|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 95 No. 8 (April 15), 2000:
pp. 2683-2690
NEOPLASIA
The t(5;17) acute promyelocytic leukemia fusion protein NPM-RAR
interacts with co-repressor and co-activator proteins and exhibits both
positive and negative transcriptional properties
Robert L. Redner,
J. Don Chen,
Elizabeth A. Rush,
Hui Li, and
Sheri L. Pollock
From the Division of Hematology/Oncology, Department of Medicine,
University of Pittsburgh Medical Center, and the University of
Pittsburgh Cancer Institute, Pittsburgh Pennsylvania; and the
Department of Pharmacology and Molecular Toxicology, University of
Massachusetts Medical School, Worcester, Massachusetts.
 |
Abstract |
The t(5;17) variant of acute promyelocytic leukemia (APL) fuses the
genes for nucleophosmin (NPM) and the retinoic acid receptor alpha
(RAR ). Two NPM-RAR molecules are expressed as a result of
alternative RNA splicing. Both contain RAR sequences that encode the
DNA binding, heterodimerization, and ligand activation domains of
RAR. This study was designed to test the ability of these fusion
proteins to act as transcriptional activators of retinoic acid
responsive promoters. The NPM-RAR fusion proteins bind to retinoic acid
response element sequences as either homodimers or as heterodimers with
RXR. Transcription of retinoic acid-inducible promoters is activated
by the fusion proteins in the presence of retinoic acid. The level of
transactivation induced by the NPM-RAR fusions differs from the level
of transactivation induced by wild-type RAR in both a promoter and
cell specific fashion, and more closely parallels the pattern of
activation of the PML-RAR fusion than wild-type RAR. In addition,
NPM-RAR decreases basal transcription from some promoters and acts in a
dominant-negative fashion when co-transfected with wild-type RAR.
Both NPM-RAR and PML-RAR interact with the co-repressor protein SMRTe
in a manner that is less sensitive than RAR to dissociation by
retinoic acid. Retinoic acid induces binding of the co-activator
protein RAC3. These data indicate that the NPM-RAR fusion proteins can modulate expression of retinoid-responsive genes in a positive or
negative manner, depending on context of the promoter, and lend support
to the hypothesis that aberrant transcriptional activation underlies
the APL phenotype.
(Blood. 2000;95:2683-2690)
© 2000 by The American Society of Hematology.
| |
Introduction |
Acute promyelocytic leukemia (APL, FAB M3) is
characterized by a rearrangement of 1 allele of the retinoic acid
receptor alpha (RAR ).1,2 RAR is a member of a class
of nuclear receptor proteins that activate transcription of retinoic
acid responsive genes. Like other members of the steroid receptor
superfamily, the secondary structure of RAR is organized into
modular functional units3: an A/B domain with
transcriptional activating functions, a DNA binding C domain containing
2 zinc fingers, a D hinge, and a complex E/F domain that mediates
ligand binding, dimerization, and interaction with co-repressor and
co-activator transcriptional proteins. RARs preferentially form
heterodimers with members of the RXR family of nuclear
receptors.4,5 As heterodimers, RARs bind to well-defined
DNA sequences (called retinoic acid response elements, or
RAREs)6 and, on binding ligand, initiate transcription from
target promoters.
The t(15;17) reciprocal chromosomal translocation that is found in
leukemic cells from over 95% of patients with APL introduces downstream elements of the RAR gene on chromosome 17 into the PML
locus on chromosome 15.7,8 The resulting PML-RAR fusion protein contains the N-terminal ring finger and leucine zipper motifs
of PML joined to the RAR B-F domains.
Strong evidence indicates that expression of the PML-RAR fusion protein
produces the APL phenotype.9-12 However, there is much
controversy over the molecular mechanism by which PML-RAR alters
myeloid growth and differentiation. PML-RAR retains the RAR DNA
binding motifs and can interact with RARE sequences in vitro. It
activates transcription from RARE reporter constructs in a
ligand-dependent fashion. However, PML-RAR activity differs from
wild-type RAR in a promoter- and cell-specific fashion, and can
inhibit wild-type RAR function in a dominant-negative fashion.7,13 For these reasons it has been proposed that
PML-RAR might function as an aberrant transcriptional activator of
retinoic acid-responsive genes.7,8,14 Related to its
putative function as a modulator of expression of retinoic
acid-responsive genes is the recent set of observations that indicates
PML-RAR binds to RAREs and recruits a co-repressor complex containing
the nuclear co-repressor N-CoR (or the homologous silencing mediator
for retinoid and thyroid hormone receptors SMRT), Sin3, and histone
deacetylase (HDAC1).15-18 This has led to the current
paradigm17 that, unlike wild-type RAR that binds the
co-repressor only in the absence of retinoic acid, PML-RAR continues to
bind the co-repressor complex even in the presence of physiologic
levels of retinoic acid, and releases the co-repressor only at
pharmacologic levels of retinoic acid.
