Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nie, D.
Right arrow Articles by Honn, K. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nie, D.
Right arrow Articles by Honn, K. V.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 95 No. 7 (April 1), 2000: pp. 2304-2311

HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY

Eicosanoid regulation of angiogenesis: role of endothelial arachidonate 12-lipoxygenase

Daotai Nie, Keqin Tang, Clement Diglio, and Kenneth V. Honn

From the Departments of Radiation Oncology and Pathology, Wayne State University School of Medicine, and the Karmanos Cancer Institute, Detroit, MI.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Angiogenesis, the formation of new capillaries from preexisting blood vessels, is a multistep, highly orchestrated process involving vessel sprouting, endothelial cell migration, proliferation, tube differentiation, and survival. Eicosanoids, arachidonic acid (AA)-derived metabolites, have potent biologic activities on vascular endothelial cells. Endothelial cells can synthesize various eicosanoids, including the 12-lipoxygenase (LOX) product 12(S)-hydroxyeicosatetraenoic acid (HETE). Here we demonstrate that endogenous 12-LOX is involved in endothelial cell angiogenic responses. First, the 12-LOX inhibitor, N-benzyl-N-hydroxy-5-phenylpentanamide (BHPP), reduced endothelial cell proliferation stimulated either by basic fibroblast growth factor (bFGF) or by vascular endothelial growth factor (VEGF). Second, 12-LOX inhibitors blocked VEGF-induced endothelial cell migration, and this blockage could be partially reversed by the addition of 12(S)-HETE. Third, pretreatment of an angiogenic endothelial cell line, RV-ECT, with BHPP significantly inhibited the formation of tubelike/cordlike structures within Matrigel. Fourth, overexpression of 12-LOX in the CD4 endothelial cell line significantly stimulated cell migration and tube differentiation. In agreement with the critical role of 12-LOX in endothelial cell angiogenic responses in vitro, the 12-LOX inhibitor BHPP significantly reduced bFGF-induced angiogenesis in vivo using a Matrigel implantation bioassay. These findings demonstrate that AA metabolism in endothelial cells, especially the 12-LOX pathway, plays a critical role in angiogenesis. (Blood. 2000;95:2304-2311)

© 2000 by The American Society of Hematology.


    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The formation of new capillaries from preexisting vessels, a process termed angiogenesis, is tightly regulated in physiologic processes such as embryonic development, wound repair, and hypertrophy of normal organs. In contrast, persistent unregulated angiogenesis underscores many pathologic conditions, such as tumor growth and metastasis, diabetic retinopathy, atherosclerosis, and chronic inflammation. Angiogenesis is a complex process involving an extensive interplay between cells, soluble factors, and extracellular matrix molecules that culminate in the proliferation, migration, and tube differentiation of endothelial cells.1 A plethora of angiogenesis regulators such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) can elicit various angiogenic responses from endothelial cells.2 An understanding of endothelial cell metabolism and the signaling that underlies angiogenesis is important because it provides potential therapeutic targets to inhibit or enhance angiogenesis.

12-lipoxygenases (12-LOX) are a family of isozymes that belong to the LOX superfamily. These enzymes catalyze the stereospecific oxygenation of arachidonic acid (AA) to form 12(S)-hydroperoxyeicosatetraenoic acid (HPETE) and 12(S)-hydroxyeicosatetraenoic acid (HETE). At least 3 types of 12-LOX have been well characterized: platelet-type, leukocyte-type, and epidermal 12-LOX.3 Platelet-type 12-LOX exclusively uses AA released from glycerophospholipid pools to synthesize 12(S)-HPETE and 12(S)-HETE, whereas leukocyte-type 12-LOX can also synthesize 15(S)-HETE and 12(S)-HETE. In addition to leukocytes and platelets, the expression of 12-LOX isozymes has been detected in various types of cells, such as smooth muscle cells,4 keratinocytes,5 endothelial cells,4,6 and tumor cells. Elevated 12-LOX activity has been implicated in hypertension,7 vaso-occlusion in sickle cell disease,8 inflammation,9 thrombosis,10 and mouse skin tumor development.5 In human prostate carcinoma, the level of 12-LOX expression has been correlated with tumor stage.11 Along this line, we recently demonstrated that the overexpression of platelet-type 12-LOX in human prostate cancer PC3 cells stimulated tumor growth by elaborating tumor angiogenesis.12

In endothelial cells, it has been shown that 12-LOX activity is required for serum- and bFGF-stimulated endothelial cell proliferation13,14 and for minimally modified low-density lipoprotein-induced monocyte binding to endothelial cells.15 It has been shown that 12(S)-HETE can directly stimulate endothelial cell mitogenesis,13,16 migration,12 and surface expression of alpha vbeta 3 integrin.17-20 Because endothelial cell proliferation and migration and increased levels of surface alpha vbeta 3 integrin21-23 are involved in angiogenesis, these observations prompted us to investigate the functional role of endothelial 12-LOX in angiogenesis. Here we report that endothelial 12-LOX activity is required for endothelial cell proliferation, migration, and tube differentiation in vitro and angiogenesis in vivo. This study suggests the importance of arachidonic acid metabolism in endothelial cell signaling as it relates to angiogenesis.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Inhibitors

BHPP, a 12-LOX inhibitor as previously described,24 was a generous gift from Biomide (Grosse Pointe Farms, MI). The IC50 for BHPP to inhibit platelet-type 12-LOX activity in tumor cells is approximately 0.2 to 1 µmol/L, depending on cell type.24,25 BHPP does not appreciably inhibit 5(S)-HETE or 15(S)-HETE synthesis in highly metastatic B16a cells.25 Using recombinant enzymes, the IC50 of BHPP for the murine platelet-type 12-LOX is 0.8 µmol/L with arachidonic acid as a substrate. The rank of selectivity of BHPP for lipoxygenase inhibition is murine platelet-type 12-LOX > murine epidermis-type 12-LOX > human 5-LOX >> murine leukocyte 12-LOX >>  rabbit 15-LOX-1 (Furstenberger G, personal communication). Because of its selectivity toward the platelet-type 12-LOX, BHPP was extensively used in the current study. Other inhibitors for AA metabolism---5-, 8-, 11-, and 14-eicosatetraynoic acid (ETYA), nordihydroguaiaretic acid (NDGA), 5-LOX-activating protein (FLAP) inhibitor MK886, and cyclooxygenase (COX) inhibitor indomethacin---were purchased from Calbiochem (San Diego, CA). Their sites of action are illustrated in Figure 1.


View larger version (18K):
[in this window]
[in a new window]
 
Fig 1. Scheme of AA metabolism. The AA released from phospholipids by PLA2 activity is metabolized by the COX pathways to various prostaglandins and thromboxanes (left), by the LOX pathways to various HETEs, leukotrienes, and lipoxins42-44 (middle), and by P-450 epoxygenase to epoxyeicosatrienoic acids (right). The proposed site of action for the inhibitors used in this study is shown in parentheses.

Cell culture

The cord-forming angiogenic endothelial cell line RV-ECT was isolated from the RV-EC cell line established from rat brain resistance vessels as previously described.26 The mouse capillary endothelial cell line CD4 was originally established from mouse lung capillary blood vessels.27 Both the RV-ECT and the CD4 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS). Human umbilical vein endothelial cells (HUVEC) and human foreskin dermal microvascular endothelial cells (HMVEC) were purchased from Clonetics (San Diego, CA), multiplied in EGM-2, and used from passages 4 to 10.

