|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 7 (April 1), 2000:
pp. 2386-2390
NEOPLASIA
Variant genotypes of Fc RIIIA influence the
development of Kaposi's sarcoma in HIV-infected men
Thomas Lehr nbecher,
Charles B. Foster,
Shaoxian Zhu,
David Venzon,
Seth M. Steinberg,
Kathleen Wyvill,
Julia A. Metcalf,
Sandra S. Cohen,
Joseph Kovacs,
Robert Yarchoan,
Andrew Blauvelt, and
Stephen J. Chanock
From the Immunocompromised Host Section, Pediatric Oncology Branch;
Biostatistics and Data Management Section; HIV and AIDS Malignancy
Branch; and Dermatology Branch, National Cancer Institute; Laboratory
of Immunoregulation, National Institute of Allergy and Infectious
Diseases; and Critical Care Medicine Department, Clinical Center,
National Institutes of Health, Bethesda, MD.
 |
Abstract |
Disturbances in inflammatory cytokine production and immune
regulation coupled with human herpesvirus-8 (HHV-8) infection underlie the current understanding of the pathogenesis of Kaposi's sarcoma (KS), the most common HIV-associated malignancy. The low affinity Fc gamma receptors (Fc R) for IgG link humoral and cellular immunity by mediating interaction between antibodies and effector cells, such as phagocytes and natural killer cells. We examined the
frequency of polymorphic forms of the low affinity
FcRs, FcRIIA,
FcRIIIA, and FcRIIIB in
2 cohorts of HIV-infected men with KS and found that the
FcRIIIA genotype exerts a significant influence
on susceptibility to or protection from KS. The FF genotype was
underrepresented in patients with KS, whereas the VF genotype was
associated with development of KS. A similar association was observed
between FcRIIIA genotypes and HHV-8
seropositivity. These observations suggest a possible role for
FcRIIIA in the development of KS during HIV infection.
(Blood. 2000;95:2386-2390)
© 2000 by The American Society of Hematology.
| |
Introduction |
Kaposi's sarcoma (KS) is the most common malignant
condition associated with human immunodeficiency virus-1 (HIV)
infection.1,2 Before the onset of the HIV epidemic, KS was
a rare disease confined to specific risk groups: elderly men of
Mediterranean or Ashkenazi Jewish background, Sub-Saharan Africans, and
immuno-suppressed patients.2-6 Since the initial
description of KS, there has been strong evidence to suggest that an
infectious agent contributes to the pathogenesis of this disease.
Recently, a KS-associated herpesvirus (KSHV), later designated as human
herpesvirus-8 (HHV-8), has been determined to be the likely causative
microbial agent critical in the pathogenesis of KS.7-10
However, this virus appears to be necessary but not sufficient for
development of KS.
Current insights into the pathogenesis of KS in HIV-infected
individuals indicate that in its early stage, KS is an
angio-proliferative inflammatory condition induced by infection with
HHV-8.11,12 In the late stages of KS, lesions may develop a
malignant phenotype and there is some evidence that they can resemble a
true sarcoma as defined by monoclonality.13 The
immunopathogenesis of KS includes the activation of lymphocytes,
resulting in increased inflammatory cytokine production, activation of
endothelial cells, and production of virally encoded angiogenic factors
by HHV-8-infected cells.7-10,14-18 It is postulated that an
increase in pro-inflammatory cytokine production, notably IFN-,
TNF- , IL-1, and IL-6 as well as HIV-1 tat protein, promotes
activation and growth of endothelial cells, expression of adhesion
molecules and integrins, and release of angiogenic
molecules.14-19 Hence, a significant disruption of the
extra- and intracellular signaling pathways by cytokines and other
molecules of innate immunity appears to be a hallmark of KS in
HIV-infected individuals.