Alternative hypotheses have also been put forward. PML-RAR contains the
dimerization domains of wild-type RAR and has been shown to bind the
RAR heterodimerization partner RXR. By competing for free RXR,
PML-RAR might inhibit the function of the unrearranged RAR.19 PML-RAR might also promote leukemogenesis by
disrupting the function of wild-type PML protein,20 which
has been shown to have a tumor suppresser function.21
One approach toward reconciling these seemingly disparate hypotheses is
to study the rare variants of APL that do not express the PML-RAR
fusion protein. The first such variant to be characterized was the
t(11;17) of which 6 cases have been described
worldwide.22,23 Blasts with the t(11;17) genotype, though,
differ phenotypically from t(15;17) blasts, and do not differentiate
when exposed to all-trans retinoic acid. It has been proposed
that this phenotypic difference could be explained by the finding that
the PLZF-RAR fusion product of t(11;17) is a less potent
transcriptional activator than PML-RAR.24,25 This concept
is further supported by recent studies indicating that PLZF-RAR forms
more stable interactions with co-repressor molecules.18
Our group has characterized the t(5;17) variant, of which 3 cases have
been identified.26,27 The t(5;17) blasts are
morphologically similar to t(15;17) cells. Furthermore, like t(15;17),
t(5;17) leukemic cells differentiate in vitro when cultured with
all-trans retinoic acid.28 These phenotypic
similarities make t(5;17) an important model system in which to
identify common molecular pathways that underlie APL.
The t(5;17) chromosomal rearrangement translocates the genomic loci for
the nucleolar phosphoprotein nucleophosmin (NPM) and RAR.27 Two NPM-RAR fusion proteins are expressed as a
result of alternative splicing. NPMS-RAR contains 119 N-terminal amino acids of NPM; NPML-RAR contains an
additional 43 amino acids immediately upstream to the junction with
RAR sequence. Both forms of NPM-RAR fuse NPM sequence to the B-F
domains of RAR that encode DNA binding, ligand binding, heterodimer
formation, and transcriptional activation. This is the same region of
RAR that is contained in the PML-RAR and PLZF-RAR fusions.
We characterize the ability of the NPM-RAR proteins to act as
ligand-dependent transcriptional activators. We demonstrate that
NPM-RAR-mediated transcriptional activation differs from wild-type
RAR in a fashion that is both promoter and cell-type dependent. Both
NPM-RAR fusion proteins interact with RAREs either as homodimers or
heterodimers with RXR. Furthermore, both fusion proteins bind
corepressor and coactivator proteins with retinoic acid dependence
similar to PML-RAR. These results support the hypothesis that aberrant
transcriptional activation of retinoic acid responsive genes
contributes to the APL phenotype.
| |
Materials and methods |
Cell culture and transfection protocols
CV1.
CV1 cells were obtained from the American Type Culture Collection
(ATCC; Bethesda, MD), and maintained in a humidified 5% CO2 atmosphere in Dulbecco's modified Eagle's medium
(DMEM; Mediatech, Herndon, VA) supplemented with glutamine, pen/strep,
and 10% fetal bovine serum (FBS) (GIBCO, Grand Island, NY). Sixteen
hours prior to transfection, 2 × 105 cells were
replated in 6-well dishes with media containing delipidated FBS
(Cocalico Biologicals, Reamstown, PA). Cells were transfected using
Lipofectamine (GIBCO) and OptiMem serum-free media (GIBCO) according to
the manufacturer's protocol; after 5 hours of incubation with the
lipofectamine-DNA complexes, the media was readjusted to 10%
delipidated FBS containing 1 µM all-trans retinoic acid (Sigma, St. Louis, MO) or an equal volume of ethanol vehicle. Transfection mixes contained 625 ng of chloramphenical acetyl transferase (CAT)-reporter plasmid, 125 ng of test transcriptional activator, pBluescript II KS as carrier, and 100 ng of RSV-luciferase as a transfection control.
HeLa.
HeLa cells were obtained from the ATCC. The cells were grown under the
same conditions as CV1 cells. Sixteen hours before transfection, cells
were plated in delipidated medium. Cells were transfected by
coprecipitation of CaPO4-DNA complexes.29 Six hours after application of the DNA precipitates, the cells were washed
and fresh delipidated medium containing 1 µM retinoic acid or ethanol
vehicle was added.
K562.
K562 cells were obtained from the ATCC. Cells were grown in RPMI 1640 (Mediatech) supplemented with glutamine, pen/strep, and 10% FBS.
Sixteen hours prior to transfection cells were washed and plated in
RPMI containing 10% delipidated FBS. K562 cells were electroporated
using a Gene Pulser (Bio-Rad, Hercules, CA) at 270 mV and 960 µF.
107 cells were transfected with a total of 20 µg of CAT
reporter plasmid, transcriptional activator expression vector, RSV-luciferase, and carrier DNA in the same molar ratios as for
the CV1 and HeLa transfections. Ater transfection the cells were
incubated on ice for 15 minutes and plated in delipidated medium
containing 1 µM retinoic acid or ethanol vehicle.
U937.
U937 cells were obtained from the ATCC. Culture and electroporation
conditions were the same as for K562 cells.