Detection of 12-LOX expression by reverse transcription-polymerase chain reaction

Total RNA was isolated from semiconfluent (70% to 80%) endothelial cells using Tri-reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer's recommendations. After total RNA was isolated, it was further washed with 2 mol/L LiCl/5 mmol/L EDTA to reduce possible contamination from genomic DNA. Total RNA was reverse transcribed with oligo dT using Moloney murine leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD). To detect the expression of platelet-type 12-LOX in human endothelial cells, nested polymerase chain reaction (PCR) was conducted using primers located in different exons of the human platelet-type 12-lipoxygenase to ensure the differentiation of PCR products from cDNA or genomic DNA as previously described.11 The size of the first-round PCR product was approximately 590 bp and the second-round PCR approximately 190 bp. Negative controls with no reverse transcriptase added were also used to detect the possibility of false-positive signals. The PCR products were analyzed using 2% agarose gel.

To confirm further the expression of platelet-type 12-LOX in rat RV-ECT endothelial cells, primers were designed based on the partial sequence of rat platelet-type 12-LOX obtained from rat Walker 256 cells24 because full-length rat platelet-type 12-LOX has not been cloned or sequenced. Total RNA was isolated using tri-reagent, and the cDNA sequence was synthesized using adapter primer according to the standard protocol from Gibco BRL's 3' RACE kit (Rapid Amplification of cDNA Ends kit; #18,73-027; Life Technologies). Three different combinations of primers were used for nested PCR. The first combination yielded the final product of 111 bp with the first-round PCR primer set of AGACAATAGCAGCAGACT (1 U) and TAGACGGTTCCAGCTT (137 L) and the second-round primer set of TGACCTCCCTCCAAACAT (26 U) and CTCAGGGTATAAACA (119 L). The second combination yielded the final product of 62 bp using AGACAATAGCAGCAGACT (1 U) and CTCAGGGTATAAACA (119 L) as the first-round primer set and TGACCTCCCTCCAAACAT (26U) and TCAGCGTCCATTCTAAGT (70L) as the second PCR primer set. The expected product size of the third combination was 88 bp using CAGGAGACAATGCTTTTGGAC (LOS2) and GAACAACTCATCATCCTGCC (LO-AS2) as the first PCR primer set and AGACAATAGCAGCAGACT (1 U) and TCAGCGTCCATTCTAAGT (70 L) as the second primer ser. The final PCR products were analyzed using 2% agarose gel.

To study the expression of leukocyte-type 12-LOX in RV-ECT, the following pairs of primers were designed based on the leukocyte-type 12-LOX sequence characterized from rat brain and used for nested PCR: first-round PCR primers, GCCCAGGAGCCAAACGACAT (lower primer) and CATCTTCTGAGGGGACACTT (upper primer). The expected size of the first-round PCR product was 695 bp. The expected size of second-round PCR product was 342 bp using GCATTAGGAACCCAGTAGAA (lower primer) and ACCTATTGCTCATTGTGTCC (upper primer) as second-round PCR primers.

Immunoblot analysis of 12-LOX expression

Semiconfluent confluent (70% to 80%) HUVEC, HMVEC, RV-EC, RV-ECT, and CD4 endothelial cells were rinsed with ice-cold PBS, scraped into lysis buffer containing 20 mmol/L Tris-HCl, pH 7.5, 2 mmol/L EDTA, 0.5 mmol/L EGTA, 0.5 mmol/L phenylmethylsulfonyl fluoride, 0.5 mmol/L leupeptin, 0.15 mmol/L pepstatin A, 1 mmol/L dithiothreitol, and 1% NP-40. Protein concentration was measured using BCA protein assay kit (Pierce, Rockford, IL). Human platelet lysates (10-40 ng) or human epidermoid carcinoma A431 cell lysates (30 µg) were used for positive control. Cell lysates (80 µg) from each sample were loaded onto a minigel for electrophoresis separation. The proteins in the gel were then transferred onto a polyvinylidene difluoride membrane and processed for immunodetection using a rabbit polyclonal antibody to human platelet-type 12-LOX obtained from Oxford Biomedical Research (Oxford, MI). This antibody reacts strongly with platelet-type 12-LOX from various species, with slight cross-reactivity with 5-LOX and 15-LOX at higher concentrations. Horseradish peroxidase-conjugated goat antirabbit IgG antibodies and enhanced chemiluminescent reagent was purchased from Amersham (Arlington Heights, IL).

Measurement of 12(S)-HETE levels by enzyme immunoassay

To measure 12(S)-HETE synthesis in cell culture, RV-ECT cells (4 × 106 cells) were plated and grown to 80% to 90% confluence in DMEM supplemented with 10% FBS and then serum starved overnight in serum-free DMEM. Fresh serum-free DMEM with 1 µmol/L arachidonic acid was added 1 hour before VEGF treatment. BHPP was added to a final concentration of 10 µmol/L 30 minutes before VEGF treatment. Recombinant human VEGF was added in a final concentration of 10 ng/mL. After 30 minutes of treatment, cells were washed in PBS once and harvested using cell scrapers. After centrifugation, the cell pellets were resuspended in cell lysis buffer and sonicated. Lipids were extracted from cell lysates by adding ethanol to a final concentration of 15%. After centrifugation at 375g for 10 minutes at 4°C, the supernatants were acidified to pH 3.5 with 3% formic acid and applied to BAKERBOND spe Octadecyl (C18) columns (J.T. Baker, Phillipsburg, NJ). After washing with ddH2O, 15% ethanol, and petroleum ether, lipids were eluted with ethyl acetate and dried under N2 gas, and 12(S)-HETE levels were measured using an EIA kit according to the manufacturer's instructions (Assay Designs, Ann Arbor, MI). To measure 12(S)-HETE levels in Matrigel (Becton Dickinson, Bedford, MA) implants, resected Matrigel plugs were homogenized in cell lysis buffer and processed for lipid extraction and 12(S)-HETE measurement.

Stable transfection of CD4 endothelial cells and characterization

Semiconfluent CD4 endothelial cells were transfected with a pcDNA 3.1 expression construct containing human platelet-type 12-lipoxygenase cDNA, which was a gift from Dr Colin Funk (University of Pennsylvania). Empty vector was used as a control. Transfection was performed using lipofectin reagent (Life Technologies). Transfectants were selected using 300 µg/mL geneticin (G418) in DMEM with 10% FBS. The expression of 12-LOX in CD4 transfectants was characterized by reverse transcription (RT)-PCR and Northern blot analysis for mRNA expression and by immunoblot for 12-LOX protein expression.

Endothelial cell proliferation assay

HUVEC cells were used to study the effects of 12-LOX inhibitors on endothelial cell proliferation. Cells were harvested by trypsinization, resuspended in EGM-2, and plated in a 96-well plate at 2000 cells per well. After overnight incubation, the media were changed to fresh EBM-2 with 1% FBS and treated with recombinant human VEGF-A or bFGF (R&D Systems, Minneapolis, MN) plus various amounts of BHPP. The concentrations of BHPP used were 0, 1, 10, and 50 µmol/L unless otherwise indicated. The final concentration of recombinant human VEGF and bFGF was 10 ng/mL. After 2 days, the plates were processed to quantitate the number of cells using an MTS cell proliferation assay kit (Promega, Madison, WI). The absorbance at 490 nm (A490) indicated the relative number of cells.

The determination of the in vitro growth kinetics of CD4 12-LOX transfectants in culture was conducted essentially as previously described.12 Basically, 2 × 103 cells were seeded onto 96-well culture plates in complete medium, and the number of viable cells at 48-hour intervals was assessed using an MTS cell proliferation assay kit. The A490 reading 2 to 3 hours after plating was used as a baseline. The number of cells was expressed as the percentage of increase from the A490 baseline.

Endothelial cell migration assay

RV-ECT endothelial cell migration assay was performed essentially as previously described.12 VEGF (10 ng/mL), bFGF (10 ng/mL), or various other treatments were placed in the lower chamber. For each treatment, at least 3 chambers were used unless otherwise indicated. The migration assay for CD4 12-LOX transfectants was conducted in a similar way except that the number of cells seeded was 1 × 105 per chamber. The migrated cells were counted by a person unaware of the treatment regimen (blinded approach).