The low-affinity Fc gamma receptors (FcR) for IgG couple humoral and
cellular immunity by mediating interaction between antibodies and
effector cells, such as professional phagocytes (ie, neutrophils, monocytes, and macrophages) and natural killer (NK)
cells.20 Surface FcR on effector cells can direct
phagocytosis, antibody-dependent cell-mediated cytotoxicity (ADCC), and
activation of cytokine pathways.21,22 The structural
heterogeneity of the genes that encode the FcRs reflects the
functional diversity of these receptors. The genes that encode the
low-affinity FcR map to a region of chromosome 1q22 are
characterized by a high degree of sequence homology.23,24
Polymorphic forms of the low affinity receptors,
FcRIIA, FcRIIIA, and
FcRIIIB, have been described and are currently
the focus of efforts to identify heritable risk factors for a range of
diseases.25-31 Variant alleles have been described that
have a high frequency (greater than 25%) in the general population. These alleles exhibit differing functional characteristics both in
vitro and in clinical association studies. For example, a polymorphism in FcRIIA at amino acid 131 results in altered
binding affinity to IgG2.27 The FcRIIIa-158 V isoform,
which lies in the extracellular domain and affects ligand binding, has
a higher affinity for IgG1, IgG3, and IgG4 than FcRIIIa -158 F.28,29 Interestingly, FcRIIIa is highly expressed on NK
cells and monocytes. Neutrophils from NA2 homozygotes of
FcRIIIB bind human IgG3 less avidly than those from NA1 homozygotes and exhibit a lower level of phagocytosis of
erythrocytes sensitized with IgG1 and IgG3 anti-Rhesus D monoclonal antibody.21 Recently, it was shown that variant genotypes
of these 3 FcRs were randomly distributed in the populations
studied, suggesting that each of the 3 FcRs, namely,
FcRIIA, FcRIIIA, and
FcRIIIB, provides a distinct set of functions
in host immune responses, despite the high degree of homology among
their sequences.32
Clinical association studies analyzing these variant genotypes have
shown a correlation between FcR genotype and disease susceptibility
or outcome, particularly in cohorts with underlying defects in immune
function. Specifically, FcRIIA and
FcRIIIB genotypes have been associated with
granulomatous and rheumatologic complications of chronic granulomatous
disease, renal complications of both systemic lupus erythematosus and
Wegener's granulomatosis, as well as infection with encapsulated
bacteria in HIV-infected and other immunocompromised
populations.33-36 Although variant alleles of the FcRs
have not been associated with the occurrence or progression of HIV
infection, clinical association studies investigating other genes, in
particular variant alleles of the chemokine receptor family, have
demonstrated a strong influence on infection and progression of HIV
disease.37-44
The above mentioned observations led us to consider the possibility
that variant genotypes of low affinity FcRs might influence susceptibility to KS. To investigate this possibility, we chose to
genotype the 3 candidate FcRs loci,
FcRIIA, FcRIIIA, and FcRIIIB, in a cohort of HIV patients with or
without KS.33
| |
Methods |
Human subjects
The first cohort tested, population I, consisted of 119 deceased
white males enrolled on NCI protocols, who had acquired HIV through sex
with other men. None of the patients received highly active
antiretroviral therapy (HAART) and each died before 1996. The second
cohort, population II, consisted of 131 HIV-infected patients (61 patients with KS, 70 patients without KS). The demographic and clinical
profile of the patients in the confirmatory cohort, population II, was
comparable to the first cohort in that it consisted of men with or
without KS who had acquired HIV through sex with other men and were
enrolled in NIAID protocols that did not include HAART. The 2 groups
did not differ in age or CD4 count at time of death. All but 4 samples
were collected from deceased patients. The activity of this protocol
was determined to be exempt from the need for Institutional Review
Board approval by the Office of Human Subject Research, National
Institutes of Health, Bethesda, MD. Four patients still alive with
confirmed KS provided informed consent for enrollment in a prospective
study approved by the NIAID Institutional Review Board and were
included. All but 4 patients were white North Americans; 2 controls and
2 with KS were African Americans.
Genomic DNA was extracted from banked cryopreserved lymphocyte pellets
using the Puregene DNA Extraction Kit (Gentra Systems, Minneapolis, MN).
Polymorphism analysis
FcRIIA polymorphisms were tested by
allele-specific restriction digest according to a previously described
method.45
The 158V/F-FcRIIIA polymorphism was detected by
an allele-specific oligohybridization after a nested polymerize chain
reaction (PCR) amplification of genomic DNA.28,29 A
gene-specific 1.2-kilobase (kb) DNA fragment was amplified by PCR using
the following primers, ATATTTACAGAATGGCACAGG and GACTTGGTACCCAGGTTGAA,
and conditions, 5 minutes at 95°C, 35 cycles of 1 minute at 95°C, 1 minute at 56°C, and 1 minute at 72°C with a final extension of 8 minutes at
72°C.28,32 One microliter was used as a
template for a nested PCR reaction with the primer pair,
TCATCATAATTCTGACTTCT and CTTGAGTGATGGTGATGTTC, and conditions of 30 cycles of 1 minute each at 95°C, 62°C,
and 72°C. [-32P]-ATP-labeled oligonucleotide
probes corresponding to the F or V allele,
GCAGGGGGCTTTTTGGGAGTAAA or
GCAGGGGGCTTGTTGGGAGTAAA, were hybridized and
washed in 6 × SSPE/1% SDS at room temperature, 42°C, and at 70.5°C for T allele and at
72.5°C for G allele. Autoradiography was then
performed. Selected samples were confirmed by direct sequence analysis
in duplicate; the 3' oligonucleotide was used as the sequence
primer with the Thermo Sequenase-radiolabeled terminator cycle
sequencing kit (Amersham Life Sciences, Cleveland, OH) at 35 cycles and
an annealing temperature of 55°C. Sequence analysis
confirmed the presence of a C at nucleotide 531, present in
FcRIIIA but not in
FcRIIIB (which has a T). Two groups have
characterized the polymorphism at base pair 559, a nonconservative T to
G substitution, resulting in a change of phenylalanine (F) to valine
(V) but designated the amino acid position differently, ie,
15829 or 176.28 Interestingly, a tri-allelic
polymorphism of FcRIIIA at nucleotide 230, 48L/H/R, which is strongly linked to 158V/F, does not appear to confer a significant biologic difference.28
The FcRIIIB-NA1/NA2 polymorphism was determined
by an allele-specific PCR, using a modification of a protocol by
Hessner et al.46
HHV-8 serologic testing
A commercially available immunofluorescence assay kit for measuring
antibodies against lytically expressed HHV-8 antigens (Advanced
Biotechnologies, Columbia, MD) was used for detection of HHV-8
antibodies according to the manufacturer's
instructions.47,48 Sera were tested at a 1:40 dilution and
coded slides were scored by 3 independent investigators.