Luciferase and CAT assays
Twenty-four hours after transfection, the cells were washed and
lysed in 100 mM KHPO4 buffer, pH 7.8. Luciferase activity was determined by standard protocol29 using an AutoLumat LB 953 (Wallac, Gaithersburg, MD). CAT activity was quantitated by scintography of xylene extracted C14-chloramphenicol-butyrate reaction
product, using standard protocols.29
Electrophoretic mobility shift assays
NPMS-RAR, NPML-RAR, and mRXR
complementary DNAs (cDNAs), cloned into either pBluescript II KS or
pSG5, were used to program reticulocyte lysates (TNT Coupled
Reticulocyte Lysate System, Promega, Madison, WI). Expression of
appropriately sized proteins was confirmed by immunoblotting using
either a polyclonal rabbit antiserum that recognizes the C-terminus of
RAR (gift from P. Chambon), or a monoclonal anti-RXR antibody
(Affinity Bioreagents, Golden, CO). The amount used for each assay was
adjusted to compensate for discrepancies in the efficiency of the in
vitro translation reactions. The in vitro translation product was
incubated at room temperature for 20 minutes with 10 fmol
32P-labeled oligonucleotide in 20 mM Hepes pH 7.9 buffer
containing 50 mmol/L KCl, 2.5 mmol/L MgCl2, 10% glycerol,
1 mmol/L DTT, and 1 µg salmon sperm DNA (for some reactions 2 µg
poly (dI:dC) was used instead of salmon sperm carrier). The reaction
mix was loaded onto a 4% nondenaturing polyacrylamide gel. After
electrophoresis, the gel was dried and exposed to Biomax MR film
(Kodak, Rochester, NY). The sequence of the RAR RARE oligonucleotide
is AGCTTGGGTAGGGTTCACCGAAAGTTCACTCGA30,31; for the
cold-competition experiments a control unrelated oligonucleotide GATCGAAGACTAATCATGTCTGGGCAGATC, corresponding to a sequence in the p21
promoter,32 was used. Labeling of oligonucleotide was performed by Klenow fill-in reaction in the presence of
32P-dCTP (NEN, Boston, MA).
Coprecipitation
The coding sequence for NPMS-RAR was subcloned into a
malE expression vector (New England Biolabs, Beverly, MA) in the
appropriate reading frame to encode a maltose-binding protein (MBP)
fusion. MBP-NPMS-RAR or control MBP protein was
affinity-purified from bacterial lysates using amylose resin. 30 µg
malE-fusion protein and 20 µL of
35S-methionine-programmed reticulocyte lysate were mixed
for 4 hours at 4°C in 20 mmol/L Tris pH8, 110 mmol/L NaCl, 1 mmol/L
EDTA, and 0.5% NP-40, and then allowed to bind to amylose resin. After extensive washing, the resin was boiled and the eluted products subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The gels were dried and imaged by autoradiography.
Co-immunoprecipitation
Programmed reticulocyte lysate (10 µL) was mixed at 4°C in 20 mmol/L Hepes pH 7.9, 50 mmol/L NaCl, 1 mmol/L EDTA, 5% glycerol, 0.05% Triton X-100, and 0.5% bovine serum albumin, and then incubated with 1 µg antibody (either anti-RXR rabbit polyclonal
[Santa Cruz Biotechnology, Santa Cruz, CA] or anti-RAR rabbit
polyclonal [Santa Cruz Biotechnology]) for an additional 16 hours.
Complexes were precipitated with Protein A-sepharose (Pharmacia,
Piscataway, NJ), washed, boiled, and fractionated by SDS-PAGE. After
electrophoresis, the gel was dried and imaged by autoradiography.
Far-Western analysis
Far-Western blot analysis was conducted as described.33
Bacterially expressed GST-fusion proteins were purified using
glutathione agarose beads and separated in SDS-PAGE. Proteins were
transferred onto nitrocellulose membrane in 25 mM Tris-HCl, pH 8.3, 192 mM glycine, 0.01% SDS. The bound proteins were denatured in 6 mol/L guanidine hydrochloride (GnHCl), and renatured by stepwise dilution of
GnHCl in hybridization buffer (25 mM Hepes pH 7.7, 25 mM NaCl, 5 mM
MgCl2, 1 mM DTT). The filters were blocked overnight with 5% nonfat milk in the hybridization buffer followed by a rinse in 1%
nonfat milk plus 0.05% NP-40. In vitro translated
35S-methionine labeled proteins generated in reticulocyte
lysate (Promega) were hybridized to the immobilized proteins overnight in 20 mM Hepes, pH 7.7, 75 mM KCl, 0.1 mM EDTA, 2.5 mM
MgCl2, 0.05% NP-40, 1% milk, 1 mM DTT. After
hybridization, the membrane was washed 3 times with hybridization
buffer and the bound probe was detected by autoradiography.
| |
Results |
NPM-RAR acts as a retinoic acid-dependent transcriptional
activator
Preliminary observations indicated that NPMS-RAR and
NPML-RAR are able to activate transcription of an
mRAR2-CAT reporter construct in a ligand-dependent
fashion.27 We sought to determine whether such
ligand-dependent transcriptional activation shows similar promoter and
cell specificity as has been reported for PML-RAR.7,8,14 We
compared the ability of NPMS-RAR, NPML-RAR, PML-RAR, and RAR to activate transcription of a series of retinoic acid-dependent reporter plasmids in CV1 monkey kidney cells, HeLa human cervical carcinoma cells, and K562 human myeloid leukemia cells.