Endothelial cell tube/cord formation assay

Cord-forming RV-ECT cells or CD4 transfectants (1 × 105) were plated on a 24-well plate precoated with a thin layer of Matrigel (Becton Dickinson). After overnight incubation, BHPP was added. After 24 hours of treatment, the media were removed and the confluent monolayer was overlaid with 0.5 mL diluted Matrigel (Becton Dickinson; final concentration, 5 mg/mL). After solidifying at 37°C, 0.5 mL DMEM-10% FBS medium was carefully added without disturbing the gel. The formation of a tubelike structure was monitored microscopically every 6 hours and recorded.

Matrigel implantation assay for angiogenesis

The Matrigel (Becton Dickinson) implantation assay was performed as described by Ito et al28 with the following modifications. Matrigel 0.4 mL premixed with bFGF (5 µg/ml) with and without BHPP (0.9 mg/ml) was injected subcutaneously into nude mice (4 mice/group). Mice were killed 5 days after injection and dissected to expose the implants for recording using an SP SZ-4060 stereomicroscope (Olympus America, Melville, NY). The amount of blood retained in the Matrigel was further assessed by measuring the hemoglobin levels using Drabkin's reagent (Sigma Diagnostics, St. Louis, MO).


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

12-Lipoxygenase expression and activity in endothelial cells

Several studies have provided evidence that endothelial cells synthesize various lipoxygenase products such as 5(S)-HETE, 12(S)-HETE, and 15(S)-HETE.16 The expression of platelet-type 12-LOX in HUVEC cells was previously detected by RT-PCR.6 Using primers selective for platelet-type 12-LOX, the expression of 12-LOX mRNA was confirmed in HUVEC cells and also detected in microvascular endothelial cells, HMVEC (Figure 2A). In RV-ECT, an endothelial cell line derived from rat brain resistance microvessel, a faint band of PCR product was also present (Figure 2A). To further confirm the expression of platelet-type 12-LOX in RV-ECT cells, we designed 7 primers on the basis of the partial sequence obtained from rat Walker 256 cells.24 The expression of platelet-type 12-LOX was detected by nested PCR using 3 different combinations of these 7 primers (Figure 2B). Interestingly, in addition to platelet-type 12-LOX, RV-ECT cells also expressed another isoform of 12-LOX that presumably was leukocyte-type as detected by using primers designed on the basis of the rat leukocyte-type 12-LOX sequence29 (data not shown), suggesting that RV-ECT cells expressed both platelet- and leukocyte-type 12-LOX.


View larger version (19K):
[in this window]
[in a new window]
 
Fig 2. Expression of platelet-type 12-LOX in endothelial cells and its role in cell proliferation. (A) RT-PCR detection of 12-LOX expression in endothelial cells. Total RNA was isolated and processed for double-round RT-PCR using primers designed on the basis of human platelet-type 12-LOX sequence as described in "Materials and Methods." Control, no RNA present in PCR or RT reaction mixtures as controls for the quality of PCR; RT(-), no reverse transcriptase present in RT reaction mixtures as controls for the possible contamination of DNA in RNA samples; RT(+), reverse transcription present. (B) RT-PCR detection of platelet-type 12-LOX expression in RV-ECT cells. The primer combinations for 1st, 2nd, and 3rd are described in "Materials and methods." The target sizes of the final PCR product from 1st, 2nd, and 3rd primer combinations are 111 bp, 62 bp, and 88 bp, respectively. (C) Immunoblot analysis of 12-LOX expression in endothelial cells. The blot was probed with a rabbit polyclonal antibody to human platelet-type 12-LOX. (D) Inhibition of VEGF-stimulated 12-LOX activity by BHPP. Cell treatment and measurement of 12(S)-HETE are detailed in "Materials and methods." Columns, average levels of 12(S)-HETE per 1 × 106 cells (n = 3); bars, SE. a, P < .01 when compared with the unstimulated control; b, P < .05 when compared to the VEGF-stimulated cells. (E) Involvement of endothelial 12-LOX in bFGF- or VEGF-stimulated cell proliferation. HUVEC cells were plated in 96-well culture plates. Cell proliferation was stimulated with 10 ng/mL bFGF (open triangle) or 10 ng/mL VEGF (filled circle) in EBM-2 with 2% FBS. Cells with no bFGF or VEGF stimulation were used as controls (open circle). 48 hours after treatment with graded levels of BHPP, cell numbers were measured by an MTS method as described in "Materials and methods." Data point, mean from quadruplicate determination; bars, SE from quadruplicate of treatment.

Immunoblot analysis using a rabbit polyclonal antibody against human platelet-type 12-LOX revealed that 12-LOX is also expressed in endothelial cells at the protein level. As shown in Figure 2C, primary cultures of HUVEC and HMVEC had the highest levels of 12-LOX expression, whereas CD4, an endothelial cell line derived from mouse pulmonary microvasculature,27 had the lowest 12-LOX expression.

When RV-ECT cells were treated with VEGF for 30 minutes, a 5-fold increase in 12(S)-HETE biosynthesis was observed (Figure 2D). The increased 12-LOX activity was inhibited by pretreating RV-ECT cells with BHPP (10 µmol/L). Because BHPP is 20-fold more selective toward platelet-type 12-LOX than leukocyte-type 12-LOX, the results suggest that the increased 12(S)-HETE synthesis on VEGF treatment was probably caused by the increased activity of platelet-type 12-LOX.

It has been shown that arachidonic acid metabolism through the LOX pathways, especially the 12-LOX pathway, is involved in endothelial cell proliferation stimulated by serum or bFGF.13,14 As shown in Figure 2E, inhibition of 12-LOX activity by BHPP significantly inhibited bFGF- or VEGF-stimulated HUVEC proliferation, suggesting that 12-LOX activity is required for the endothelial cell proliferative responses to bFGF or VEGF.

Involvement of endogenous 12-lipoxygenase in endothelial cell migration

Endothelial cell migration is a requisite step in angiogenesis. It has been shown that the activation of phospholipase A2 is required for endothelial cell migration in response to bFGF.30 To study whether AA released by phospholipase A2 modulates endothelial cell migration, we selected the RV-ECT cell line, which can grow in DMEM-10% FBS without bFGF or VEGF supplementation,26 for cell migration assay. First we examined the migratory response of RV-ECT cells toward exogenous AA, bFGF, and VEGF. As shown in Figure 3A, AA increased endothelial cell migration by 70% to 80%, a level comparable to that of bFGF but less than VEGF. This observation is consistent with the report that VEGF is a stronger chemotactic factor than bFGF.31 Because mobilization of AA has been observed in endothelial cells on stimulation with angiogenic factors such as VEGF,32 bFGF,33 and angiogenin,34 we studied the effect of various inhibitors of arachidonic acid metabolism on endothelial cell migration stimulated by VEGF. As shown in Figure 3B, ETYA, a promiscuous inhibitor for AA metabolism, inhibited VEGF-stimulated RV-ECT migration. NDGA, a general LOX inhibitor, also significantly reduced VEGF-stimulated RV-ECT migration. In contrast, indomethacin, a general COX inhibitor, had no effect. The results suggest that the LOX pathway, but not the COX pathway, of AA metabolism is involved in RV-ECT migration.





View larger version (15251817K):
[in this window]
[in a new window]
 
Fig 3. Arachidonate metabolites in endothelial cell migration. The migration assays were performed as described in "Materials and methods." (A) Stimulation of RV-ECT migration by arachidonic acid (1 µmol/L), bFGF (10 ng/ml), and VEGF (10 ng/ml). (B) VEGF-stimulated RV-ECT migration involves lipoxygenase-dependent arachidonic acid metabolism. Treatment: VEGF, 10 ng/mL; ETYA, 5 µmol/L; NDGA, 50 µmol/L; indomethacin, 50 µmol/L. -, absence of treatment (vehicle only); +, presence of treatment. (C) Differential effects on RV-ECT cell migration by various HETEs. (D) Modulation of RV-ECT cell migration by 12-LOX inhibitor BHPP and 12(S)-HETE. Columns, percentage of the average number of cells migrated when compared with the controls; bars, SE (a, P < .05; b, P < 0.01; Student's t test). All migration assays were repeated at least 4 times.