Statistical analysis
An initial analysis was performed on population I to explore a
possible association between 1 or more loci and development of KS using
 2 analysis (3 × 2 tables with 2 degrees of
freedom). The data are presented without formal correction on the
premise that candidate genes were chosen on the basis of previous in
vitro data or association studies suggesting the functional
significance of the polymorphisms.33 Because the second
cohort, population II, was tested to confirm the findings for
population I, a 2 analysis (3 × 2 tables with 2 degrees of freedom) of the second population is presented without
correction. The effect of each FcRs genotype on KS associated with
HIV was analyzed by 2 analysis (2 × 2 with 1 degree of freedom). The association between KS and the
FcRIIIA locus in the combined population was
tested using the Cochran-Mantel-Haenszel method of stratified
analysis.49,50
| |
Results |
An exploratory analysis of the candidate
FcRs loci, FcRIIA,
FcRIIIA, and FcRIIIB,
was performed on stored samples from population I (Table
1). In this cohort, 58 patients had KS by time of death and 61 did not. Serologic evidence of HHV-8 infection by
immunofluorescence assay on the last available serum sample conformed
to published data: 39 of 46 KS patients (84.7%) were seropositive,
compared with 21 of 55 patients (38.1%) without KS.51,52
In an exploratory analysis in this cohort, population I (Table 1),
there was a significant difference observed between individuals with
and without KS with respect to 1 locus, FcRIIIA (P = .0035). Further analysis indicated (Table
1) that the FcRIIIA FF genotype was
underrepresented in individuals with KS; only 21.8% of patients with
KS had this genotype, compared with 48.3% of patients without KS
(P = .003). In contrast, the heterozygous VF
genotype was associated with KS; 65.5% of patients with KS had this
genotype, compared with 35% of patients without KS
(P = .0011). An association was not observed
between KS and either the FcRIIA or
FcRIIIB variant genotypes.
View this table:
[in this window]
[in a new window]
|
Table 1.
Association between variant FcR
genotypes and Kaposi's sarcoma (KS) in 2 populations of HIV-infected
men
|
|
To confirm these results, a second population, population II, was
subsequently genotyped (Table 1). The HHV-8 serologic status of the
second population was determined on the last available banked serum. Of
the patients tested, 47 of 55 KS patients (85.5%) were HHV-8
seropositive in contrast to 23 of 67 patients without KS (34.3%) who
were seropositive, a distribution that did not differ statistically
from the previous cohort or the published literature.51,52
The analysis of population II (P = .018), as
well as the analysis of the combined populations (ie, populations I and
II; P = .00028) provided additional evidence
(Table 1) that variant genotypes for FcRIIIA
were strongly associated with KS. In population II, the FF genotype was
associated with failure to develop KS
(P = .0065); however, the association between
the VF genotype and KS was only suggestive of a trend
(P = .10).
Because the 2 study populations were comparable (ie, males with late
stage HIV infection, CD4 counts below 200/µL, and identical rates for
HHV-8 seropositivity), a stratified analysis combining both populations
was performed using the Cochran-Mantel-Haenszel test.49,50
This analysis indicated a strong association between the
FcRIIIA locus and KS
(P = .00028) in the combined populations. Furthermore, analysis of the combined cohort of 240 genotyped patients
(112 with KS and 128 without KS) demonstrated that the FF homozygous
genotype was associated with a decreased likelihood of KS during HIV
infection (P = .000061), whereas the VF
heterozygous genotype was strongly associated with development of KS
(P = .00063).
The distribution of genotypes did not differ significantly between the
population without KS and a healthy control population of white North
Americans from a recently published report at any of the 3 FcR loci
studied.32 Specifically, the distribution of
FcRIIIA genotypes in the healthy control
population was as follows: 91 (50%) FF, 71 (40%) VF, and 19 (10%) VV
and did not differ from the combined group without KS (P = .77; 2 = 0.53).