As reporter constructs 2 artificial RAREs (TREp-CAT34 and
[TRE3]3-TK-CAT35), and 4 naturally occurring retinoic
acid responsive promoters (mRAR2-CAT containing 3.75 kb upstream to the mRAR2 cap site,36,37 mRAR2-CAT containing 1.3 kb
of promoter and 5'-untranslated sequence of
mRAR2,38 CRABP-II CAT containing 2.5 kb of CRABP-II
promoter,39 and CRBP-I CAT containing 2027 bases upstream
to the transcriptional start site of CRBP-I36) were used.
The graphs of Figure 1 present the ratio of
CAT activity (normalized for transfection efficiency) from transfected
cells incubated with retinoic acid compared with the ethanol control. CRBP-I CAT data are not presented in the analysis of K562 cells because
the CAT activities were not significantly different from the no-lysate
negative control.
View larger version (27K):
[in this window]
[in a new window]
| Fig 1.
Transcriptional activation. Expression vector pSG5
containing the coding sequence for RAR, PML-RAR,
NPMS-RAR, or NPML-RAR was transfected into CV1,
HeLa, or K562 cells along with CAT reporter genes driven by the CRABP
II, (TRE3)3-tk, CRBP I, mRAR2, mRAR2, or TREp promoter elements,
and RSV-luciferase. Cells were incubated in 1 µM retinoic acid or
ethanol vehicle for 16 hours after transfection and harvested for
luciferase and CAT activity. The values indicate the ratio of the CAT
activity induced with retinoic acid compared to ethanol, normalized for
transfection efficiency. The mean and standard deviations for a minimum
of 2 independent transfections are shown.
|
|
The level of ligand-dependent activation by wild-type RAR varied for
each reporter, as previously described.40 The variation of
the level of activation generated with the control vector between cell
lines, particularly evident with the mRAR-CAT and mRAR2-CAT reporters, most likely reflects the activity of endogenous RARs and RXRs.
For each cell line, NPMS-RAR and NPML-RAR were
similar in the degree of activation of each reporter construct, with
NPML-RAR inducing slightly higher levels of transcription.
Compared with RAR, the NPM-RAR fusion proteins were more active in
CV1 cells toward CRABPII, but less efficient toward the
mRAR2 reporter. In HeLa cells, both NPM-RAR fusion proteins
were less efficient transcriptional activators than wild-type RAR
for all the test constructs. With the mRAR2-CAT and mRAR2-CAT
reporters, the level of retinoic acid-induced transcription was less
than that generated with the control vector, suggesting that the
NPM-RAR fusions might be acting as inhibitors of endogenous RAR
activation of these reporters.
NPM-RARs form homodimers
In vitro interactions of the NPM-RARs with a target RARE were
assessed in an electrophoretic mobility shift assay (EMSA). Figure
2 indicates that NPMS-RAR and
NPML-RAR bind and retard the migration of a radiolabeled
RARE. This was observed both with NPM-RAR proteins derived from in
vitro translation (Figure 2A) or with affinity purified MBP-NPM-RAR
protein (Figure 2C). The specificity of this reaction is documented by
the competition reaction using cold RARE (Figure 2B and data not
shown). The RAR oligonucleotide contains a direct repeat of 2 consensus half-sites30,31; binding of NPM-RAR to this site
led us to question whether the NPM-RAR fusion proteins might interact
with DNA as a homodimer. To directly test the ability of NPM-RAR to
homodimerize in solution, we incubated MBP-NPMS-RAR with in
vitro translated 35S-NPMS-RAR protein, and captured the
complexes using amylose resin (Figure 3).
Recovery of the radiolabeled NPMS-RAR with
MBP-NPMS-RAR, but not the MBP control, indicates that
NPMS-RAR is able to form homodimers in solution.
View larger version (45K):
[in this window]
[in a new window]
| Fig 2.
Electrophoretic mobility shift assay. (A) Two µL of
NPMS-RAR charged reticulocyte lysate (left panel) or 5 µL
NPML-RAR reticulocyte lysate (right panel) was incubated
with 0, 0.1, 0.2, 0.5, or 1.0 µl RXR reticulocyte lysate before
incubation with radiolabeled RAR oligonucleotide. (B) In vitro
translated NPMS-RAR + RXR, NPML-RAR + RXR, or
RXR alone were preincubated with 100-fold excess of cold control
oligonucleotide (lane 1), cold RAR oligonucleotide (lane 2), or no
oligonucleotide (lane 3) before addition of the radiolabeled RAR
oligonucleotide. (C) 1 µg affinity purified
MBP-NPMS-RAR was incubated with the radiolabeled RAR
oligonucleotide (lane 1) or preincubated with 100- (lane 2) or
1000-fold (lane 3) molar excess of unlabeled RAR oligonucleotide
before incubation with the labeled oligonucleotide.
|
|
View larger version (33K):
[in this window]
[in a new window]
| Fig 3.
NPMS-RAR forms homodimers. In vitro
translated 35S-NPMS-RAR was incubated with MBP
or MBP-NPMS-RAR protein. Complexes were purified over
amylose resin and analyzed on 8% SDS-PAGE.
|
|
NPM-RAR can heterodimerize with RXR
Because the NPM-RAR fusion proteins contain the heterodimerization
domains of RAR, it is reasonable to postulate that they might form
heterodimers with RXR. To determine whether NPM-RAR can form
heterodimers as well as homodimers, we incubated in vitro translated
radiolabeled RXR with soluble MBP-NPMS-RAR, and captured the complexes with amylose resin. Figure 4A
indicates that MBP-NPMS-RAR, but not control MBP protein,
is able to form a stable complex with RXR. To confirm this data, we
tested whether in vitro translated NPMS-RAR and RXR would associate in
a complex that could be immunoprecipitated by antibodies to either
constituent. Figures 4B and 4C indicate that NPMS-RAR and
RXR proteins form a stable heterodimer complex that can be precipitated
with either anti-RAR or anti-RXR antisera. Furthermore, co-transfection
of RXR with NPMS-RAR or NPML-RAR increased
ligand-inducible activation of an RARE-reporter construct (data not
shown).