In the LOX pathways, AA can be used by 5-LOX to synthesize 5(S)-HETE and leukotrienes, by 12-LOX to synthesize mainly 12(S)-HETE, and by 15-LOX to synthesize15(S)-HETE. To delineate which pathway(s) is involved in endothelial cell migration, we first studied the effect of various types of HETEs on RV-ECT cell migration. As shown in Figure 3C, among the various types of HETEs tested, only 12(S)-HETE, but not 5(S)-HETE, 15(S)-HETE, or 12(R)-HETE, could stimulate endothelial cell migration. The stimulation of endothelial cell migration by 12(S)-HETE is consistent with previous observations.12 To study whether the endogenous synthesis of 12(S)-HETE is involved in endothelial cell migration in response to VEGF, we examined the effect of BHPP on VEGF-stimulated endothelial cell migration. As shown in Figure 3D, BHPP inhibited VEGF-stimulated RV-ECT endothelial cell migration. Furthermore, exogenous 12(S)-HETE partially reversed the inhibitory effect of BHPP on RV-ECT migration (Figure 3D). We also tested the effect of an inhibitor of the 5-LOX pathway, ie, MK886, on VEGF-stimulated RV-ECT migration and did not observe any appreciable effects at a concentration of 10 µmol/L (data not shown). These results collectively suggest that 12-LOX activity and 12(S)-HETE are involved in endothelial cell migration.

Endothelial 12-lipoxygenase was involved in RV-ECT tube differentiation

Certain endothelial cell lines, under proper culture conditions, have the capacity to form tubelike structures. Confluent RV-ECT cells can spontaneously form cordlike structures under normal culture conditions.26 Therefore, this cell line was chosen for the current study. When RV-ECT cells were cultured between 2 layers of Matrigel, the formation of cordlike structures was expedited, as manifested by the formation of numerous vacuoles within 4 to 5 hours and interconnected tubelike structures within 24 hours (Figures 4A, 4C). Pretreatment of RV-ECT cells with BHPP (10 µmol/L) significantly impaired their ability to form cordlike structures (Figures 4B, 4D), suggesting the potential involvement of 12-LOX in endothelial cell cordlike differentiation.


View larger version (127K):
[in this window]
[in a new window]
 
Fig 4. Involvement of 12-LOX in endothelial cell tubelike differentiation. The formation of cordlike structures by RV-ECT cells was facilitated by Matrigel as detailed in "Materials and methods." (A) RV-ECT treated with ethanol as control. Original magnification, ×40. (B) RV-ECT treated with 10 µmol/L BHPP. Original magnification, ×40. (C) RV-ECT treated with ethanol as control. Original magnification, ×100. (D) RV-ECT treated with 10 µmol/L BHPP. Original magnification, ×100. Shown here are typical observations from 4 independent studies on the tube-forming ability of RV-ECT and the effect of BHPP.

Endothelial cells that overexpress 12-LOX had increased motility and enhanced tubelike differentiation

To further explore the role of 12-LOX in endothelial cell migration and tubelike differentiation, we transfected CD4 endothelial cells with a pcDNA-12-LOX expression construct. The CD4 endothelial cell line was selected for 12-LOX overexpression study because of its low level of 12-LOX expression (Figure 2C). Stable transfectants were selected using G418, and the transfectant pools were characterized for the expression of 12-LOX mRNA by RT-PCR (Figure 5A) and Northern blot analysis (Figure 5B). The expression of 12-LOX was also increased in 12-LOX-transfected CD4 cells at protein levels as revealed by Western blot (Figure 5C). The growth rate of 12-LOX-transfected CD4 endothelial cells was similar to the mock transfectants (data not shown), suggesting that although 12-LOX is involved in bFGF- or VEGF-stimulated endothelial cell growth, the overexpression of 12-LOX in CD4 cells is not sufficient to stimulate endothelial cell proliferation. However, the overexpression of 12-LOX was able to stimulate CD4 endothelial cell migration (Figure 5D). Further, the increased motility in 12-LOX-transfected CD4 cells was inhibited by BHPP, suggesting that it is the increased 12-LOX activity in endothelial cells that enhances cell motility (Figure 5D).


View larger version (36K):
[in this window]
[in a new window]
 
Fig 5. Stimulation of endothelial cell migration and tubelike differentiation by the overexpression of 12-LOX in endothelial cells. CD4 cells were transfected with a 12-LOX expression construct or an empty vector as a control. (A) Detection of 12-LOX mRNA expression by RT-PCR. Primers were the pair of the primers for the first round of PCR. The reaction was carried out for 30 cycles. Control, no RNA present in PCR or RT reaction mixtures as controls for the quality of PCR; RT(-), no reverse transcription present in RT reaction mixtures as controls for the possible contamination of DNA in RNA samples; RT(+), reverse transcription present. Vector, CD4 cells transfected with pcDNA 3.1; LOX, CD4 cells transfected with pcDNA construct with 12-LOX cDNA insert. (B) Northern blot analysis of 12-LOX mRNA levels. Control, loading buffer as the blank control. (C) Analysis of 12-LOX expression at the protein level by immunoblot. (D) Increased cell migration in CD4 12-LOX transfectants. The migration assay was performed as detailed in "Materials and methods" using CD4 cells transfected with pcDNA (open circle) or pcDNA 12-LOX construct (filled circle). Data point, mean from 30 fields counted; bars, SE. The migration assay was repeated for 3 times with similar results. (E) Increased formation of tubelike structures in CD4 12-LOX transfectants. Left panel, vector control; right panel, 12-LOX transfected CD4 cells.

When cultured within 2 layers of Matrigel, CD4 vector transfectants did not form tubelike structures (Figure 5E, left panel). In contrast, under identical conditions, CD4 12-LOX transfectants retracted and formed tubelike structures (Figure 5E, right panel). The results further suggest the involvement of 12-LOX in endothelial cell tube differentiation.

Inhibition of angiogenesis in vivo by 12-lipoxygenase inhibitor

The involvement of the 12-LOX pathway of arachidonic acid metabolism in endothelial cell proliferation, migration, and tube differentiation led us to study whether the inhibition of 12-LOX activity can compromise angiogenesis in vivo. Because the induction of angiogenesis in vivo by bFGF requires the angiogenic activities of VEGF,35 we used bFGF premixed with Matrigel to induce angiogenesis. As shown in Figure 6A, bFGF induced massive angiogenesis around and within the implant (upper panel, left). When dissected out, the implanted Matrigel retained a large volume of blood within the gel (upper panel, right). Matrigel implants without bFGF had little or no angiogenic activities in vivo (bottom panel). Inclusion of the 12-LOX inhibitor BHPP in the implants significantly reduced the ability of bFGF to induce angiogenesis (Figure 6A, middle panel), suggesting that 12-LOX is involved in angiogenesis in vivo. Figure 6B shows the hemoglobin levels in the dissected Matrigel. As shown in the Figure, BHPP significantly reduced the hemoglobin levels in Matrigel (P < .05), suggesting a reduction of angiogenesis. The reduction of angiogenesis was closely correlated with the levels of 12(S)-HETE in the Matrigel implants as shown in Figure 6C. Taken together, the data suggest a critical role of 12-LOX activity in angiogenesis in vivo.