We also examined whether FcRIIIA might be
involved in host response against HHV-8. An exploratory analysis of the
combined populations with respect to HHV-8 serologic status and
FcRIIIA genotype, not taking into account KS
status, does suggest an association (P = .0071)
(Table 2). It appears that the FF genotype
is protective against infection with HHV-8 that induces serologic
response (P = .0017), whereas the VF genotype
could be a risk factor for this form of HHV-8 infection
(P = .023). Because HHV-8 infection appears to
be an essential factor for the development of KS, an analysis restricted to subjects with detectable HHV-8 antibodies was performed for the combined population (n = 130; 86 with KS and 44 without KS).
The significance of the 158 V/F polymorphism of
FcRIIIA and predisposition to KS in individuals
was still evident in those who were seropositive for HHV-8
(P = .036). The FF genotype was protective; 17 of 86 patients with KS in contrast to 18 of 44 without KS had this
genotype (P = .01). On the other hand, the VF
genotype was marginal in its association with development of KS in
individuals who were seropositive for HHV-8 (55 of 86 with KS in
comparison to 21 of 44 without KS; P = .076).
| |
Discussion |
Our study of FcR genotypes in 2 separate
cohorts of HIV-infected men suggests that the homozygous FF genotype of
FcRIIIA acts to partially protect HIV-infected individuals
from developing KS. Conversely, the presence of at least 1 V allele is
associated with KS. These findings suggest a possible role for
FcRIIIA in the pathogenesis of HIV-associated
KS. Infection with HHV-8 could predispose individuals at risk to
develop KS with the outcome determined in part by the genotype of
FcRIIIA 158V/F. Certainly, other cofactors are
critical, some of which could be influenced by low-affinity FcR
activity; these include HIV-associated disturbances in cytokine
regulation, hormonal balance, angiogenic and transforming growth
factors, and altered monocyte or NK activity.
Both in vitro and in vivo evidence are consistent with the hypothesis
that cytokine balance plays a critical role in the pathogenesis of
KS.11,12,15 Pro-inflammatory cytokines, IL-1 , IL-6,
TNF-, and oncostatin M are potent growth factors for KS spindle
cells and are also found in excess within lesions, whereas the addition of the interleukin-1 receptor antagonist (IL-1RN) to KS spindle cells
impairs growth in vitro.17,53-55 In vitro studies have
shown that the VV genotype of FcRIIIA results
in an increase in NK cell activation, induction of apoptosis, and
increased binding affinity for IgG1 and IgG3 compared with FF
homozygotes.28,29 It will be of interest to study whether
differential binding of IgG to FcRIIIa results in alterations in
downstream events, such as release of cytokines or chemokines which in
turn could influence pathways critical for development of KS. We
suggest that FF homozygotes might be protected from developing KS
because of a less vigorous inflammatory response.
The small number of VV individuals precluded our ability to determine
whether this genotype carries a moderately increased risk compared with
VF heterozygotes. VF heterozygotes might be at a disadvantage because
of the combination of the underlying defect in NK cells associated with
HIV infection and the presence of a V allele that could more
significantly modulate inflammatory pathways. The correlation of a
deleterious outcome with heterozygosity for a variant form of a
molecule of innate immunity has been reported previously56;
tuberculosis in West Africa has been associated with heterozygous
genotypes of several linked variants of the NRAMP-1 gene.
It is of interest that variant genotypes of
FcRIIIA are associated with KS in HIV because
FcRIIIa is the predominant FcR expressed on NK cells where it is
closely associated with either the TCR- or Fc RI
chain.57 FcRIIIa is a critical receptor on CD3-negative
NK cells that act as effectors for ADCC and spontaneous lysis of
sensitized viral-infected or malignant cells. In addition, on
activation, NK cells secrete cytokines that influence pro- and
anti-inflammatory pathways that are already deranged in HIV-associated KS, such as interferon-.58 Also, the absence of NK cells
has been associated with increased severity of herpesvirus
infections.59 Several case reports have suggested that the
expression of variant FcRIIIA on NK cells
contributes to more severe illness during infection with herpesviruses
but this limited study does not take into account the frequency of the
variant alleles in the general population.60
In the course of this study, it was determined that the FF genotype
might be important in influencing not only the development of
HIV-associated KS but also the outcome of infection with HHV-8. Further
research will be required to determine whether genotypic differences in
the binding of IgG, whether by NK cells or by other phagocytic cells,
such as macrophages or monocytes, could alter response to HHV-8
infection, particularly in the presence of HIV infection. We infer from
our analysis of FcRIIIA genotypes and HHV-8
seropositivity that the reduced occurrence of seropositive HHV-8
infection associated with the FF genotype could be partially responsible for underrepresentation of the FF genotype in KS. These
preliminary observations provide a possible link connecting KS and
FcRIIIA genotype, particularly because HHV-8
infection is an essential cofactor for KS. In this regard, the possible role of FcRIIIa in modulating infection with HHV-8 is novel and bears further investigation, both for validation and elucidation of
events critical for KS pathogenesis.