View larger version (48K):
[in this window]
[in a new window]
| Fig 4.
NPMS-RAR forms heterodimers with RXR. (A)
In vitro translated 35S-RXR was incubated with MBP or
MBP-NPMS-RAR protein. Complexes were purified over amylose
resin and analyzed on 8% SDS-PAGE. (B) 35S-RXR was
preincubated with in vitro translated NPMS-RAR or control
reticulocyte lysate before addition of anti-RAR antibody. Complexes
were precipitated with Protein A-sepharose and analyzed on 8%
SDS-PAGE. (C) 35S-NPMS-RAR was preincubated
with in vitro translated RXR or control reticulocyte lysate before
addition of anti-RXR antibody. Complexes were precipitated with Protein
A-sepharose and analyzed on 8% SDS-PAGE.
|
|
If NPM-RAR can form homodimers or heterodimers, in which form does it
preferentially interact with DNA? To address this issue, we
preincubated the in vitro translated NPM-RAR with increasing amounts of
RXR before performing an EMSA (Figure 2). We found that co-incubation
of NPMS-RAR or NPML-RAR with less than
equimolar amounts of RXR led to 5- to 10-fold increased binding of the
RARE oligonucleotide, suggesting that the heterodimer-DNA complexes are
more stable than the homodimer-DNA complexes. RXR alone did not induce
a mobility shift of the RARE (Figure 2B). Intensity of the retarded
complex decreased on preincubation with an excess of unlabeled RARE,
indicating the specificity of this protein-DNA binding reaction (Figure
2B).
NPM-RAR acts as a dominant-negative inhibitor of RAR
We observed that in the absence of retinoic acid, the basal
transcription of several reporter constructs decreased on
cotransfection of NPMS-RAR and NPML-RAR (Figure
5). This suggested that the NPM-RAR proteins might act as dominant negatives for endogenous RAR, similar
to what has been described for PML-RAR.7,13 To further investigate this possibility, we assessed the ability of co-transfected NPMS-RAR or PML-RAR to modulate RAR function. Both
NPMS-RAR and PML-RAR suppressed the level of retinoic
acid-induced activation of an RARE-reporter construct (Figure
6). This indicates that like PML-RAR,
NPMS-RAR can act as a dominant-negative inhibitor of
RAR.
View larger version (23K):
[in this window]
[in a new window]
| Fig 5.
NPM-RAR decreases basal transcription of reporter
constructs. Cells were transfected with pSG5, or expression
plasmids encoding PML-RAR, NPMS-RAR or NPML-RAR
along with a reporter construct and transfection control as in Figure
1. Cells were harvested 16 hours after transfection, without addition
of exogenous retinoic acid. The relative CAT enzyme activity for each
experiment was normalized to the activity in cells transfected with
pSG5. (A) TRE3-CAT in HeLa cells; (B) RAR2-CAT in K562 cells; (C)
RAR2-CAT in HeLa cells.
|
|
View larger version (29K):
[in this window]
[in a new window]
| Fig 6.
NPMS-RAR inhibits transcriptional activation
by RAR. HeLa or U937 cells were transfected with mRAR2-CAT
and a luciferase transfection control along with equimolar amounts of
pSG5 + RAR, PML-RAR + RAR, or NPMS-RAR + RAR.
Cells were incubated in 1 µM retinoic acid or ethanol vehicle for 16 hours after transfection and harvested for luciferase and CAT activity.
The values indicate the ratio of the CAT activity induced with retinoic
acid compared to ethanol, normalized for transfection efficiency.
|
|
NPM-RAR interaction with nuclear receptor co-repressor and
co-activator proteins
Transcriptional repression and activation by RAR is mediated
through ligand-dependent recruitment of co-repressor or co-activator complexes (see review by Redner et al41). In the absence of retinoic acid, RAR binds directly to the co-repressor molecules SMRT
or N-CoR. In the presence of retinoic acid, RAR releases the
co-repressor complex and binds a receptor-associated co-activator protein (RAC33,42), which itself recruits other
co-activator proteins.33 We used Far-Western analysis to
assess the interactions of NPM-RAR with the co-repressor
SMRTe43 and the co-activator RAC3.42 The
specific activity of the probes were all similar and identical exposure
times used. In the absence of ligand, wild-type RAR and both NPM-RAR
and PML-RAR interact efficiently with C-SMRT (corresponding to AA
1993-2507 of hSMRTe), suggesting that the fusion proteins are not
defective in co-repressor association (Figure
7). As expected, unliganded RAR and the
RAR fusion proteins fail to interact with the co-activator RAC3 in the
absence of ligand.
View larger version (27K):
[in this window]
[in a new window]
| Fig 7.