View larger version (41K):
[in this window]
[in a new window]
 
Fig 6. Attenuation of angiogenesis in vivo by 12-LOX inhibitors. Matrigel implantation assay for angiogenesis was performed as described in "Materials and methods" and repeated at least 3 times with similar results. (A) Matrigel implantation angiogenesis assay. Top panel: left, bFGF (5 µg/mL Matrigel) in situ; right, bFGF (5 µg/mL Matrigel) resected Matrigel. Middle panel: left, bFGF (5 µg/mL Matrigel) and BHPP (0.8 mg/mL Matrigel) in situ; right, bFGF (5 µg/mL Matrigel) and BHPP (0.8 mg/mL Matrigel) resected implant. Bottom panel: left, Matrigel alone in situ; right, resected Matrigel blank control. (B) Hemoglobin levels in resected implants. The hemoglobin was measured by Drabkin's reagent. Columns, hemoglobin levels normalized with protein concentrations. Bars, SE from quadruplicate samples. (C) 12(S)-HETE levels in resected implants. Lipids were extracted from the resected implants, and 12(S)-HETE levels were measured as described in "Materials and methods." Columns, average 12(S)-HETE levels normalized with protein concentrations. Bars, SE (n = 4 for Matrigel control; n = 3 for bFGF; n = 5 for bFGF plus BHPP).


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

In this study we demonstrated that endothelial cells from different species (rat and human) and different organs (brain, umbilical cord, and foreskin) express platelet-type 12-LOX and elucidated its important role in endothelial cell responses to angiogenic stimuli. Inhibition of 12-LOX activity by BHPP, a platelet-type selective inhibitor, attenuated the endothelial cell mitogenic and the migratory responses to the angiogenic factors bFGF and VEGF and the tubelike differentiation on Matrigel. Forced expression of 12-LOX in the CD4 endothelial cells stimulated cell migration and promoted tube differentiation. Inhibition of 12-LOX activity by BHPP significantly reduced angiogenesis in vivo. Our findings suggest that eicosanoids from the arachidonic acid metabolism through the 12-LOX pathway, ie 12(S)-HETE, are involved in modulating angiogenesis.

There are seemingly conflicting reports regarding the isozymes of 12-LOX expressed in endothelial cells as both leukocyte type 12-LOX4 and platelet-type 12-LOX6 are reported. In the current study, we demonstrated that platelet-type 12-LOX was expressed in HUVEC and HMVEC as well as in RV-ECT, an endothelial cell line originally isolated from rat brain resistance blood vessels.26 RV-ECT cells also express another isoform of 12-LOX originally isolated from rat brain and close to leukocyte-type.29 When RV-ECT cells were treated with VEGF, there was a 5-fold increase in 12(S)-HETE biosynthetic activity inhibitable by BHPP pretreatment. Because BHPP is much more selective toward platelet-type 12-LOX than leukocyte-type (Furstenberger G, personal communication), the results suggest that it is the platelet-type 12-LOX, not the leukocyte-type 12-LOX, that is activated in endothelial cells during angiogenic responses.

Arachidonic metabolites have been implicated in angiogenesis since the inhibition of arachidonic acid metabolism by alpha -guaiaconic acid (GR-12) attenuated endothelial cell migration, tube formation, and angiogenesis in vivo.36 Cellular mobilization of AA is usually achieved by PLA2 cleavage of phospholipids. The activation of PLA2 and the subsequent mobilization of AA have been observed in endothelial cells in response to various extracellular cues such as angiogenin, bFGF, zinc, and phorbol ester.33,34,37,38 As a potent angiogenic factor, bFGF stimulates the migration and proliferation of vascular endothelial cells. Abrogation of the release of AA in endothelial cells by the inhibition of PLA2 activity inhibited bFGF-stimulated cell proliferation14 and migration.30 VEGF also can rapidly increase phosphorylation and activity of cytosolic PLA2 and stimulate the release of AA in HUVEC.32 In a recent study, it was shown that the inhibition of PLA2 activity in granuloma by SB 203 347 significantly reduced angiogenesis,39 suggesting that the activation of PLA2 and the subsequent mobilization of AA and lysophospholipid are intrinsic steps during angiogenesis.

The downstream events for released AA include the synthesis of various prostaglandins and thromboxanes through the COX pathway, various HETEs and lipoxins42-44 through the LOX pathways, and various epoxyeicosatrienoic acids through cytochrome P-450 epoxygenase. In this study, we found that ETYA, a general inhibitor for arachidonic acid-derived metabolism, and NDGA, an agent that can inhibit LOX activity, inhibited endothelial cell migration stimulated by VEGF. On the other hand a general COX inhibitor, indomethacin, had no appreciable effect. In contrast, BHPP, which is a selective platelet-type 12-LOX inhibitor, blocked VEGF-stimulated endothelial cell migration. The involvement of 12-LOX and its AA metabolite in endothelial cell migration was further strengthened by the observations that exogenously added 12(S)-HETE directly stimulated RV-ECT migration and partially reversed the inhibitory effect of BHPP on cell migration. Finally, the overexpression of 12-LOX in CD4 endothelial cells significantly stimulated cell migration in a 12-LOX activity-dependent manner. The findings collectively suggest the role of endothelial 12-LOX and its AA metabolite, 12(S)-HETE, in endothelial cell migration.

In addition to its role in endothelial cell migration, we found that 12-LOX is involved in endothelial cell tube formation. Pretreatment of the RV-ECT cell line with BHPP significantly inhibited the formation of vessel-like structures within Matrigel. The second line of evidence is the observation that the overexpression of 12-LOX in CD4 endothelial cells promoted the formation of tubelike structures on Matrigel. Interestingly, it has been extensively documented that exogenous 12(S)-HETE can induce a reversible retraction of endothelial cell monolayers cultured on collagen by regulating PKC and alpha Vbeta 3 integrin.40,41 It remains to be determined, however, whether endothelial cell retraction is an early event of tube differentiation on matrix proteins such as collagens or Matrigel. Studies are under way to determine this potential relationship.

It has been reported that the 12-LOX pathway of AA metabolism is required in bFGF-stimulated endothelial cell proliferation.14 We demonstrated that the inhibition of 12-LOX activity also compromised VEGF-stimulated endothelial cell proliferation. The role of 12-LOX in endothelial cell proliferation, together with the finding that 12-LOX is involved in endothelial cell migration and tube differentiation, implicate the mobilization of arachidonic acid and the generation of 12(S)-HETE through the 12-LOX pathway in endothelial cells as an early event in the intracellular cascade of angiogenic responses. Currently we are exploring the mechanism by which 12-LOX and 12(S)-HETE participate in the signaling events elicited by VEGF or bFGF in endothelial cells.

The involvement of 12-LOX in endothelial cell angiogenic responses in vitro is further corroborated by the observation that the 12-LOX inhibitor BHPP significantly reduced bFGF-stimulated angiogenesis in vivo. Because bFGF induces angiogenesis by modulating endothelial cell expression of VEGF, which in turn contributes to angiogenesis in an autocrine mechanism,35 BHPP may have inhibited angiogenesis by attenuating endothelial cell angiogenic responses to bFGF and VEGF.

It should be noted that although platelet-type 12-LOX uses arachidonic acid to synthesize 12(S)-HETE almost exclusively, platelet-type 12-LOX has been shown to use leukotriene A4 to synthesize lipoxin42-44 and also 5(S)-HETE and 15(S)-HETE to form 5(S), 12(S)-DiHETE and 14(R), 15(S)-DiHETE, respectively.45 It awaits further studies regarding whether other 12-LOX products, in addition to 12(S)-HETE, is angiogenic. In vivo, 12(S)-HETE is a prominent product of arachidonic acid metabolism through the LOX pathway in platelets. The pro-angiogenic function of 12(S)-HETE as delineated in the current study and in our previous reports12,13 implicates the possible involvement of platelets in angiogenesis during tumor growth and metastasis. Indeed, platelets are intimately involved in tumor angiogenesis,46,47 and platelet aggregation stimulates the release of VEGF.48 Clinically, 30% to 60% of patients with advanced cancer have platelet abnormalities such as thrombocytosis and many other thromboembolic disorders. In addition, activated platelets have been frequently associated with many malignant tumors.49 Obviously, the involvement of platelets adds to the complexity of tumor angiogenesis regulation.

In summary, our data suggest the important role of 12(S)-HETE generated by the 12-LOX pathway in angiogenesis and suggest the possibility of using 12-LOX inhibitors to treat angiogenic diseases such as tumor growth and arthritis. Studies are under way to evaluate the efficacy of 12-LOX inhibitors against solid tumor growth in vivo.


    Acknowledgments

We thank Homan Kian, Yilong Cai, Alex Zacharek, and Kenny Hanna for their technical support and Dr Gerhard Furstenberger of Deutsches Krebsforschungszentrum (Germany) for sharing with us the unpublished data concerning the Ki of BHPP for various recombinant lipoxygenase enzymes.


    Footnotes

Submitted June 2, 1999; accepted December 15, 1999.

Supported by National Institutes of Health grant CA-29997, United States Army Prostate Cancer Research Program DAMD 17-98-1-8502, the Harper Development Fund, a CaPCURE Foundation Award, and a Cancer Research Foundation of America Fellowship Award.

Reprints: Kenneth V. Honn, Department of Radiation Oncology, Wayne State University, 431 Chemistry Building, Detroit, Michigan 48202; e-mail: k.v.honn{at}wayne.edu.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Hanahan D. Signaling vascular morphogenesis and maintenance. Science. 1997;277:48[Free Full Text].

2. Folkman J, Shing Y. Angiogenesis. J Biol Chem. 1992;267:10,931[Free Full Text].

3. Funk CD, Keeney DS, Oliw EH, Boeglin WE, Brash AR. Functional expression and cellular localization of a mouse epidermal lipoxygenase. J Biol Chem. 1996;271:23,338[Abstract/Free Full Text].

4. Kim JA, Gu JL, Natarajan R, Berliner JA, Nadler JL. A leukocyte type of 12-lipoxygenase is expressed in human vascular and mononuclear cells: evidence for up-regulation by angiotensin II. Arterioscler Thromb Vasc Biol. 1995;15:942[Abstract/Free Full Text].

5. Krieg P, Kinzig A, Ress-Loschke M, et al. 12Lipoxygenase isoenzymes in mouse skin tumor development. Mol Carcinog. 1995;14:118[Medline] [Order article via Infotrieve].

6. Funk C, Funk LB, FitzGerald GA, Samuelsson B. Characterization of human 12-lipoxygenasegenes. Proc Natl Acad Sci U S A. 1992;89:3962[Abstract/Free Full Text].

7. Sasaki M, Hori MT, Hino T, Golub MS, Tuck ML. Elevated 12-lipoxygenase activity in the spontaneously hypertensive rat. Am J Hypertens. 1997;10:371[Medline] [Order article via Infotrieve].

8. Setty BN, Chen D, O'Neal P, Littrell JB, Grosman MH, Stuart MJ. Eicosanoids in sickle cell disease: potential relevance of 12(S)-hydroxy-5,8,10,14-eicosatetraenoic acid to the pathophysiology of vaso-occlusion. J Lab Clin Med. 1998;131:344[Medline] [Order article via Infotrieve].

9. Wang MM, Reynaud D, Pace-Asciak CR. In vivo stimulation of 12(S)-lipoxygenase in the rat skin by bradykinin and platelet activating factor: formation of 12(S)-HETE and hepoxilins, and actions on vascular permeability. Biochem Biophys Acta. 1999;1436:354[Medline] [Order article via Infotrieve].

10. Katoh A, Ikeda H, Murohara T, Haramaki N, Ito H, Imaizumi T. Platelet-derived 12-hydroxyeicosatetraenoic acid plays an important role in mediating carine coronary thrombosis by regulating platelet glycoprotein IIb/IIIa activation. Circulation. 1998;98:2891[Abstract/Free Full Text].

11. Gao X, Grignon DJ, Chbihi T, et al. Elevated 12-lipoxygenase mRNA expression correlates with advanced stage and poor differentiation of human prostate cancer. Urology. 1995;46:227[Medline] [Order article via Infotrieve].

12. Nie D, Hillman GG, Geddes T, et al. Platelet-type 12-lipoxygenase in a human prostate carcinoma stimulates angiogenesis and tumor growth. Cancer Res. 1998;58:4047[Abstract/Free Full Text].

13. Tang DG, Renaud C, Stojakovic S, Diglio CA, Porter A, Honn KV. 12(S)-HETE is a mitogenic factor for microvascular endothelial cells: its potential role in angiogenesis. Biochem Biophys Res Commun. 1995;211:462[Medline] [Order article via Infotrieve].

14. Dethlefsen SM, Shepro D, D'Amore PA. Arachidonic acid metabolites in bFGF-, PDGF-, and serum-stimulated vascular cell growth. Exp Cell Res. 1994;212:262[Medline] [Order article via Infotrieve].

15. Honda HM, Leitinger N, Frankel M, et al. Induction of monocyte binding to endothelial cells by MM-LDL: role of lipoxygenase metabolites. Arterioscler Thromb Vasc Biol. 1999;19:680[Abstract/Free Full Text].

16. Setty BN, Graeber JE, Stuart MJ. The mitogenic effect of 15- and 12-hydroxyeicosatetraenoic acid on endothelial cells may be mediated via diacylglycerol kinase inhibition. J Biol Chem. 1987;262:17,613[Abstract/Free Full Text].

17. Tang DG, Grossi IM, Chen YQ, Diglio CA, Honn KV. 12(S)-HETE promotes tumor-cell adhesion by increasing surface expression of alpha vbeta 3 integrins on ECs. Int J Cancer. 1993;54:102[Medline] [Order article via Infotrieve].

18. Tang DG, Chen YQ, Renaud C, Diglio CA, Honn KV. Protein kinase C-dependent effects of 12(S)-HETE on EC vitronectin receptor and fibronectin receptor. J Cell Biol. 1993;121:689[Abstract/Free Full Text].

19. Tang DG, Diglio CA, Honn KV. Activation of microvascular endothelium by 12(S)-HETE leads to enhanced tumor cell adhesion via upregulation of surface expression of avb3 integrin: a post-transcriptional, PKC- and cytoskeleton-dependent process. Cancer Res. 1994;54:1119[Abstract/Free Full Text].

20. Tang DG, Chen YQ, Diglio CA, Honn KV. Transcriptional activation of EC integrin av by protein kinase C activator 12(S)-HETE. J Cell Sci. 1995;108:2629[Abstract].

21. Brooks PC, Clark RAF, Cheresh DA. Requirement of vascular integrin alpha vbeta 3 for angiogenesis. Science. 1994;264:569[Abstract/Free Full Text].

22. Brooks P, Montgomery A, Rosenfeld M, et al. Integrin alpha vbeta 3 antagonist promotes tumor regression by inducing apoptosis of angiogenic blood vessels. Cell. 1994;79:1157[Medline] [Order article via Infotrieve].

23. Brooks PC, Stromblad S, Klemke R, Visscher D, Sarkar FH, Cheresh DA. Antiintegrin alpha vbeta 3 blocks human breast cancer growth and angiogenesis in human skin. J Clin Invest. 1995;96:1815.

24. Chen YQ, Duniec ZM, Liu B, et al. Endogenous 12(S)-HETE production by tumor cells and its role in metastasis. Cancer Res. 1994;54:1574[Abstract/Free Full Text].

25. Liu B, Marnett LJ, Chaudhary A, et al. Biosynthesis of 12(S)-hydroxyeicosatetraenoic acid by B16 amelanotic melanoma cells is a determinant of their metastatic potential. Lab Invest. 1994;70:314[Medline] [Order article via Infotrieve].