In this context, our results raise several interesting possibilities
for understanding the contribution of FcRIIIa to the pathogenesis of
KS. Each of these possibilities reflects an antibody-dependent, HHV-8-specific role for FcRIIIa on NK cells and professional phagocytes. Differences in genotype have been shown to alter IgG binding that could influence cytokine levels, the state of effector cell activation, or viral load. Our genetic epidemiologic study provides preliminary evidence for further investigation of these issues, based on a strong association between the
FcRIIIA locus and development of KS in
HIV-infected men. It is also possible that the observed association is
due to a different gene in linkage dysequilibrium with
FcRIIIA, which instead might directly play a
role in host response to viral infection. Because the complexity of
disturbances in immune regulation during HIV infection is sufficiently complicated, it is likely that a number of genes are involved in
determining host susceptibility and response to HHV-8 infection as well
as the development of KS.61 Nonetheless, our study has identified an immunologically interesting region of chromosome 1q22 as
potentially important in the development of KS with the FcRIIIA gene as the leading candidate
responsible for this association.
| |
Acknowledgments |
We would like to thank Renée Chen and John O'Mara for their
technical assistance.
| |
Footnotes |
Submitted October 14, 1999; accepted December 9, 1999.
T.L. was supported by a Dr Mildred Scheel Stipendium,
Deutsche Krebshilfe e.V.
T.L. and C.B.F. contributed equally to this work.
Reprints: Stephen J. Chanock, Immunocompromised Host Section,
Pediatric Oncology Branch, National Cancer Institute, Advanced
Technology Center, 8717 Grovemont Circle, Gaithersburg, MD 20877;
e-mail: sc83a{at}nih.gov.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Safai B, Johnson KG, Myskowski PL, et al.
The natural history of Kaposi's sarcoma in the acquired immunodeficiency syndrome.
Ann Intern Med.
1985;103:744-750.
2.
Haverkos HW, Drotman DP.
Prevalence of Kaposi's sarcoma among patients with AIDS.
N Engl J Med.
1985;312:1518[Medline]
[Order article via Infotrieve].
3.
Geddes M, Franceschi S, Balzi D, Arniani S, Gafa L, Zanetti R.
Birthplace and classic Kaposi's sarcoma in Italy: Associazione Italiana Registri Tumori.
J Natl Cancer Inst.
1995;87:1015-1017[Free Full Text].
4.
Penn I.
Kaposi's sarcoma in organ transplant recipients: report of 20 cases.
Transplantation.
1979;27:8-11[Medline]
[Order article via Infotrieve].
5.
Slavin G, Cameron HM, Singh H.
Kaposi's sarcoma in mainland Tanzania: a report of 117 cases.
Br J Cancer.
1969;23:349-357[Medline]
[Order article via Infotrieve].
6.
Taylor JF, Smith PG, Bull D, Pike MC.
Kaposi's sarcoma in Uganda: geographic and ethnic distribution.
Br J Cancer.
1972;26:483-497[Medline]
[Order article via Infotrieve].
7.
Chang Y, Cesarman E, Pessin MS, et al.
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science.
1994;266:1865-1869[Abstract/Free Full Text].
8.
Ambroziak JA, Blackbourn DJ, Herndier BG, et al.
Herpes-like sequences in HIV-infected and uninfected Kaposi's sarcoma patients.
Science.
1995;268:582-583[Free Full Text].
9.
Boshoff C, Schulz TF, Kennedy MM, et al.
Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells.
Nat Med.
1995;1:1274-1278[Medline]
[Order article via Infotrieve].
10.
Schalling M, Ekman M, Kaaya EE, Linde A, Biberfeld P.
A role for a new herpesvirus (KSHV) in different forms of Kaposi's sarcoma.
Nat Med.
1995;1:707-708[Medline]
[Order article via Infotrieve].
11.
Brooks JJ.
Kaposi's sarcoma: a reversible hyperplasia.
Lancet.
1986;2:1309-1311[Medline]
[Order article via Infotrieve].
12.
Levy JA, Ziegler JL.
Acquired immunodeficiency syndrome is an opportunistic infection and Kaposi's sarcoma results from secondary immune stimulation.
Lancet.
1983;2:78-81[Medline]
[Order article via Infotrieve].
13.
Rabkin CS, Janz S, Lash A, et al.
Monoclonal origin of multicentric Kaposi's sarcoma lesions.
N Engl J Med.
1997;336:988-993[Abstract/Free Full Text].
14.
Caruso A, Canaris AD, Licenziati S, et al.