NPM-RAR interacts with the co-repressor SMRTe and the
co-activator RAC3. (A) Autoradiographs show the in vitro translated
35S-methionine labeled proteins used in the Far-Western
blots. (B) Far-Western blots show the interaction of in vitro
translated RAR, NPM-RAR, and PML-RAR fusion proteins with GST-SMRTe
(AA 1993-2507) and GST-RAC3 ID (AA 613-752) in the absence ( RA)
or presence (+ RA) of 1 µM ATRA. The specific activity of all probes
were similar and the exposure time identical in 1 film. (C) Far-Western
blot analyses show the interaction of wild-type NPM, PML-1, and PLZF
with GST-SMRTe (1993-2507).
|
|
Binding of retinoic acid to RAR efficiently dissociates SMRTe from
the receptor and recruits the co-activator RAC3. We found that the
association of SMRTe with the NPM-RAR fusion proteins is resistant to
retinoic acid-induced dissociation (Figure 7B). Quantitation of the
bound probes by PhosporImager analysis indicated that only 18% of the
RAR probe that bound to the GST-SMRTe in the absence of ligand
remained bound in the presence of ligand. Compared with the RAR
probe, almost 3 times as much PML-RAR and twice as much NPM-RAR probe
remained associated with GST-SMRTe in the presence of 1 µM retinoic
acid. Interestingly, even though retinoic acid could not cause
efficient release of the co-repressor, it is capable of inducing tight
association with the co-activator RAC3 (Figure 7B). PhosphorImage
analysis indicated that there was a 2- to 3-fold higher affinity
between NPM-RAR or PML-RAR for the GST-RAC3 compared to wild-type
RAR. In addition, we also tested whether wild-type NPM could
interact with the co-repressor. We found no evidence of association
between NPM and SMRTe under conditions that allow SMRTe to interact
with PLZF (Figure 7C). These data suggest that NPM-RAR behaves
similarly to PML-RAR in terms of protein-protein interactions with
co-repressor and co-activator.
| |
Discussion |
We have previously identified 2 alternatively spliced forms of
NPM-RAR that are expressed as a result of the t(5;17) translocation in
APL.27 Both contain the DNA binding, dimerization, ligand binding, and C-terminal activation domains of RAR. We demonstrate here that both fusion proteins act as ligand-dependent transcriptional activators of a series of retinoic acid-responsive reporter
constructs. We show that both forms of NPM-RAR interact with DNA as
either homodimers or as RXR heterodimers. In addition, NPM-RAR
interacts with co-activator and co-repressor proteins in a manner
similar to PML-RAR.
The ability to form homodimer or heterodimer complexes has also been
observed for PML-RAR14 and PLZF-RAR.44
Heterodimer formation is mediated by the RAR E-domain coiled coil as
well as a dimerization interface in the second zinc
finger,45 and we presume that this region also mediates
NPM-RAR/RXR heterodimerization. PML-RAR homodimer formation is
primarily mediated through its PML-leucine zipper domain.14
PLZF-RAR homodimer formation is mediated through the POZ
domain.44 We have not as yet mapped the domains of NPM-RAR
that mediate homodimer formation. However, N-terminal NPM domains
contained within the NPM-RAR fusion have been implicated in wild-type
NPM oligomerization46 and might be sufficient to mediate
NPM-RAR homodimer formation. Alternatively, the coiled-coil of the
RAR E-domain has been shown to mediate weak RAR homodimer
formation,40 and might contribute to the stability of
NPM-RAR homodimers. Whether the transcriptional activation that we
observe is attributable to NPM-RAR homodimers or heterodimers is
difficult to determine. The EMSA experiments presented in Figure 2
indicate that less than equimolar amounts of RXR increase DNA binding
of NPM-RAR 5- to 10-fold. This would indicate that the Ka for the
heterodimer complex must be greater that the Ka for the homodimer
complex, and suggests that NPM-RAR/RXR/RARE complexes would
preferentially form over homodimer/RARE. All of the cell lines tested
have endogenous RXRs, and it may be the case that the level of
activation reflects heterodimerization with a limiting amount of
endogenous RXR; CV1 cells, which have low levels of endogenous RXR,
gave uniformly low levels of transcriptional activation (Figure 1),
whereas increasing the level of RXR by transfection of exogenous
mRXR augmented transcriptional activation (data not shown).
There is marked variation between the activity of NPM-RAR and wild-type
RAR. This was seen with different promoters in the same cell line or
for the same promoter in different cell lines. These differences may
indicate alteration in DNA binding specificity caused by fusion of
RAR to NPM, or modification in interactions with co-activator or
co-repressor proteins (see below). Moreover, the level of induction of
both NPM-RAR fusion proteins for each test plasmid more closely
paralleled PML-RAR than RAR, with the only exception being the
artificial construct TREp-CAT34 assayed in CV1 cells.
We found that both NPM-RAR fusion proteins have a dominant negative
function over RAR. This conclusion is supported by both the
suppression of basal transcription (Figure 5) and of RAR-mediated activation by NPM-RAR (Figure 6). Indeed, in HeLa cells, NPM-RAR acted
as a transcriptional repressor toward the mRAR2- and
mRAR2-reporters (Figure 1).