26. Diglio CA, Liu W, Grammas P, Giacomelli F, Wiener J. Isolation and characterization of cerebral resistance vessel endothelium in culture. Tissue Cell. 1993;25:833[Medline] [Order article via Infotrieve].

27. Liu B, Renaud C, Nelson K, et al. Proteinkinase-C inhibitor calphostin C reduces B16 amelanotic melanoma cell adhesion to endothelium and lung colonization. Int J Cancer. 1992;52:147[Medline] [Order article via Infotrieve].

28. Ito Y, Iwamoto Y, Tanaka K, Okuyama K, Sugioka Y. A quantitative assay using basement membrane extracts to study tumor angiogenesis in vivo. Int J Cancer. 1996;67:148[Medline] [Order article via Infotrieve].

29. Watanabe T, Medina JF, Haeggstrom JZ, Radmark O, Samuelsson B. Molecular cloning of a 12-lipoxygenase cDNA from rat brain. Eur J Biochem. 1993;212:605[Medline] [Order article via Infotrieve].

30. Sa G, Fox PL. Basic fibroblast growth factor-stimulated endothelial cell movement is mediated by a pertussis toxin-sensitive pathway regulating phospholipase A2 activity. J Biol Chem. 1994;269:3219[Abstract/Free Full Text].

31. Kumar R, Yoneda J, Bucana CD, Fidler IJ. Regulation of distinct steps of angiogenesis by different angiogenic molecules. Int J Oncol. 1998;12:749[Medline] [Order article via Infotrieve].

32. Wheeler-Jones C, Abu-Ghazaleh R, Cospedal R, Houliston RA, Martin J, Zachary I. Vascular endothelial growth factor stimulates prostacyclin production and activation of cytosolic phospholipase A2 in endothelial cells via p42/p44 mitogen-activated protein kinase. FEBS Lett. 1997;420:28[Medline] [Order article via Infotrieve].

33. Fafeur V, Jiang ZP, Bohlen P. Signal transduction by bFGF, but not TGFbeta 1, involves arachidonic acid metabolism in endothelial cells. J Cell Physiol. 1991;149:277[Medline] [Order article via Infotrieve].

34. Bicknell R, Vallee BL. Angiogenin stimulates endothelial cell prostacyclin secretion by activation of phospholipase A2. Proc Natl Acad Sci U S A. 1989;163:902.

35. Seghezzi G, Patel S, Ren CJ, et al. Fibroblast growth factor-2 (FGF-2) induces vascular endothelial cells of forming capillaries: an autocrine mechanism contributing angiogenesis. J Cell Biol. 1998;141:1659[Abstract/Free Full Text].

36. Ito K, Abe T, Tomita M, et al. Anti-angiogenic activity of arachidonic acid metabolism inhibitors in angiogenesis model systems involving human microvascular endothelial cells and neovascularization in mice. Int J Cancer. 1993;55:660[Medline] [Order article via Infotrieve].

37. Kaji T, Miyamoto A, Yamamoto C, Fujiwara Y, Miyajima S, Koizumi F. Basic fibroblast growth factor-induced glycosaminoglycan production in cultured vascular endothelial cells results from enhanced protein synthesis mediated by the lipoxygenase pathway. Life Sci. 1997;60:873[Medline] [Order article via Infotrieve].

38. Patte C, Blanquet PR. Possible involvement of arachidonic acid metabolites in the synergistic action of endothelial mitogenesis by basic fibroblast growth factor and phorbol ester. Cell Mol Biol. 1992;38:429[Medline] [Order article via Infotrieve].

39. Jackson JR, Bolognese B, Mangar CA, Hubbard WC, Marshall LA, Winkler JD. The role of platelet activating factor and other lipid mediators in inflammatory angiogenesis. Biochim Biophys Acta. 1998;1392:145[Medline] [Order article via Infotrieve].

40. Tang DG, Diglio CA, Honn KV. 12(S)-HETEinduced microvascular endothelial cell retraction results from PKC-dependent rearrangement of cytoskeletal elements and alpha vbeta 3 integrins. Prostaglandins. 1993;45:249[Medline] [Order article via Infotrieve].

41. Honn KV, Tang DG, Grossi I, et al. Tumor cell-derived 12(S)-hydroxyeicosatetraenoic acid induces microvascular endothelial cell retraction. Cancer Res. 1994;54:565[Abstract/Free Full Text].

42. Romano M, Chen XS, Takahashi Y, Yamamoto S, Funk CD, Serhan CN. Lipoxin synthase activity of human platelet 12-lipoxygenase. Biochem J. 1993;296:127.

43. Sheppard KA, Greenberg SM, Funk CD, Romano M, Serhan CN. Lipoxin generation by human megakaryocyte-induced 12-lipoxygenase. Biochim Biophys Acta. 1992;1133:223[Medline] [Order article via Infotrieve].

44. Serhan CN, Sheppard KA. Lipoxin formation during human neutrophil-platelet interactions: evidence for the transformation of leukotriene A4 by platelet 12-lipoxygenase in vitro. J Clin Invest. 1990;85:772.

45. Dadaian M, Westlund P. Albumin modifies the metabolism of hydroxyeicosatetraenoic acids via 12-lipoxygenase in human platelets. J Lipid Res. 1999;40:940[Abstract/Free Full Text].

46. Salgado R, Vermeulen PB, Benoy I, et al. Platelet number and interleukin-6 correlate with VEGF but not with bFGF serum levels of advanced cancer patients. Br J Cancer. 1999;80:892[Medline] [Order article via Infotrieve].

47. Pinedo HM, Verheul HM, D'Amato RJ, Folkman J. Involvement of platelets in tumour angiogenesis? Lancet. 1998;352:1775[Medline] [Order article via Infotrieve].

48. Maloney JP, Silliman CC, Ambruso DR, Wang J, Tuder RM, Voelkel NF. In vitro release of vascular endothelial growth factor during platelet aggregation. Am J Physiol. 1998;275:H1054[Abstract/Free Full Text].

49. Honn KV, Tang DG, Crissman JD. Platelets and cancer metastasis: a causal relationship? Cancer Metastasis Rev. 1992;11:325[Medline] [Order article via Infotrieve].


© 2000 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y. Chawengsub, K. M. Gauthier, and W. B. Campbell
Role of arachidonic acid lipoxygenase metabolites in the regulation of vascular tone
Am J Physiol Heart Circ Physiol, August 1, 2009; 297(2): H495 - H507.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G.-Y. Kim, J.-W. Lee, S.-H. Cho, J.-M. Seo, and J.-H. Kim
Role of the Low-Affinity Leukotriene B4 Receptor BLT2 in VEGF-Induced Angiogenesis
Arterioscler Thromb Vasc Biol, June 1, 2009; 29(6): 915 - 920.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. M. Abdel-Rahman, P. M. Abadir, and H. M. Siragy
Regulation of renal 12(S)-hydroxyeicosatetraenoic acid in diabetes by angiotensin AT1 and AT2 receptors
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2008; 295(5): R1473 - R1478.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
B. Gerstner, T. M. DeSilva, K. Genz, A. Armstrong, F. Brehmer, R. L. Neve, U. Felderhoff-Mueser, J. J. Volpe, and P. A. Rosenberg
Hyperoxia Causes Maturation-Dependent Cell Death in the Developing White Matter
J. Neurosci., January 30, 2008; 28(5): 1236 - 1245.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. P. Herbert and J. H. Walker
Group VIA Calcium-independent Phospholipase A2 Mediates Endothelial Cell S Phase Progression
J. Biol. Chem., November 24, 2006; 281(47): 35709 - 35716.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. Jankun, A. M. Aleem, S. Malgorzewicz, M. Szkudlarek, M. I. Zavodszky, D. L. DeWitt, M. Feig, S. H. Selman, and E. Skrzypczak-Jankun
Synthetic curcuminoids modulate the arachidonic acid metabolism of human platelet 12-lipoxygenase and reduce sprout formation of human endothelial cells
Mol. Cancer Ther., May 1, 2006; 5(5): 1371 - 1382.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhang, H. Wang, J. Li, L. Dong, P. Xu, W. Chen, R. L. Neve, J. J. Volpe, and P. A. Rosenberg
Intracellular Zinc Release and ERK Phosphorylation Are Required Upstream of 12-Lipoxygenase Activation in Peroxynitrite Toxicity to Mature Rat Oligodendrocytes
J. Biol. Chem., April 7, 2006; 281(14): 9460 - 9470.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. W. Reinhold, H. Vitzthum, T. Filbeck, K. Wolf, C. Lattas, G. A. J. Riegger, A. Kurtz, and B. K. Kramer
Gene expression of 5-, 12-, and 15-lipoxygenases and leukotriene receptors along the rat nephron
Am J Physiol Renal Physiol, April 1, 2006; 290(4): F864 - F872.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. P. Herbert, S. Ponnambalam, and J. H. Walker
Cytosolic Phospholipase A2-{alpha} Mediates Endothelial Cell Proliferation and Is Inactivated by Association with the Golgi Apparatus
Mol. Biol. Cell, August 1, 2005; 16(8): 3800 - 3809.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
P. Chen, M. Guo, D. Wygle, P. A. Edwards, J. R. Falck, R. J. Roman, and A. G. Scicli
Inhibitors of Cytochrome P450 4A Suppress Angiogenic Responses
Am. J. Pathol., February 1, 2005; 166(2): 615 - 624.
[Abstract] [Full Text] [PDF]


Home page
Integr Cancer TherHome page
M. F. McCarty
Targeting Multiple Signaling Pathways as a Strategy for Managing Prostate Cancer: Multifocal Signal Modulation Therapy
Integr Cancer Ther, December 1, 2004; 3(4): 349 - 380.
[Abstract] [PDF]


Home page
J. Neurosci.Home page
Y. Zhang, H. Wang, J. Li, D. A. Jimenez, E. S. Levitan, E. Aizenman, and P. A. Rosenberg
Peroxynitrite-Induced Neuronal Apoptosis Is Mediated by Intracellular Zinc Release and 12-Lipoxygenase Activation
J. Neurosci., November 24, 2004; 24(47): 10616 - 10627.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
Y. Chen, D. Lasaitiene, B. G. Gabrielsson, L. M.S. Carlsson, H. Billig, B. Carlsson, N. Marcussen, X.-F. Sun, and P. Friberg
Neonatal Losartan Treatment Suppresses Renal Expression of Molecules Involved in Cell-Cell and Cell-Matrix Interactions
J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1232 - 1243.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Nie, M. Che, A. Zacharek, Y. Qiao, L. Li, X. Li, M. Lamberti, K. Tang, Y. Cai, Y. Guo, et al.
Differential Expression of Thromboxane Synthase in Prostate Carcinoma: Role in Tumor Cell Motility
Am. J. Pathol., February 1, 2004; 164(2): 429 - 439.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. S. Yiu, X. Zhao, E. W. Inscho, and J. D. Imig
12-Hydroxyeicosatetraenoic acid participates in angiotensin II afferent arteriolar vasoconstriction by activating L-type calcium channels
J. Lipid Res., December 1, 2003; 44(12): 2391 - 2399.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
D. Turgeon, S. Chouinard, P. Belanger, S. Picard, J.-F. Labbe, P. Borgeat, and A. Belanger
Glucuronidation of arachidonic and linoleic acid metabolites by human UDP-glucuronosyltransferases
J. Lipid Res., June 1, 2003; 44(6): 1182 - 1191.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. L. Amaral, K. G. Maier, D. N. Schippers, R. J. Roman, and A. S. Greene
CYP4A metabolites of arachidonic acid and VEGF are mediators of skeletal muscle angiogenesis
Am J Physiol Heart Circ Physiol, May 1, 2003; 284(5): H1528 - H1535.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. E. Lovat, S. Oliverio, M. Ranalli, M. Corazzari, C. Rodolfo, F. Bernassola, K. Aughton, M. Maccarrone, Q. D. C. Hewson, A. D. J. Pearson, et al.
GADD153 and 12-Lipoxygenase Mediate Fenretinide-induced Apoptosis of Neuroblastoma
Cancer Res., September 15, 2002; 62(18): 5158 - 5167.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. A. Wong, Y. Kita, N. Uozumi, and T. Shimizu
Discrete Role for Cytosolic Phospholipase A2{alpha} in Platelets: Studies Using Single and Double Mutant Mice of Cytosolic and Group IIA Secretory Phospholipase A2
J. Exp. Med., August 5, 2002; 196(3): 349 - 357.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Mezentsev, F. Seta, M. W. Dunn, N. Ono, J. R. Falck, and M. Laniado-Schwartzman
Eicosanoid Regulation of Vascular Endothelial Growth Factor Expression and Angiogenesis in Microvessel Endothelial Cells
J. Biol. Chem., May 17, 2002; 277(21): 18670 - 18676.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Tang, B. Bhatia, C. J. Maldonado, P. Yang, R. A. Newman, J. Liu, D. Chandra, J. Traag, R. D. Klein, S. M. Fischer, et al.
Evidence That Arachidonate 15-Lipoxygenase 2 Is a Negative Cell Cycle Regulator in Normal Prostate Epithelial Cells
J. Biol. Chem., May 3, 2002; 277(18): 16189 - 16201.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
L. Rao, B. Puschner, and T. A. Prolla
Gene Expression Profiling of Low Selenium Status in the Mouse Intestine: Transcriptional Activation of Genes Linked to DNA Damage, Cell Cycle Control and Oxidative Stress
J. Nutr., December 1, 2001; 131(12): 3175 - 3181.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. ROMANO, A. CATALANO, M. NUTINI, E. D'URBANO, C. CRESCENZI, J. CLARIA, R. LIBNER, G. DAVI, and A. PROCOPIO
5-Lipoxygenase regulates malignant mesothelial cell survival: involvement of vascular endothelial growth factor
FASEB J, November 1, 2001; 15(13): 2326 - 2336.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
B. C. Y. Wong, W. P. Wang, C. H. Cho, X. M. Fan, M. C. M. Lin, H. F. Kung, and S. K. Lam
12-Lipoxygenase inhibition induced apoptosis in human gastric cancer cells
Carcinogenesis, September 1, 2001; 22(9): 1349 - 1354.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. Shureiqi and S. M. Lippman
Lipoxygenase Modulation to Reverse Carcinogenesis
Cancer Res., September 1, 2001; 61(17): 6307 - 6312.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
X. Chen and C. S. Yang
Esophageal adenocarcinoma: a review and perspectives on the mechanism of carcinogenesis and chemoprevention
Carcinogenesis, August 1, 2001; 22(8): 1119 - 1129.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. H. Zink, C. L. Oltman, T. Lu, P. V. G. Katakam, T. L. Kaduce, H.-C. Lee, K. C. Dellsperger, A. A. Spector, P. R. Myers, and N. L. Weintraub
12-Lipoxygenase in porcine coronary microcirculation: implications for coronary vasoregulation
Am J Physiol Heart Circ Physiol, February 1, 2001; 280(2): H693 - H704.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. D. Imig
Eicosanoid regulation of the renal vasculature
Am J Physiol Renal Physiol, December 1, 2000; 279(6): F965 - F981.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nie, D.
Right arrow Articles by Honn, K. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nie, D.
Right arrow Articles by Honn, K. V.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2000 by American Society of Hematology         Online ISSN: 1528-0020