CD4+ and CD8+ lymphocytes of patients with AIDS synthesize increased amounts of interferon-gamma.
J Acquir Immune Defic Syndr Hum Retrovirol.
1995;10:462-470[Medline]
[Order article via Infotrieve].
15.
Capobianchi MR, Ameglio F, Fei PC, et al.
Coordinate induction of interferon alpha and gamma by recombinant HIV-1 glycoprotein 120.
AIDS Res Hum Retroviruses.
1993;9:957-962[Medline]
[Order article via Infotrieve].
16.
Ensoli B, Salahuddin SZ, Gallo RC.
AIDS-associated Kaposi's sarcoma: a molecular model for its pathogenesis.
Cancer Cells.
1989;1:93-96[Medline]
[Order article via Infotrieve].
17.
Nakamura S, Salahuddin SZ, Biberfeld P, et al.
Kaposi's sarcoma cells: long-term culture with growth factor from retrovirus-infected CD4+ T cells.
Science.
1988;242:426-430[Abstract/Free Full Text].
18.
Ensoli B, Gendelman R, Markham P, et al.
Synergy between basic fibroblast growth factor and HIV-1 tat protein in induction of Kaposi's sarcoma.
Nature.
1994;371:674-680[Medline]
[Order article via Infotrieve].
19.
Sirianni MC, Vincenzi L, Fiorelli V, et al.
Gamma-interferon production in peripheral blood mononuclear cells and tumor infiltrating lymphocytes from Kaposi's sarcoma patients: correlation with the presence of human herpesvirus-8 in peripheral blood mononuclear cells and lesional macrophages.
Blood.
1998;91:968-976[Abstract/Free Full Text].
20.
van de Winkel J, Capel P.
Human IgG Fc receptor heterogeneity: molecular aspects and clinical implications.
Immunol Today.
1993;14:215-221[Medline]
[Order article via Infotrieve].
21.
Nagarajan S, Chesla S, Cobern L, Anderson P, Zhu C, Selvaraj P.
Ligand binding and phagocytosis by CD16 (Fc gamma receptor III) isoforms.
J Biol Chem.
1995;270:26,762-25,770[Abstract/Free Full Text].
22.
Tax W, Tamboer W, Jacobs C, Frenken L, Koene R.
Role of polymorphic Fc receptor Fc gamma RIIa in cytokine release and adverse effects of murine IgG1 anti-CD3/T cell receptor antibody (WT31).
Transplantation.
1997;63:106-112[Medline]
[Order article via Infotrieve].
23.
Peltz GA, Grundy HO, Lebo RV, Yssel H, Barsh GS, Moore KW.
Human Fc gamma RIII: cloning, expression, and identification of the chromosomal locus of two Fc receptors for IgG.
Proc Natl Acad Sci U S A.
1989;86:1013-1017[Abstract/Free Full Text].
24.
Su Y, Brooks DG, Li L, et al.
Myelin protein zero gene mutated in Charcot-Marie-tooth type 1B patients.
Proc Natl Acad Sci U S A.
1993;90:10,856-10,860[Abstract/Free Full Text].
25.
Parren PW, Warmerdam PA, Boeije LC, et al.
On the interaction of IgG subclasses with the low affinity Fc gamma RIIa (CD32) on human monocytes, neutrophils, and platelets. Analysis of a functional polymorphism to human IgG2.
J Clin Invest.
1992;90:1537-1546.
26.
Warmerdam PA, van de Winkel JG, Gosselin EJ, Capel PJ.
Molecular basis for a polymorphism of human Fc gamma receptor II (CD32).
J Exp Med.
1990;172:19-25[Abstract/Free Full Text].
27.
Warmerdam PA, van de Winkel JG, Vlug A, Westerdaal NA, Capel PJ.
A single amino acid in the second Ig-like domain of the human Fc gamma receptor II is critical for human IgG2 binding.
J Immunol.
1991;147:1338-1343[Abstract].
28.
Wu J, Edberg J, Redecha P, et al.
A novel polymorphism of Fc gamma RIIIa (CD16) alters receptor function and predisposes to autoimmune disease.
J Clin Invest.
1997;100:1059-1070[Medline]
[Order article via Infotrieve].
29.
Koene H, Kleijer M, Algra J, Roos D, von dem Borne A, de Haas M.
Fc gamma RIIIa-158V/F polymorphism influences the binding of IgG by natural killer cell Fc gamma RIIIa, independently of the Fc gamma RIIIa-48L/R/H phenotype.
Blood.
1997;90:1109-1114[Abstract/Free Full Text].
30.
Ory PA, Clark MR, Kwoh EE, Clarkson SB, Goldstein IM.
Sequences of complementary DNAs that encode the NA1 and NA2 forms of Fc receptor III on human neutrophils.
J Clin Invest.
1989;84:1688-1691.
31.
Ory PA, Goldstein IM, Kwoh EE, Clarkson SB.