Recently, several lines of evidence have indicated that the suppressive
effects of PML-RAR and PLZF-RAR might be mediated through binding a
co-repressor complex.15-18 Both PML-RAR and PLZF-RAR bind
to retinoic acid response elements, and tether a co-repressor protein
(SMRT or N-CoR) that recruits Sin3 and HDAC1. HDAC1 removes acetyl
groups from nucleosomal histones in the neighborhood of the promoter,
to allow the histones to bind more tightly to DNA, and to inhibit
access of transcriptional machinery to the DNA template. Unlike
wild-type RAR, PML-RAR and PLZF-RAR do not release the co-repressor
complex on binding physiologic levels of retinoic acid, and so continue
to repress transcription of genes that otherwise would be activated by
physiologic doses of retinoic acid. Only at pharmacologic levels of
retinoic acid does PML-RAR release the co-repressor complex. Because of
a second co-repressor binding site in its POZ domain, PLZF-RAR does not
release the co-repressor; this presumably explains the lack of retinoic
acid responsiveness that characterizes PLZF-RAR APL.
We have found that wild-type NPM by itself does not bind SMRTe (Figure
7C). Our observation that NPM-RAR binding to SMRTe is incompletely
reversed by retinoic acid is consistent with previous studies on
PML-RAR.17 Of note, the Far-Western blot (Figure 7B)
indicates a residual interaction between RAR and GST-SMRTe in the
presence of ligand; this has been seen as well in yeast 2 hybrid and
mammalian 2 hybrid assays (J.D.C, unpublished data), and may indicate
that a small proportion of receptors fail to bind ligand.
Nevertheless, the interaction between NPM-RAR or PML-RAR with
GST-SMRTe in the presence of retinoic acid was 2- and 3-fold greater
than wild-type RAR. This finding suggests that NPM-RAR behaves
similarly to PML-RAR in its reduced retinoic acid sensitivity in
interaction with co-repressors,17 and is consistent with
our prior observation that t(5;17) blasts are sensitive to the
differentiating effects of high dose (1 µM) retinoic acid.28
The finding that NPM-RAR and PML-RAR are able to bind the co-activator
RAC3 at concentration of retinoic acid at which the fusion proteins do
not fully release SMRTe may indicate lack of uniformity of binding of
ligand. Alternatively, this observation may suggest that the fusion
proteins might bind both co-repressor and co-activator proteins
simultaneously, and that there might be cross-talk between the
co-repressor and co-activator in regulating transcriptional activity of
the APL fusion proteins. Such a speculative model might account for the
previously observed synergy between retinoic acid and HDAC1
inhibitors17,47,48; conceivably, retinoic acid could induce
recruitment of a co-activator complex, whereas the HDAC inhibitor
blocks the effects of the tethered co-repressor complex. The net result
of the combination of histone acetylase and inhibited histone
deacetylase activity would be hyperacetylation of promoter histones,
leading to decreased affinity of the acetylated histones for DNA, and
access of the transcriptional machinery to the DNA template. The
interaction of APL fusion proteins with co-activator complexes has not
been previously studied; it is as yet unclear whether RAC3 binds to
NPM-RAR and PML-RAR through the RAR E-domain, or perhaps through a
novel site. PhosphorImager analysis of the Far-Western blot suggests
that the affinity of these fusion proteins for RAC3 may be greater than
wild-type RAR.
The identification of a molecular pathway that is perturbed by both
NPM-RAR and PML-RAR would implicate it as a key mechanism underlying
APL. Recent mutational analyses of PML-RAR suggest that the
transcriptional activation properties of PML-RAR are critical for its
biologic function.25,49 Our observations strongly support
the hypothesis that aberrant transcriptional activation or suppression
of retinoid-inducible genes underlies APL. It remains to be determined
which of the retinoic acid-responsive genes are critical to
development of the APL phenotype.
| |
Acknowledgments |
pSG5-hRAR, mRAR2-CAT, mRAR2-CAT, CRABP-II-CAT, CRBP-I-CAT,
(TRE3)3-tk-CAT, and the rabbit anti-RAR antiserum were gifts from P. Chambon. TREp-CAT and PML-RAR cDNA were gifts from R. Evans, and
mRXR cDNA was a gift from K. Ozato. We would also like to thank D. Johnson, D. Tweardy, and T. Wright for helpful discussions, and R. Steinman and S. Brandt for critical reading of the manuscript.
| |
Footnotes |
Submitted October 28, 1998; accepted December 20, 1999.
Supported by National Institutes of Health Grant No. R29 CA67346
(R.L.R.), the American Institute for Cancer Research Grant No. 96B057
(R.L.R.), and American Cancer Society Grant No. 98-085-01-LBC (J.D.C.).
Reprints: Robert L. Redner, E1058 Biomedical Science Tower,
University of Pittsburgh Medical Center, 211 Lothrop St, Pittsburgh, PA
15213; e-mail: redner+{at}pitt.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
de The H, Chomienne C, Lanotte M, Degos L, Dejean A.
The t(15;17) translocation of acute promyelocytic leukaemia fuses the retinoic acid receptor alpha gene to a novel transcribed locus.
Nature.
1990;347:558[Medline]
[Order article via Infotrieve].
2.
Warrell R Jr, de The H, Wang ZY, Degos L.
Acute promyelocytic leukemia.
N Engl J Med.
1993;329:177[Free Full Text].
3.
