene WC. The cytoplasmic domain of the interleukin-2 receptor beta chain contains both unique and functionally redundant signal transduction elements. J Biol Chem. 1994;269:14,698[Abstract/Free Full Text]. 48. He TC, Jiang N, Zhuang H, Quelle DE, Wojchowski DM. The extended box 2 subdomain of erythropoietin receptor is nonessential for Jak2 activation yet critical for efficient mitogenesis in FDC-ER cells. J Biol Chem. 1994;269:18,291[Abstract/Free Full Text]. 49. Quelle FW, Sato N, Witthuhn BA, et al. JAK2 associates with the beta c chain of the receptor for granulocyte- macrophage colony-stimulating factor, and its activation requires the membrane-proximal region. Mol Cell Biol. 1994;14:4335[Abstract/Free Full Text]. 50. Behrmann I, Janzen C, Gerhartz C, et al. A single STAT recruitment module in a chimeric cytokine receptor complex is sufficient for STAT activation. J Biol Chem. 1997;272:5269[Abstract/Free Full Text]. 51. Pless M, Norga K, Carroll M, Heim MH, D'Andrea AD, Mathey-Prevot B. Receptors that induce erythroid differentiation of Ba/F3 cells: structural requirements and effect on STAT5 binding. Blood. 1997;89:3175[Abstract/Free Full Text]. 52. Ferrag F, Pezet A, Chiarenza A, et al. Homodimerization of IL-2 receptor beta chain is necessary and sufficient to activate Jak2 and downstream signaling pathways. FEBS Lett 1998;421:32[Medline] [Order article via Infotrieve]. 53. Witthuhn BA, Quelle FW, Silvennoinen O, et al. JAK2 associates with the erythropoietin receptor and is tyrosine phosphorylated and activated following stimulation with erythropoietin. Cell. 1993;74:227[Medline] [Order article via Infotrieve]. 54. Jiang N, He TC, Miyajima A, Wojchowski DM. The box1 domain of the erythropoietin receptor specifies Janus kinase 2 activation and functions mitogenically within an interleukin 2 beta-receptor chimera. J Biol Chem. 1996;271:16,472[Abstract/Free Full Text]. © 2000 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: L. J. Russell, M. Capasso, I. Vater, T. Akasaka, O. A. Bernard, M. J. Calasanz, T. Chandrasekaran, E. Chapiro, S. Gesk, M. Griffiths, et al. Deregulated expression of cytokine receptor gene, CRLF2, is involved in lymphoid transformation in B-cell precursor acute lymphoblastic leukemia Blood, September 24, 2009; 114(13): 2688 - 2698. [Abstract] [Full Text] [PDF] Y.-J. Liu Thymic stromal lymphopoietin: master switch for allergic inflammation J. Exp. Med., February 21, 2006; 203(2): 269 - 273. [Abstract] [Full Text] [PDF] N. Carpino, W. E. Thierfelder, M.-s. Chang, C. Saris, S. J. Turner, S. F. Ziegler, and J. N. Ihle Absence of an Essential Role for Thymic Stromal Lymphopoietin Receptor in Murine B-Cell Development Mol. Cell. Biol., March 15, 2004; 24(6): 2584 - 2592. [Abstract] [Full Text] [PDF] K. Ozaki and W. J. Leonard Cytokine and Cytokine Receptor Pleiotropy and Redundancy J. Biol. Chem., August 9, 2002; 277(33): 29355 - 29358. [Full Text] [PDF] N. Shah, L. Oseth, H. Tran, B. Hirsch, and T. W. LeBien Clonal Variation in the B-Lineage Acute Lymphoblastic Leukemia Response to Multiple Cytokines and Bone Marrow Stromal Cells Cancer Res., July 1, 2001; 61(13): 5268 - 5274. [Abstract] [Full Text] [PDF] P. A. Reche, V. Soumelis, D. M. Gorman, T. Clifford, M.-r. Liu, M. Travis, S. M. Zurawski, J. Johnston, Y.-J. Liu, H. Spits, et al. Human Thymic Stromal Lymphopoietin Preferentially Stimulates Myeloid Cells J. Immunol., July 1, 2001; 167(1): 336 - 343. [Abstract] [Full Text] [PDF] E. Chklovskaia, C. Nissen, L. Landmann, C. Rahner, O. Pfister, and A. Wodnar-Filipowicz Cell-surface trafficking and release of flt3 ligand from T lymphocytes is induced by common cytokine receptor {gamma}-chain signaling and inhibited by cyclosporin A Blood, February 15, 2001; 97(4): 1027 - 1034. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Fujio, K. Articles by Kitamura, T. Search for Related Content PubMed PubMed Citation Articles by Fujio, K. Articles by Kitamura, T. Related Collections Plenary Papers Social Bookmarking                   What's this?

	Copyright © 2000 by American Society of Hematology         Online ISSN: 1528-0020