Characterization of polymorphic forms of Fc receptor III on human neutrophils.
J Clin Invest.
1989;83:1676-1681.
32.
Lehrnbecher T, Foster CB, Zhu S, et al.
Variant genotypes of the low affinity Fc gamma receptors in two control populations and a review of low affinity Fc gamma receptor polymorphisms in control and disease populations.
Blood.
1999;94:4220-4232[Abstract/Free Full Text].
33.
Foster CB, Lehrnbecher T, Mol F, et al.
Host defense molecule polymorphisms influence the risk for immune-mediated complications in chronic granulomatous disease.
J Clin Invest.
1998;102:2146-2155[Medline]
[Order article via Infotrieve].
34.
Manger K, Repp R, Spriewald BM, et al.
Fcgamma receptor IIa polymorphism in Caucasian patients with systemic lupus erythematosus: association with clinical symptoms.
Arthritis Rheum.
1998;41:1181-1189[Medline]
[Order article via Infotrieve].
35.
Norris CF, Surrey S, Bunin GR, Schwartz E, Buchanan GR, McKenzie SE.
Relationship between Fc receptor IIA polymorphism and infection in children with sickle cell disease.
J Pediatr.
1996;128:813-819[Medline]
[Order article via Infotrieve].
36.
Abadi J, Zhon Z, Dobroszycki J, Pirofski L.
Fc gamma RIIa polymorphism in human immunodeficiency virus-infected children with invasive pneumococcal disease.
Pediatr Res.
1997;42:259-262[Medline]
[Order article via Infotrieve].
37. Koene HR, von dem Borne AEGK, Roos D, de Haas M. Polymorphisms of Fc
gamma RIIIa on NK cells and macrophages. In: van de Winkel JGJ, Hogarth
PM, eds. The Immunoglobulin Receptors and Their Physiological and
Pathological Roles in Immunity. Kluwer Academic Publisher;
1998:135-140.
38.
Winkler C, Modi W, Smith MW, et al.
Genetic restriction of AIDS pathogenesis by an SDF-1 chemokine gene variant. ALIVE Study, Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC).
Science.
1998;279:389-393[Abstract/Free Full Text].
39.
Martin MP, Dean M, Smith MW, et al.
Genetic acceleration of AIDS progression by a promoter variant of CCR5.
Science.
1998;282:1907-1911[Abstract/Free Full Text].
40.
Dean M, Carrington M, Winkler C, et al.
Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene: Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study.
Science.
1996;273:1856-1862[Abstract/Free Full Text].
41.
McDermott DH, Zimmerman PA, Guignard F, Kleeberger CA, Leitman SF, Murphy PM.
CCR5 promoter polymorphism and HIV-1 disease progression: Multicenter AIDS Cohort Study (MACS).
Lancet.
1998;352:866-870[Medline]
[Order article via Infotrieve].
42.
Zimmerman PA, Buckler-White A, Alkhatib G, et al.
Inherited resistance to HIV-1 conferred by an inactivating mutation in CC chemokine receptor 5: studies in populations with contrasting clinical phenotypes, defined racial background, and quantified risk.
Mol Med.
1997;3:23-36[Medline]
[Order article via Infotrieve].
43.
Smith MW, Dean M, Carrington M, et al.
Contrasting genetic influence of CCR2 and CCR5 variants on HIV-1 infection and disease progression: Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC), ALIVE Study.
Science.
1997;277:959-965[Abstract/Free Full Text].
44.
Carrington M, Nelson G, Martin M, et al.
HLA and HIV-1: heterozygote advantage and B*35-Cw*04 disadvantage.
Science.
1999;283:1748-1752[Abstract/Free Full Text].
45.
Jiang X, Arepally G, Poncz M, McKenzie S.
Rapid detection of the Fc gamma RIIA-H/R (131) ligand-binding polymorphism using an allele-specific restriction enzyme digestion (ASRED).
J Immunol Meth.
1996;199:55-59[Medline]
[Order article via Infotrieve].
46.
Hessner M, Curtis B, Endean D, Aster R.
Determination of neutrophil antigen gene frequencies in five ethnic groups by polymerase chain reaction with sequence-specific primers.
Transfusion.
1996;36:895-899[Medline]
[Order article via Infotrieve].
47.
Masood R, Zheng T, Tupule A, et al.
Kaposi's sarcoma-associated herpesvirus infection and multiple myeloma.
Science.
1997;278:1970-1973.
48.
Davis DA, Humphrey RW, Newcomb FM, et al.
Detection of serum antibodies to a Kaposi's sarcoma-associated herpesvirus-specific peptide.
J Infect Dis.
1997;175:1071-1079[Medline]
[Order article via Infotrieve].
49.
Cochran WG.
Some methods for strengthening the common 2 tests.
Biometrics.
1954;10:417-451.
50.