Evans R.
The steroid and thyroid hormone receptor superfamily.
Nature.
1988;240:889.
4.
Leid M, Kastner P, Lyons R, et al.
Purification, cloning, and RXR identity of the HeLa cell factor with which RAR or TR heterodimerizes to bind target sequences efficiently.
Cell.
1992;68:377[Medline]
[Order article via Infotrieve].
5.
Yu VC, Delsert C, Andersen B, et al.
RXR beta: a coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements.
Cell.
1991;67:1251[Medline]
[Order article via Infotrieve].
6.
Umesono K, Murakami KK, Thompson CC, Evans RM.
Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors.
Cell.
1991;65:1255[Medline]
[Order article via Infotrieve].
7.
de The H, Lavau C, Marchio A, Chomienne C, Degos L, Dejean A.
The PML-RAR alpha fusion mRNA generated by the t(15;17) translocation in acute promyelocytic leukemia encodes a functionally altered RAR.
Cell.
1991;66:675[Medline]
[Order article via Infotrieve].
8.
Kakizuka A, Miller WJ, Umesono K, et al.
Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML.
Cell.
1991;66:663[Medline]
[Order article via Infotrieve].
9.
Brown D, Kogan S, Lagasse E, et al.
A PMLRARalpha transgene initiates murine acute promyelocytic leukemia.
Proc Natl Acad Sci U S A.
1997;94:2551[Abstract/Free Full Text].
10.
Early E, Moore MA, Kakizuka A, et al.
Transgenic expression of PML/RARalpha impairs myelopoiesis.
Proc Natl Acad Sci U S A.
1996;93:7900[Abstract/Free Full Text].
11.
Grisolano JL, Wesselschmidt RL, Pelicci PG, Ley TJ.
Altered myeloid development and acute leukemia in transgenic mice expressing PML-RAR alpha under control of cathepsin G regulatory sequences.
Blood.
1997;89:376[Abstract/Free Full Text].
12.
He LZ, Tribioli C, Rivi R, et al.
Acute leukemia with promyelocytic features in PML/RARalpha transgenic mice.
Proc Natl Acad Sci U S A.
1997;94:5302[Abstract/Free Full Text].
13.
Pandolfi PP, Grignani F, Alcalay M, et al.
Structure and origin of the acute promyelocytic leukemia myl/RAR alpha cDNA and characterization of its retinoid-binding and transactivation properties.
Oncogene.
1991;6:1285[Medline]
[Order article via Infotrieve].
14.
Perez A, Kastner P, Sethi S, Lutz Y, Reibel C, Chambon P.
PMLRAR homodimers: distinct DNA binding properties and heterodimeric interactions with RXR.
EMBO J.
1993;12:3171[Medline]
[Order article via Infotrieve].
15.
Lin RJ, Nagy L, Inoue S, Shao WL, Miller WH, Evans RM.
Role of the histone deacetylase complex in acute promyelocytic leukaemia.
Nature.
1998;391:811[Medline]
[Order article via Infotrieve].
16.
Grignani F, Dematteis S, Nervi C, et al.
Fusion proteins of the retinoic acid receptor-alpha recruit histone deacetylase in promyelocytic leukaemia.
Nature.
1998;391:815[Medline]
[Order article via Infotrieve].
17.
Guidez F, Ivins S, Zhu J, Soderstrom M, Waxman S, Zelent A.
Reduced retinoic acid-sensitivities of nuclear receptor corepressor binding to pml- and plzf-rar-alpha underlie molecular pathogenesis and treatment of acute promyelocytic leukemia.
Blood.
1998;91:2634[Abstract/Free Full Text].
18.
He LZ, Guidez F, Tribioli C, et al.
Distinct interactions of pml-rar-alpha and plzf-rar-alpha with co-repressors determine differential responses to ra in apl.
Nat Genet.
1998;18:126[Medline]
[Order article via Infotrieve].
19.
Weis K, Rambaud S, Lavau C, et al.
Retinoic acid regulates aberrant nuclear localization of PML-RARa in acute promyelocytic leukemia cells.
Cell.
1994;76:345[Medline]
[Order article via Infotrieve].
20.
Dyck JA, Gerd GG, Miller WH, Chen JD, Kakizuka A, Evans RM.
A novel macromolecular structure is a target of the promyelocyte-retinoic acid receptor oncoprotein.
Cell.
1994;76:333[Medline]
[Order article via Infotrieve].
21.
Mu ZM, Chin KV, Lozano G, Liu JH, Chang KS.
A growth suppressor disrupted in acute promyelocytic leukemia.
Mol Cell Biol.
1994;14:6858[Abstract/Free Full Text].
22.
Chen Z, Brand NJ, Chen A, et al.
Fusion between a novel Kruppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia.
EMBO J.
1993;12:1161[Medline]
[Order article via Infotrieve].
23.
Licht JD, Chomienne C, Goy A, et al.
Clinical and molecular characterization of a rare syndrome of acute promyelocytic leukemia associated with translocation (11;17).
Blood.
1995;85:1083[Abstract/Free Full Text].
24.
Chen Z, Guidez F, Rousselot P, et al.
PLZF-RARa fusion proteins generated from the variant t(11;17)(q23;q21) translocation in acute promyelocytic leukemia inhibit li |
Top
Abstract
Introduction