Mantel N, Haenszel WJ.
Statistical aspects of the analysis of data from retrospective studies of disease.
J Natl Cancer Inst.
1959;22:719.
51.
Kedes DH, Operskalski E, Busch M, Kohn R, Flood J, Ganem D.
The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission.
Nat Med.
1996;2:918-924[Medline]
[Order article via Infotrieve].
52.
Gao SJ, Kingsley L, Li M, et al.
KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma.
Nat Med.
1996;2:925-928[Medline]
[Order article via Infotrieve].
53.
Miles SA, Rezai AR, Salazar-Gonzalez JF, et al.
AIDS Kaposi's sarcoma-derived cells produce and respond to interleukin 6.
Proc Natl Acad Sci U S A.
1990;87:4068-4072[Abstract/Free Full Text].
54.
Nair BC, DeVico AL, Nakamura S, et al.
Identification of a major growth factor for AIDS-Kaposi's sarcoma cells as oncostatin M.
Science.
1992;255:1430-1432[Abstract/Free Full Text].
55.
Miles SA, Martinez-Maza O, Rezai A, et al.
Oncostatin M as a potent mitogen for AIDS-Kaposi's sarcoma-derived cells.
Science.
1992;255:1432-1434[Abstract/Free Full Text].
56.
Bellamy R, Ruwende C, Corrah T, McAdam KP, Whittle HC, Hill AV.
Variations in the NRAMP1 gene and susceptibility to tuberculosis in West Africans.
N Engl J Med.
1998;338:640-644[Abstract/Free Full Text].
57.
Wirthmueller U, Kurosaki T, Murakami MS, Ravetch JV.
Signal transduction by Fc gamma RIII (CD16) is mediated through the gamma chain.
J Exp Med.
1992;175:1381-1390[Abstract/Free Full Text].
58.
Cassatella MA, Anegon I, Cuturi MC, Griskey P, Trinchieri G, Perussia B.
Fc gamma R(CD16) interaction with ligand induces Ca2+ mobilization and phosphoinositide turnover in human natural killer cells. Role of Ca2+ in Fc gamma R(CD16)-induced transcription and expression of lymphokine genes.
J Exp Med.
1989;169:549-567[Abstract/Free Full Text].
59.
Jawahar S, Moody C, Chan M, Finberg R, Geha R, Chatila T.
Natural killer (NK) cell deficiency associated with an epitope-deficient Fc receptor type IIIA (CD16-II).
Clin Exp Immunol.
1996;103:408-413[Medline]
[Order article via Infotrieve].
60.
de Vries E, Koene H, Vossen J, et al.
Identification of an unusual Fc gamma receptor IIIa (CD16) on natural killer cells in a patient with recurrent infections.
Blood.
1996;88:3022-3027[Abstract/Free Full Text].
61.
Chanock SJ, Foster CB.
SNPing away at innate immunity.
J Clin Invest.
1999;104:369-370[Medline]
[Order article via Infotrieve].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
D. N. Forthal, G. Landucci, J. Bream, L. P. Jacobson, T. B. Phan, and B. Montoya
Fc{gamma}RIIa Genotype Predicts Progression of HIV Infection
J. Immunol.,
December 1, 2007;
179(11):
7916 - 7923.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. Chanock
Genetic Variation in the Immune System and Cancer Etiology: The Collision between Genes and Environment
Am. Assoc. Cancer Res. Educ. Book,
April 1, 2006;
2006(1):
39 - 42.
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. E. Brown, M. D. Fallin, J. J. Goedert, R. Chen, D. Whitby, C. B. Foster, C. Lauria, A. J. Alberg, A. Messina, M. Montella, et al.
A Common Genetic Variant in FCGR3A-V158F and Risk of Kaposi Sarcoma Herpesvirus Infection and Classic Kaposi Sarcoma
Cancer Epidemiol. Biomarkers Prev.,
March 1, 2005;
14(3):
633 - 637.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. B. Foster, T. Lehrnbecher, S. Samuels, S. Stein, F. Mol, J. A. Metcalf, K. Wyvill, S. M. Steinberg, J. Kovacs, A. Blauvelt, et al.
An IL6 promoter polymorphism is associated with a lifetime risk of development of Kaposi sarcoma in men infected with human immunodeficiency virus
Blood,
October 1, 2000;
96(7):
2562 - 2567.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. L. Shields, A. K. Namenuk, K. Hong, Y. G. Meng, J. Rae, J. Briggs, D. Xie, J. Lai, A. Stadlen, B. Li, et al.
High Resolution Mapping of the Binding Site on Human IgG1 for Fcgamma RI, Fcgamma RII, Fcgamma RIII, and FcRn and Design of IgG1 Variants with Improved Binding to the Fcgamma R
J. Biol. Chem.,
February 23, 2001;
276(9):
6591 - 6604.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction