|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 96 No. 1 (July 1), 2000:
pp. 347-354
TRANSPLANTATION
Thymic atrophy in murine acute graft-versus-host disease is
effected by impaired cell cycle progression of host
pro-T and pre-T cells
Werner Krenger,
Simona Rossi,
Luca Piali, and
Georg A. Holländer
From the Laboratory of Pediatric Immunology, The Children's
University Hospital, and the Department of Research, Kantonsspital
Basel, Basel University, Switzerland.
 |
Abstract |
Reconstitution of the peripheral T-cell compartment is a critical
aspect for the success of bone marrow transplantation and is also
dependent on the reestablishment of normal thymic structure and
function. Graft-versus-host disease (GVHD), however,
exacerbates posttransplant immunodeficiency through a deleterious
effect on thymic function. To investigate the mechanisms of
GVHD-mediated thymic disease, 2 murine parent F1
transplantation models of acute and chronic GVHD, respectively,
were studied. Acute GVHD was associated with changes in thymic
architecture and a reduction in cellularity mainly because of the
decrease in CD4+CD8+, or double-positive
(DP) thymocytes, to less than 15% of values found in mice without
GVHD. Simultaneously, mature donor-derived T cells expanded in the
confines of the allogeneic thymic microenvironment, leading to local
inflammation. Through analysis of in vivo cell proliferation, we
demonstrated that the ensuing depletion of DP thymocytes was secondary
to a decreased commitment of resident pro-T and pre-T cells to enter
the cell cycle. Moreover, DP cells themselves showed altered
proliferative capacities in the presence of acute GVHD. These findings
suggested that thymic atrophy in acute GVHD is effected by
impaired cellular proliferation of immature host thymocytes and that
the failure of these cells to enter the cell cycle is dependent on an
interferon (IFN)- -driven immune response. In contrast,
interleukin-4-driven chronic GVHD was not accompanied by a sustained
thymic infiltration of donor T cells. Consequently, there was a lack of
apparent structural changes, a restricted in situ transcription of
inflammatory cytokines, and a virtually unchanged cell cycle
progression in vivo.
(Blood. 2000;96:347-354)
© 2000 by The American Society of Hematology.
| |
Introduction |
After bone marrow transplantation (BMT), the peripheral
T-cell pool is regenerated through thymic and extrathymic
pathways.1-3 The first pathway stipulates that either
autologous or allogeneic lymphoid precursor cells seed to the
recipient's thymus and undergo differentiation and selection to
functionally mature T cells. The thymus-independent mechanism of T-cell
reconstitution involves the peripheral expansion of donor-derived
mature T cells cotransfused with the hematopoietic stem cells. However,
prevailing evidence suggests that the thymus-independent pathway
of T-cell regeneration is limited in its ability to restore
complete host immune competence.1 Indeed, efficient
reconstitution of the host T-cell compartment is dependent on the
presence of a functional thymus.4-6
The newly generated T lymphocytes recapitulate normal thymic ontogeny,
a process that, in turn, is severely affected by graft-versus-host disease (GVHD). GVHD constitutes a major transplant-related
complication initiated by host-reactive donor T cells.7,8
Histologic analyses and functional studies of clinical and experimental
BMT have revealed that thymic epithelial cells, bone marrow-derived
thymic stroma cells, and thymocytes are targets of acute
GVHD.2,9-12 Moreover, experimental GVHD-induced thymic
disease leads to the loss of normal thymic repertoire
selection.11,13-15 Thymic dysfunction as a consequence of
GVHD is thus likely to contribute to the profound immunodeficiency
period regularly observed after BMT.2,3
A typical property of thymic GVHD is the change in the composition of
the different thymocyte subpopulations.2 However, the
precise mechanism(s) responsible for the depletion of immature (in
particular CD4+CD8+ coreceptor double-positive
[DP]) thymocytes have not yet been fully established. Increased
programmed cell death of DP cells in nonirradiated
parentF1 recipients16 may be caused
by cell-mediated cytotoxicity effected by natural killer
cells or donor-derived allospecific T cells.17-19 Other
studies have suggested that antigen-nonspecific effector mechanisms
such as the production of corticosteroids are operational in DP
elimination.20-22 Moreover, because intrathymic lymphopoiesis is regulated by intensive cross-talk between thymocytes and different stromal cells,23,24 any injury to or
destruction of thymic epithelial cells would have a substantial impact
on thymic development.
At present it is unclear whether additional mechanisms contribute to
the depletion of the pool of DP thymocytes during GVHD. Here we
addressed the prospect that cell cycle progression of the most immature
CD3 CD4CD8
triple-negative (TN) pro-T and pre-T cells is affected by
disease. Under normal conditions, the differentiation process within
the TN thymocyte subset corresponds to a strong expansion
phase,23,25,26 which is an important prerequisite for
proper development to DP cells. In the current study, an unirradiated
murine PF1 haploidentical transplantation model
was used.27-34 This model provides several advantages.
First, it is especially suited to study graft-versus-host reaction
(GVHR)-mediated effects on the thymus because it is independent of the
injury to thymic epithelial cells by -radiation
conditioning.35 Second, acute or chronic forms of GVHD can
be generated in allogeneic recipients, depending on the haplotype of
the parental strain injected. Acute and chronic GVHD are elicited
through distinct mechanisms characterized by a differential cytokine
production. In acute GVHD (C57BL/6B6D2F1), the
preferential production of IL-2 and interferon (IFN)- by expanding
donor T cells leads to the generation of antihost cytotoxic T
lymphocytes (CTL)28-30 and to the induction of inflammatory
cytokines.31 In contrast, chronic GVHD after
DBA/2B6D2F1 transplantation is characterized by
the activation and expansion of predominantly IL-4-secreting donor T
cells, by the lack of an antihost CTL response, and by the stimulation of host B cells to secrete autoantibodies.30,32-34,36
Our data illustrate that acute GVHD but not chronic GVHD results in
severe changes of thymic architecture and leads to aberrant T-cell
development. Thymic atrophy during acute GVHD can be explained by at
least 2 parallel mechanisms. Here we demonstrate that, in addition to
enhanced apoptosis,16 the failure of pro-T cells and pre-T
cells to enter the cell cycle and to progress to the next developmental
stage similarly contributes to the depletion of DP thymocytes. These
profound changes are associated with an intrathymic inflammatory
response likely initiated by thymus-infiltrating donor T cells.
| |
Materials and methods |
Mice
Female DBA/2 (H-2d, Ly5.2+), C57BL/6 (B6;
H-2b, Ly5.2+), and [B6 × DBA/2]F1 (B6D2F1, H-2bd,
Ly5.2+) mice were obtained from Biological Research
Laboratories (Füllinsdorf, Switzerland). Female
B6.SJL-PtprcaPep3b/BoyJ (Ly5.1) congenic mice
(B6.Ly5.1, H-2b, Ly5.1+) were purchased from
the Jackson Laboratories (Bar Harbor, ME). Animals between 6 and 10 weeks of age were kept under pathogen-free conditions and in accordance
with the institute's guidelines and federal regulations.
Reagents
For 3- and 4-color flow cytometric (FACS) analyses, the following
monoclonal antibodies (mAbs) conjugated to biotin, fluorescein isothiocyanate, phycoerythrin, or CyChrome were used: anti-CD3 (clone
145-2C11), anti-CD8 (53-6.7), anti-CD4 (RM4-5),
anti-TCR (H57-592), anti-H-2Kd (SF1-1.1),
anti-H2Kb (AF6-88.5), anti-CD44 (clone IM7), anti-CD25
(PC61), anti-Ly5.1 (CD45.1; A20), and anti-CD16/CD32
(2.4G2) (Pharmingen, San Diego, CA),
streptavidin-tricolor (Caltag, Burlingame, CA), and streptavidin-Cy5 (Zymed Laboratories, San Francisco, CA).
5'-Bromo-2'-deoxyuridine (BrdU) was obtained from Sigma
(Buchs, Switzerland). Fluorescein isothiocyanate-conjugated anti-BrdU
mAb 3D4 was purchased from Becton Dickinson (Mountain View, CA).
Purified and biotinylated mAbs for the detection of cytokines and
immunoglobulins were purchased from Pharmingen. Primers for
semiquantitative PCR were designed using oligo 4.0 primer analysis
software (National Biosciences, Plymouth, MN) and were manufactured by
Life Technologies (Paisley, UK).
Induction and characterization of acute and chronic GVHD
Acute GVHD was induced in unirradiated B6D2F1 mice by
the transplantation of 50 × 106 unseparated parental
B6 splenocytes, whereas chronic GVHD was induced in B6D2F1
mice by the transplantation of 80 × 106 parental
DBA/2 splenocytes, as described.16,30 In preparatory experiments we confirmed previous data28-33 that acute GVHD
in the B6B6D2F1 model is characterized by the
spontaneous production of IFN- by donor T cells and by the
generation of antihost CTL. In contrast, the development of chronic
GVHD in the DBA/2B6D2F1 model is characterized by
enhanced serum autoantibody levels and by the absence of spontaneous
IFN- secretion and antihost CTL. The common events shared by these 2 diseases are the expansion of donor-derived CD4+ and
CD8+ T cells in secondary lymphoid organs and the
development of T-cell immunodeficiency, as assessed by the
proliferation of recipient splenocytes in response to various T-cell
mitogens in vitro (greater than 90% inhibition; data not shown).
Cytokine secretion, CTL activity, and serum immunoglobulins in
transplanted hosts were measured, as described
elsewhere.28,30
In vivo BrdU labeling
Transplanted and untransplanted mice were injected intraperitoneally
with BrdU (1 mg in 0.2 mL phosphate-buffered saline [PBS]) twice at
2-hour intervals, as described.37,38 For the detection and
characterization of proliferating cells in situ, mice were killed 1 hour after the second BrdU pulse, and cells were stained and analyzed
by flow cytometry.
Flow cytometric analysis
Cells (0.05-1 × 106) were washed, resuspended in
1% fetal calf serum-PBS-sodium azide, and incubated for 15 minutes
at 4°C with unlabeled 2.4G2 mAb to prevent unspecific binding to
Fc receptors. For 3-color flow cytometry, cells were first stained with fluorochrome- and biotin-conjugated mAbs and were subsequently labeled with streptavidin-tricolor or -Cy5. Washed cells were immediately analyzed by flow cytometry (FACScan; Becton Dickinson). For
the detection of DNA-synthesizing cells, 4-color flow cytometry was
used. Thymocytes were isolated from BrdU-treated mice and surface
stained with the appropriate biotin- or fluorochrome-conjugated mAbs.
Subsequently, cells were treated with ice-cold 0.15 mol/L NaCl/95%
EtOH for 30 minutes at 4°C and fixed for another 30 minutes with
PBS containing 1% paraformaldehyde and 0.01% Tween-20. Cells were
then incubated for 10 minutes at room temperature in a buffer containing 50 U/mL DNAase I in 0.15 mol/L NaCl/4.2 mmol/L
MgCl2, as described.38 After washing, 3D4 mAb
was added, and cells were incubated for an additional 30 minutes at
room temperature, washed, and finally resuspended in 1% bovine serum
albumin-PBS-sodium azide. All 4 color analyses were conducted on a
FACScalibur dual laser (Becton Dickinson).
Detection of donor-host chimerism
To discern donor-derived T cells from host T cells in thymus and
secondary peripheral lymphatic organs, 2 complementary approaches were
used. First, cells from transplanted mice were tested for the
simultaneous expression of TCR, H-2Kb, and
H-2Kd. In acute GVHD, donor T cells were distinguished from
resident mature thymocytes by their lack of H-2Kd. In
chronic GVHD, TCRhigh and H-2Kd+, but not
H-2Kb+, cells were considered to be of donor origin.
Second, splenocytes (50 × 106) from the B6.Ly5.1
(CD45.1) congenic mouse strain were transplanted into
B6D2F1 recipients. Donor T cells were distinguished
from resident thymocytes by their Ly5.1 expression.
Heterotopic thymus transplantation
A single thymic lobe from neonatal B6 mice was transplanted
aseptically under the left kidney capsule of 6- to 8-week-old B6D2F1 mice. Two days later, GVHD was induced in
thymus-transplanted mice by the infusion of
50 × 106 splenocytes from B6 donor mice. The
orthotopic thymus was allogeneic, whereas the heterotopic thymus was
syngeneic to the donor inoculum. Mice were analyzed on day 14 after
GVHD induction.
Semiquantitative polymerase chain reaction
Whole thymic tissue or thymocyte subpopulations (where indicated)
were isolated 2 weeks after transplantation for polymerase chain
reaction (PCR) analysis of cytokine gene expression. To obtain distinct
thymocyte subpopulations, single-cell suspensions with specific
phenotypes were sorted using a FACSvantage (Becton Dickinson). Purity
of Ly5.1+CD4+CD8 and
Ly5.1CD4+CD8 cells
was greater than 85%, and purity of
Ly5.1+CD4CD8+ and
Ly5.1CD4CD8+ thymic
cells exceeded 95%. Total RNA from frozen thymic tissue and sorted
cells, respectively, was isolated and reverse transcribed, and the
resultant cDNA was amplified for 30 cycles. The following primers were
used: IFN- sense, TACTGCCACGGCACAGTCAT; IFN- antisense, GCATCCTTTTTCGCCTTGCT; IL-4 sense, CACCTTGGAAGCCCTACAGA; IL-4 antisense, ATCATCGGCATTTTGAACGA; tumor necrosis factor (TNF)- sense,
AGGTCTACTTTGGAGTCA TTGC; TNF- antisense, ACATTCGAGGCTCCAGTGAATTCGG;
GAPDH sense, CATCAAGAAGGTGGTGAAGC; GAPDH antisense,
CCTGTTGCTGTAGCCGTATT. For semiquantitative analysis of cytokine mRNA
expression and for comparisons, GAPDH expression was standardized and a
ratio of the band intensities of cytokine to GAPDH amplicons was
calculated using Quantity-1 software (Bio-Rad, Hercules, CA).
Histopathology
For histologic analysis, thymuses were isolated and embedded in OCT
(Tissue-Tek, Sakura Finetec, The Netherlands). Frozen samples were cut
into 5-µm thick sections and stained with hematoxylin and eosin.
Statistical analysis
Values were mean ± SEM. For 2-group comparisons, the
nonparametric 2-tailed Mann-Whitney U test was used, whereas
for multiple group comparisons, analysis of variance (ANOVA) was used.
| |
Results |
Loss of thymic architecture is a result of acute GVHD but not
chronic GVHD
To investigate whether acute or chronic GVHD affects the thymic
architecture, an unirradiated PF1 hybrid model
was chosen. After B6B6D2F1 transplantation, acute
GVHD developed, and the thymuses of recipient mice displayed severe
morphologic changes (Figure 1). Two weeks
after transplantation, the size of the thymus was decreased, and the
loss of a regular thymic architecture was apparent with a clear lack of
a demarcation between cortex and medulla. In the course of the disease,
thymic cellularity progressively decreased and did not recover until
the animal's death approximately 4 weeks after transplantation (Figure
1D). In contrast, the thymic architecture was not overtly altered
during chronic GVHD (DBA/2B6D2F1). Correspondingly, thymic cellularity was not diminished from this disease when it was analyzed between 1 and 4 weeks after
transplantation.
View larger version (458K):
[in this window]
[in a new window]
| Fig 1.
Thymic disease is a consequence of acute but not chronic
GVHD.
Acute GVHD was induced by the transfer of 50 × 106
parental B6 splenocytes to unirradiated B6D2F1 mice (B),
whereas chronic GVHD was induced by the transfer of 80 × 106 parental DBA/2 splenocytes to unirradiated
B6D2F1 mice (C). Syngeneically transplanted
B6D2F1 mice served as controls (A). Frozen thymic sections
(5 µm) were analyzed for histopathology at 2 weeks after
transplantation. Magnification ×200. (D) Thymic cellularity as a
function of time (total cells per thymus × 106) in syngeneically transplanted mice
( ) and in mice with acute ( ) and chronic ( )
GVHD, respectively. The figure represents combined data (mean ± SEM) of individual mice from at least 8 separate experiments; 20 to 42 mice were analyzed for each group.
|
|
Aberrant thymic development in acute GVHD
The alterations in thymic architecture suggested that
thymocyte development was not regular in the presence of acute GVHD. To
assess intrathymic T-cell development, cells were examined by flow
cytometry according to their developmental stages.26,39 At
2 weeks after the induction of acute GVHD, the relative distribution of
thymocyte subpopulations was abnormal (Figure
2). The proportion of DP cells was greatly
diminished, whereas the relative size of the TCRhigh
population was concomitantly increased by 4- to 5-fold. Absolute cell
numbers within the DP population declined from a normal value of
33.7 ± 3.9 × 106 cells in syngeneically
transplanted mice to 1.8 ± 0.6 × 106 cells in
GVHD+ mice (Figure 2E). Therefore, the strong reduction in
thymic cellularity was caused primarily by a decrease in DP thymocytes
to 14% of the value found in mice without GVHD. Onset of these changes
occurred approximately 8 to 9 days after transplantation. At this
point, the frequency of DP cells in GVHD+ mice was
67.4% ± 2.8%, corresponding to a total number of
27.0 ± 4.8 × 106 thymocytes. Concomitantly,
we detected 6.8 ± 1.3 million CD4 single-positive
(SP) and 2.5 ± 0.4 × 106 CD8 SP mature
thymocytes, corresponding to an approximately 3-fold increase over
values in syngeneically transplanted mice (data not shown).
View larger version (19K):
[in this window]
[in a new window]
| Fig 2.
Acute GVHD results in aberrant intrathymic T-cell
development.
Acute (C) or chronic (D) GVHD was induced in unirradiated
B6D2F1 mice, as described in Figure 1. Untransplanted (A)
or syngeneically transplanted (B) B6D2F1 mice served as
controls. Two weeks after transplantation, the surface expression of
CD4 and CD8 (upper panels) and of TCR (lower panels) on thymocytes
were analyzed by flow cytometry. Cell analysis was restricted to live
thymocytes, as defined by forward scatter and side scatter. Numbers
depicted in each quadrant of the dot plot represent mean frequencies
(%) of the respective populations. (E) Quantification of the 4 major
thymocyte subsets (cells × 106) was performed
in thymuses isolated from untransplanted ( ) or
syngeneically transplanted ()
B6D2F1 mice and from mice with acute ( ) and chronic
( ) GVHD, respectively. The figure represents combined data (mean ± SEM) of individual mice from at least 8 separate experiments; 12 to 41 mice were analyzed for each group.
|
|
Essentially normal thymic development during chronic GVHD
Thymocyte development was strikingly different in mice with
chronic GVHD from that in mice with acute GVHD (Figure 2). The relative
frequencies of the different immature and mature thymocyte subsets were
similar to those seen in untransplanted or syngeneically transplanted
mice. There was, however, a modest increase in the absolute cell number
of CD4 SP thymocytes (to 4.4 ± 0.6 × 106
cells) at 2 weeks after transplantation. Time-course experiments did
not reveal any changes in the relative frequencies of thymocyte subpopulations, either at earlier time points or as late as 4 weeks
after transplantation (data not shown). These minimal numeric changes
were in stark contrast to the profound functional T-cell deficiency
observed in this model because concanavalin A or anti-CD3-induced proliferative responses of isolated recipient splenocytes (measured at
1 or 2 weeks) were severely diminished despite the presence of
phenotypically mature T cells in the periphery (data not shown).
Impaired cell cycle progression of resident
TCRCD4CD8 thymocytes in
the presence of acute and chronic GVHD
A range of mechanisms may contribute to the observed loss of DP
thymocytes in acute GVHD. It is conceivable that GVHD perturbs the
development of TN thymocytes to their next stage of maturation, the DP
cells. Because the developmental transition from the TN to the DP stage
is accompanied by a 20- to 50-fold cellular expansion,25,39 resident TN cells were analyzed for cell cycle progression (as tested
by BrdU incorporation into DNA; Figure 3A).
Two weeks after transplantation, TN cells represented approximately 2%
of all thymocytes in both experimental GVHD models, and their
frequencies were therefore not different from those of control mice
(Figure 3B).39 Because of the decrease in thymic
cellularity, however, absolute TN cell numbers were significantly lower
in acute GVHD. Significantly, the frequencies of viable
BrdU+ TN cells were greatly diminished in acute GVHD when
compared to those in syngeneically transplanted mice (Figure 3C). No
overt impairment in the frequency (11.2% ± 0.7% vs.
12.6% + 2.2%) or absolute number of cycling cells was observed
among the TN thymocytes 1 week after GVHD induction. In the presence of
chronic GVHD, both the frequency and the number of cycling TN cells
were also decreased in comparison to those in syngeneically
transplanted F1 mice. Nevertheless, this reduction was
modest in comparison to that for acute GVHD (Figure 3C). TN cells are
further subdivided into 4 distinct subsets based on their surface
expression of CD44 and CD25. Maturation within the TN compartment
occurs in the sequence CD25CD44+ (stage
I) CD25+CD44+ (stage II) CD25+CD44 (stage III) CD25CD44 (stage
IV).26 Cell proliferation occurs mainly in stages II and IV
of TN cells.25,39 To investigate at which developmental point GVHD affects cell cycle progression, the relative abundance and
BrdU incorporation of the 4 stages were assessed. During acute GVHD,
the frequency of stage I pro-T cells was increased in lieu of cells at
the usually most populous stage III (Figure
4A-C). Cell cycle analysis in acute GVHD
revealed that viable TN cells of stages II, III, and IV were severely
inhibited in their proliferative capacity (Figure 4E,F). In addition,
pro-T cells of stage I also displayed a tendency toward decreased
proliferation, though this was not significantly different (P =
0.17) than that in syngeneically transplanted mice. A relative increase
of CD44CD25low thymocytes was noted in
thymuses affected by acute GVHD, as measured by the 4-fold lower median
CD25 fluorescence intensity of stage III cells (data not shown). This
observation suggested a maturation delay in TN cells at the point at
which they usually transit swiftly to stage IV.
View larger version (21K):
[in this window]
[in a new window]
| Fig 3.
Cell cycle progression of host-derived TN thymocytes is
impaired in GVHD.
Acute or chronic GVHD was induced in unirradiated B6D2F1
mice. Untransplanted or syngeneically transplanted B6D2F1
mice served as controls. Thymocytes were analyzed at 2 weeks after
transplantation for surface expression of CD4, CD8, and TCR and for
the incorporation of BrdU into cellular DNA.(A) Representative flow
cytometric analysis of thymocytes from a mouse with acute GVHD. (B, C)
Frequencies of TN thymocytes (%; mean ± SEM) was assessed by flow
cytometry of thymuses from untransplanted () or
syngeneically transplanted () B6D2F1 mice and from mice
with acute () and chronic () GVHD, respectively. Lower panels
show absolute numbers of cycling cells (mean ± SEM;
×103) among TN thymocytes and represent pooled
data from 2 independent experiments; 3 to 5 mice were analyzed for each
group. *P < .01 versus mice with chronic GVHD and
syngeneic controls, respectively.  P < .01 versus syngeneic controls (ANOVA).
|
|
View larger version (32K):
[in this window]
[in a new window]
| Fig 4.
Cell cycle progression of pro-T cells and pre-T cells is
impaired during GVHD.
Acute (C) or chronic (D) GVHD was induced in unirradiated
B6D2F1 mice. Untransplanted (A) or syngeneically
transplanted (B) B6D2F1 mice served as controls. TN
thymocytes were analyzed at 2 weeks after transplantation for the
surface expression of CD44 and CD25 and for the incorporation of BrdU
into cellular DNA. Numbers depicted in each quadrant of the dot plot
represent mean frequencies (%) of the respective populations. (E, F)
Frequencies (%; mean ± SEM) and absolute cell numbers
(×103) of cycling cells among TN thymocytes
was assessed by flow cytometry of thymuses from untransplanted
() or syngeneically transplanted () B6D2F1
mice and from mice with acute () and chronic () GVHD,
respectively. The graph represents pooled data from 2 independent
experiments; 3 to 5 mice were analyzed for each group.
*P < .01 versus mice with chronic GVHD and
syngeneic controls, respectively. P < .02 versus syngeneic controls (ANOVA).
|
|
In chronic GVHD, the frequencies of proliferating cells among each of
the 4 TN populations were not statistically different from those of
controls without GVHD, even though these fractions were consistently
reduced in number (Figure 4F). The frequencies of TN stage II to IV
cells undergoing cell proliferation were thus significantly lower in
acute GVHD than in chronic GVHD. Taken together, these data suggest
that acute GVHD may affect TN thymocytes in their progression to the
stage of more mature DP cells secondary to a failure to enter cell
cycle at TN stages II to IV.
During acute GVHD, DP cells display altered proliferative
capacities
Double-positive thymocytes undergo TCR-mediated selection, and
survivors of this stringent process differentiate, dependent on their
major histocompatibility class specificity, into mature CD4 or CD8 SP
thymocytes, respectively. These cells are then competent to emigrate to
the periphery.39 To test whether the few DP thymocytes present in an atrophied thymus are able to progress normally to their
subsequent SP stage, we analyzed thymocytes at distinct developmental
stages along the DPSP differentiation pathway.40 During acute GVHD, the frequency of proliferating
CD4lowCD8low TCRint thymocytes was
strongly diminished (Figure 5A). Two weeks
after transplantation, fewer than 2 × 103 cells
incorporated BrdU as opposed to 49 × 103 cells in
syngeneically transplanted mice. In the
CD4+CD8+TCRlow/int and
CD4highCD8lowTCRint/hi populations,
the frequencies of BrdU+ cells were not statistically
different from those of mice without GVHD, though absolute cell numbers
were decreased. In chronic GVHD, incorporation of BrdU was similar to
that in non-GVHD controls except for the
CD4lowCD8low TCRint cells that
proliferated by approximately 50% less. This was a modest
decrease in comparison to that in acute GVHD (Figure 5).
View larger version (24K):
[in this window]
[in a new window]
| Fig 5.
Impaired cell cycle progression of DP thymocytes during
GVHD.
Acute and chronic GVHD was induced in unirradiated B6D2F1
mice. Syngeneically transplanted or naive B6D2F1 mice
served as non-GVHD controls. Three developmental stages along the
DPSP differentiation pathway were analyzed at 2 weeks after
transplantation for the incorporation of BrdU into cellular DNA. (A)
Frequencies (%; mean ± SEM) and (B) absolute cell numbers
(×103) of cycling cells among DP thymocytes
were assessed by flow cytometry of thymocytes from untransplanted
() or syngeneically transplanted
() B6D2F1 mice and from mice with
acute () and chronic () GVHD, respectively. The graph represents
pooled data from 3 independent experiments; 4 to 7 mice were analyzed
for each group. *P < .2 versus mice
with chronic GVHD and syngeneic controls, respectively.
P < .02 versus syngeneic controls (ANOVA).
|
|
Donor T cells migrate to the thymus during acute GVHR
Our results and previous data2,3,16,18,19
demonstrate that the thymus is a target of acute GVHD in the
PF1 model. To test whether the observed thymic
changes were a consequence of alloantigen-specific recognition, mice
were transplanted with thymic lobes and then with allogeneic
splenocytes. To this end, neonatal B6 thymuses were grafted under the
kidney capsule of naive B6D2F1 mice, which in turn were
infused 2 days later with B6 splenocytes to induce GVHD. Thus, the
orthotopic thymus was allogeneic whereas the heterotopic thymus was
syngeneic to the infused T cells. Orthotopic and heterotopic thymic
tissues were analyzed in the double-transplanted mice at the height of
the GVHR at 2 weeks after T-cell transfer. Flow cytometric analysis revealed that DP cells were eliminated from the orthotopic thymus, whereas the cellular composition of the transplanted thymus appeared indistinguishable from that of mice without GVHD (Figure
6). These data infer that the depletion of
DP cells during acute GVHD is a direct consequence of allorecognition
of host DP thymocytes.
View larger version (54K):
[in this window]
[in a new window]
| Fig 6.
A heterotopically transplanted thymus syngeneic to donor
splenocytes is not a target of acute GVHD.
A single thymic lobe from neonatal B6 mice was transplanted aseptically
under the left kidney capsule of B6D2F1 mice. Forty-eight
hours later, GVHD was induced in organ-transplanted mice by the
infusion of 50 × 106 B6 splenocytes. In
this setting, the orthotopic thymus is allogeneic, whereas the
heterotopic thymus is syngeneic to the donor inoculum. Thymocytes were
analyzed for surface expression of CD4 and CD8 by flow cytometry on day
14 after GVHD induction (day 16 after thymus transplantation). Numbers
within the flow cytometry plots represent mean frequencies (%) of the
respective populations among all live thymocytes. The graph is
representative of 1 experiment; 2 to 3 mice were analyzed for each
group.
|
|
We therefore tested whether and to what extent donor-derived mature T
cells infiltrated the thymus during GVHD. In the acute GVHD model,
donor-derived T cells were distinguished from mature host thymocytes
because of the lack of H-2Kd expression by the former
(Figure 7A). Donor-derived T cells could first be detected at 1 week after transplantation (Figure 7D). At this
time, splenic donor-host chimerism was already substantial (more than
30% of splenic CD4+ and CD8+ T cells were of
donor origin; data not shown). The frequency of intrathymic donor T
cells increased to 11% cells among TCRhigh
cells 2 weeks after transplantation (corresponding to an
absolute number of 0.62 ± 0.09 × 106 donor T
cells). The relative increase was primarily caused by the progressive
decrease in host-type thymocytes. Comparable results were obtained with
the transfer of splenocytes from B6.Ly5.1 congenic donors to
B6D2F1 recipients. On average, 22% of CD4 and 43% of CD8
SP mature thymic T cells were Ly5.1+ at 2 weeks after
transplantation, corresponding to approximately 106
donor-derived intrathymic T cells (data not shown). Taking the loss of
DP thymocytes (1/DP) as a measure of thymic injury, the number of
infiltrating donor T cells was directly correlated with the phenotypic
changes in thymocyte subsets (Figure 7E).
View larger version (32K):
[in this window]
[in a new window]
| Fig 7.
During acute GVHD, donor-derived T cells infiltrate the
thymus.
Acute (A) or chronic (B) GVHD was induced in unirradiated
B6D2F1 mice. Syngeneically transplanted B6D2F1
mice served as controls (C), and donor-host chimerism was measured at
2 weeks after transplantation. In the B6B6D2F1
model, mature donor T cells were
TCR highH-2Kb+Kd, whereas
in the DBA/2B6D2F1 model,
TCRhighH-2Kb-H-2Kd+ T cells were
of donor origin. The background in syngeneically transplanted mice was
0.5% or less. (D) Quantification of donor-derived mature T cells in
thymuses of transplanted hosts with acute () or
chronic () GVHD. Donor cell infiltration is given either as a
percentage of all TCRhigh thymocytes or as an absolute
cell number (×106) of donor-derived T cells
among TCRhigh cells in the thymus at 1 and 2 weeks after
transplantation (mean ± SEM). (E) Loss of DP thymocytes (1/DP) is
plotted against the percentage of TCRhigh infiltrating
donor T cells at 1 and 2 weeks after transplantation for both GVHD
models. The graph represents pooled data from 2 (chronic GVHD) to 9 (acute GVHD) independent experiments; 5 to 25 mice were analyzed for
each group. *P < .01 versus mice with chronic GVHD.
#P < .01 versus chronic GVHD at 2 weeks (2-tailed
Mann-Whitney U test).
|
|
In chronic GVHD, donor-derived T cells were distinguished from mature
host thymocytes by their lack of H-2Kb expression (Figure
7B). Despite the limited infiltration at 1 week after transplantation,
there was only a small number of donor T cells after an additional week
(less than 1% of total thymocytes, or
0.20 ± 0.05 × 106 cells; Figure 7D). Thus,
donor T cells demonstrate in chronic GVHD a limited migration to or
expansion in the thymus.
During acute GVHD, thymus-infiltrating T cells expand and express
inflammatory cytokines in situ
To investigate the function of donor T cells in the thymus of mice
with acute GVHD, cell proliferation was assessed in vivo, simultaneously using a donor-specific marker (Ly5.1) with the detection
of intracellular BrdU incorporation. Two weeks after the transfer of
B6.Ly5.1 splenocytes, 13% of Ly5.1+ T cells were
proliferating, and there was a preferential expansion among
CD8+ T cells (Figure 8A). To
further detail their function, thymus-infiltrating T cells were
analyzed for cytokine expression because the development of acute GVHD
is linked to the secretion by T cells of the Th1 signature cytokine
IFN-.30,41,42 Transcription of this cytokine was
detected using semiquantitative PCR analysis. A strong up-regulation of
IFN--specific message was found in the unseparated thymic tissue of
mice with acute GVHD in comparison with untransplanted B6D2F1 mice (Figure 8B). The origin of IFN- was
subsequently determined separately for donor and host SP T cells,
respectively. Among Ly5.1+ T cells, IFN- was
preferentially expressed in CD8+ T cells (Figure 8C). In
contrast, IFN- transcripts were detected neither in mature CD4 SP
nor in CD8 SP thymocytes of host origin (Ly5.1).
Additional evidence for intrathymic inflammation was provided by the
observation that increased transcripts for TNF- were found in
unseparated thymic tissue of mice with acute GVHD when compared to
unmanipulated or syngeneically transplanted animals (Figure 8B).
Analyzing TNF- expression in SP thymic cells, specific transcripts were either unchanged or diminished among donor and recipient cells
when they were compared to naive B6D2F1 thymocytes (Figure 8C). In view of an overall increase of TNF- mRNA in unseparated thymic tissue, the results obtained with sorted thymic T cells suggested that TNF- was produced by cells other than
thymocytes.
View larger version (38K):
[in this window]
[in a new window]
| Fig 8.
Thymus-infiltrating donor T cells proliferate in situ and
express inflammatory cytokines during acute GVHD.
Acute or chronic GVHD was induced in unirradiated B6D2F1
mice. Cell cycling and cytokine mRNA expression of thymic cells were
analyzed 2 weeks after transplantation. (A) Representative flow
cytometric plots of thymocytes from a mouse with acute GVHD. Numbers
depicted in each quadrant of the dot plots represent mean frequencies
(%) of the respective populations. (B) For analysis of cytokine
production, semiquantitative PCR of cDNA from frozen whole thymic
tissue was used. PCR products were separated by gel electrophoresis,
and the bands depict amplicons from 1 naive B6D2F1 mouse
and from 2 representative mice with acute or chronic disease on day 15 after transplantation. Bands were further analyzed by densitometry, and
the intensities of each amplicon cytokine mRNA from mice with acute
() or chronic () GVHD were
expressed as ratios compared with syngeneically transplanted controls
(). Expression levels for the different genes in the
B6D2F1 control were arbitrarily set at 1, and differences
in initial cDNA input levels were corrected based on band intensities
measured for GAPDH products. (C) Freshly isolated thymocytes from naive
B6D2F1 mice (F1) and from transplanted mice
with acute GVHD (day 15) were separated on a FACSvantage into donor-
and host-derived CD4 SP () and CD8 SP () cell subsets based on
their expression of Ly5.1. PCR amplification products (IFN- and
TNF-) were analyzed by densitometry, and optical densities of bands
were compared. The graph represents pooled data from 5 independent
experiments; 3 to 8 mice were analyzed for each group. *P < .001 versus mice with chronic GVHD and syngeneic controls,
respectively. P < .03 versus syngeneic controls
(ANOVA).
|
|
In chronic GVHD, thymic transcripts for TNF- and IFN- were
smaller than in the acute form of the disease. The abundance of
IFN--specific mRNA was still higher than the concentrations noted
in syngeneically transplanted control mice. Taken together, these
results demonstrated the dominance of a Th1-like response in thymic
tissue of mice with acute GVHD, whereas thymic inflammation in chronic
GVHD was minimal and was reflective of a "Th0" cytokine response.
| |
Discussion |
Effective reconstitution of the donor-derived peripheral T-cell
compartment after BMT is contingent on 2 independent pathways the intrathymic differentiation of donor stem cells and the peripheral expansion of donor T cells.1-6,43 Thymic function is also
important for T-cell reconstitution in adolescent and adult recipients
of BMT because, even though thymic lymphoid development declines with
time, substantial cellular output is maintained to old
age.3,44,45 Relevant to any age, thymic injury is
enhanced in the presence of GVHD (reviewed in Hakim and
Mackall2). The current study was designed to increase our
understanding of the mechanisms by which experimental GVHD
causes thymic atrophy. Here we demonstrate that after
B6B6D2F1 transplantation, thymic atrophy is
distinguished by a prominent decrease in relative and absolute numbers
of DP thymocytes (Figure 2). This change is associated with the
intrathymic accumulation of donor-derived T cells that express IFN-
(Figures 7 and 8). Cell cycle progression among viable resident TN
thymocytes is highly reduced in the presence of acute GVHD when
compared to syngeneically transplanted animals (Figures 3 and 4). In
contrast, the development of chronic GVHD after
DBA/2B6D2F1 transplantation is characterized by
almost normal thymic cellularity, phenotype, and cell cycle
progression. The scarcity of any changes correlates with a low level of
intrathymic inflammation and IFN- mRNA expression.
These data led us to conclude that extensive morphologic and functional
alterations of the thymus are dependent on a Th1-driven immune response
after transplantation. Significantly, the marked loss of DP cells was
effected by impaired cellular proliferation of host pro-T
and pre-T cells. This finding is relevant because only TN thymocytes
that have cycled and have successfully rearranged and expressed 1 TCR gene locus are allowed to progress to the DP
stage.5,26,39 Thus, acute GVHD prevents the normal TN maturation from stage II to the late stage IV. This lack of a strong
clonal expansion results in the failure to generate sufficient amounts
of DP thymocytes, leading to thymic atrophy.
The mechanisms responsible for the failure of TN thymocytes to enter
cell cycle have not been defined. It is possible that a lack of growth
and survival factors by thymic epithelial cells or other cells of the
microenvironment causes impairment in TN expansion. In normal thymic
development, the cytokine IL-7 provides a crucial survival and
proliferation signal to TN thymocytes.46 A lack of stromal
cell-derived IL-7 secretion might, therefore, explain the TN defect
during acute GVHD. We have measured thymic IL-7 production by
semiquantitative PCR in the B6B6D2F1 model. However, we have not found any evidence for a decrease in stromal IL-7
transcripts in the presence of acute GVHD (data not shown). In
contrast, the abundance of IL-7 message was even enhanced when the
relative increase of stromal cells was taken into consideration (data
not shown). It is conceivable then that the defect in proliferation lies within the population of viable TN thymocytes. This understanding is further supported by the fact that the attendant condition of an
acute GVHD-induced intrathymic inflammatory response generates several
other cytokines (eg, IL-2, TNF-) that are known to promote, either
alone or in combination, thymocyte proliferation at distinct developmental stages.47,48 Prolonged disruption of the
normal thymic microenvironments may nevertheless contribute to a
defective cellular expansion. Thymocytes normally develop in direct
physical contact with thymic stromal cells, which, in turn, form a
3-dimensional meshwork of primarily thymic cortical and medullary
epithelial cells. As defined by separate phenotypes and functions,
those stromal cells provide distinct microenvironments critical for the
development and selection of thymocytes.23,49 In the course of acute GVHD, the ensuing changes of the thymic microenvironments have
been demonstrated to promote aberrant thymic
education.11,13-15
It is unlikely that the failure of TN cells to proliferate is the only
mechanism responsible for the depletion of the DP pool. In this
respect, we have recently demonstrated that GVHD causes enhanced
programmed cell death among DP thymocytes.16 Hence, we
speculate that both mechanisms, increased apoptosis and diminished cell
cycle, are a direct consequence of alloantigen-specific T-cell recognition in the course of GVHD. This contention is favored by the
data shown in Figure 6. Indeed, donor T cells that have gained access
to the thymus in the course of acute GVHD18,19 represent
activated effector cells, as judged by their in situ proliferation and
cytokine secretion (Figures 7 and 8). It is unclear whether these
donor-derived cells become activated in the periphery and subsequently
migrate to the thymus or whether the initial alloantigen recognition
occurs in the thymus. In acute GVHD, the cytokine phenotype of
donor-derived cells clearly corresponds to a Th1-like pattern (ie, the
preferential production of IL-2 and IFN-). This response may affect
thymic function by 2 (interrelated) pathways, cell-mediated
cytotoxicity and induction of inflammatory cytokines such as TNF-.
Infiltrating donor CTLs can directly target host DP thymocytes because
these immature cells express intermediate levels of major
histocompatibility class I antigens (data not shown). In addition, a
role for TNF--mediated immunopathology may be inferred from results
using cultured DP thymocytes as lysis targets50 and from
the observation of elevated serum TNF- levels31 and
increased intrathymic TNF- transcripts during acute GVHD in the
F1-hybrid model (Figure 8). Our data argue, however,
against the involvement of systemic TNF- in DP depletion because the elimination of syngeneic thymocytes bearing this phenotype in the
heterotopic thymus during acute GVHD (Figure 6) is
expected. A causative role for TNF- in the programmed
cell death of DP thymocytes in acute GVHD remains to be established.
The distinct disease patterns of acute and chronic murine GVHD observed
in parentF1 transplantation models reflect the
differential immune responses mediated by Th1 and Th2 donor T cells,
respectively.29-33,42 Although T-cell activation and
expansion in secondary lymphoid organs are shared between acute and
chronic GVHD,30 the respective consequences of these events
differ significantly. In contrast to acute GVHD, there was no
morphologic evidence of thymic disease during chronic GVHD (Figure 1).
Moreover, lymphoid development was normal, as evidenced by the normal
frequency and numbers of all thymocyte subpopulations (Figure 2).
Consistent with the lack of overt thymic disease, donor T-cell
infiltration and the ensuing intrathymic inflammation were minimal in
the presence of chronic GVHD (Figures 7 and 8). Although donor-derived
T cells were present in thymuses early in this disease, their numbers
quickly decreased from approximately 0.5 × 106
cells to virtually undetectable levels by 2 weeks after
transplantation. This finding is in obvious contrast to the substantial
and sustained numbers of activated donor T cells in secondary lymphoid
organs (our unpublished data and Rus et al30). These
results further imply that thymus-infiltrating donor T cells in chronic
GVHD are less efficient in inducing a local inflammatory response.
Expression of thymic IL-4 but not IFN- mRNA was indeed prominent in
this disease model (Figure 8). The limited numbers of donor T cells present in the thymus early after chronic GVHD induction may
nevertheless be capable of causing a milder form of thymic GVHD because
cell cycle progression among TN cells was moderately diminished
relative to syngeneically transplanted mice (Figure 4).
Because donor-derived T cells constitute only a minority of SP cells
(Figure 7) and because host DP cells display a defect in their capacity
to enter the cell cycle (Figure 5), additional mechanisms are expected
in acute GVHD to contribute to the observed increase in mature SP
cells. Under physiological conditions, only activated T cells
recirculate to the thymus.51 During GVHD, T cells of host
origin may gain access to the inflamed thymus regardless of their
antigenic specificities. These cells may thus contribute to the
relative increase in mature host T cells. To test this issue, HSA
(CD24) and Qa-2 cell surface expression was analyzed on
CD3high, H-2Kd(high) host thymocytes. SP
thymocytes are usually HSA+, whereas peripheral T cells
lose expression of this marker and acquire Qa-2
expression.52 Our data suggest that during acute GVHD,
peripheral host-derived mature T cells indeed recirculate to an
extended degree to the thymus (not shown).
We have demonstrated that the thymus is a target of acute GVHD and, to
a limited extent, of chronic GVHD. In-depth analysis of the mechanisms
interfering with normal thymic T-cell development may provide the basis
for novel strategies in the prevention or reduction of GVHD-associated
immunodeficiency. Of relevance to peripheral lymphoid homeostasis will
be an assessment of the impact of GVHD on thymocyte output. In this
respect, a recent study used a lethal irradiation BMT model to
demonstrate that thymic cellular output in acute GVHD was reduced to
approximately 25% of normal.53 It remains to be
established whether such a limited thymocyte output is still sufficient
to sustain a phenotypically normal peripheral T-cell compartment.
| |
Acknowledgments |
We thank Tracy N. Hayden, Verena Jäggin Verin, and Verena Wyss
for expert technical assistance.
| |
Footnotes |
Submitted December 8, 1999; accepted February 19, 2000.
Supported by grants 3100-046-936.96 (W.K., G.A.H.) and 3100-43600.95 (G.A.H.) from the Swiss National Science Foundation.
Reprints: Werner Krenger, Laboratory of Pediatric Immunology,
Department of Research, Basel University Medical School, Hebelstrasse
20, 4031 Basel, Switzerland; e-mail: werner.krenger{at}unibas.ch.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Mackall CL, Gress RE.
Pathways of T-cell regeneration in mice and humans: implications for bone marrow transplantation and immunotherapy.
Immunol Rev.
1997;157:61[Medline]
[Order article via Infotrieve].
2.
Hakim FT, Mackall CL.
The immune system: effector and target of graft-versus-host disease. In:
Ferrara JLM,Deeg HJ,Burakoff SJ, eds.
). Graft-vs-Host Disease. New York: Marcel Dekker; 1997:257.
3.
Parkman R, Weinberg KI.
Immunological reconstitution following bone marrow transplantation.
Immunol Rev.
1997;157:73[Medline]
[Order article via Infotrieve].
4.
Dumont-Girard F, Roux E, van Lier RA, et al.
Reconstitution of the T-cell compartment after bone marrow transplantation: restoration of the repertoire by thymic emigrants.
Blood.
1998;92:4464[Abstract/Free Full Text].
5.
Heitger A, Neu N, Kern H, et al.
Essential role of the thymus to reconstitute naive (CD45RA+) T-helper cells after human allogeneic bone marrow transplantation.
Blood.
1997;90:850[Abstract/Free Full Text].
6.
Weinberg K, Annett G, Kashyap A, Lenarsky C, Forman SJ, Parkman R.
The effect of thymic function on immunocompetence following bone marrow transplantation.
Biol Blood Marrow Transpl.
1995;1:18[Medline]
[Order article via Infotrieve].
7.
Blazar BR, Korngold R, Vallera D.
Recent advances in graft-versus-host disease (GVHD) prevention.
Immunol Rev.
1997;157:79[Medline]
[Order article via Infotrieve].
8.
Krenger W, Hill GR, Ferrara JLM.
Cytokine cascades in acute graft-versus-host disease.
Transplantation.
1997;64:553[Medline]
[Order article via Infotrieve].
9.
Seddik M, Seemayer TA, Lapp WS.
T cell functional defect associated with thymic epithelial cell injury induced by a graft-versus-host reaction.
Transplantation.
1980;29:61[Medline]
[Order article via Infotrieve].
10.
Lapp WS, Ghayur T, Mendez M, Seddik M, Seemayer TA.
The functional and histological basis for graft-versus-host-induced immunosuppression.
Immunol Rev.
1985;88:107[Medline]
[Order article via Infotrieve].
11.
Fukushi N, Arase H, Wang B, et al.
Thymus: a direct target tissue in graft-versus-host reaction after allogeneic bone marrow transplantation that results in abrogation of induction of self-tolerance.
Proc Natl Acad Sci U S A.
1990;87:6301[Abstract/Free Full Text].
12.
Ghayur T, Seemayer T, Lapp WS, et al.
Histologic correlates of immune functional deficits in graft-vs-host disease. In:
Burakoff SJ,Deeg HJ,Ferrara J,Atkinson K, eds.
Graft-vs.-Host Disease: Immunology, Pathophysiology, and Treatment. New York: Marcel Dekker; 1990:109.
13.
Holländer GA, Widmer B, Burakoff SJ.
Loss of normal thymic repertoire selection and persistence of autoreactive T cells in graft vs. host disease.
J Immunol.
1994;152:1609[Abstract].
14.
Desbarats J, Lapp WS.
Thymic selection and thymic major histocompatibility complex class II expression are abnormal in mice undergoing graft-versus-host reactions.
J Exp Med.
1993;178:805[Abstract/Free Full Text].
15.
Fukuzawa M, Via CS, Shearer GM.
Defective thymic education of L3T4+ T helper cell function in graft-vs-host mice.
J Immunol.
1988;141:430[Abstract].
16. Krenger W, Rossi S, Holländer GA. Apoptosis of thymocytes during
acute graft-versus-host disease is independent of glucocorticoids.
Transplantation. In press.
17.
Ghayur T, Seemayer TA, Lapp WS.
Association between the degree of thymic dysplasia and the kinetics of thymic NK cell activity during the graft-versus-host reaction.
Clin Immunol Immunopathol.
1988;48:19[Medline]
[Order article via Infotrieve].
18.
Cray C, Levy RB.
Evidence that donor cells are present in the thymus of recipients undergoing a PF1 graft-versus-host reaction exacerbated by concurrent murine cytomegalovirus infection.
Transplantation.
1992;53:696[Medline]
[Order article via Infotrieve].
19.
Onoe Y, Harada M, Tamada K, et al.
Involvement of both donor cytotoxic T lymphocytes and host NK1.1+ T cells in the thymic atrophy of mice suffering from acute graft-versus-host disease.
Immunology.
1998;95:248[Medline]
[Order article via Infotrieve].
20.
Seemayer TA, Lapp WS, Bolande RP.
Thymic epithelial injury in graft-versus-host reactions following adrenalectomy.
Am J Pathol.
1978;93:325[Abstract].
21.
You-Ten KE, Itie A, Seemayer TA, Palfree RG, Lapp WS.
Increased expression of proopiomelanocortin (POMC) mRNA in adrenal glands of mice undergoing graft-versus-host disease (GVHD): association with persistent elevated plasma corticosterone levels.
Clin Exp Immunol.
1995;102:596[Medline]
[Order article via Infotrieve].
22.
Kornbluth M, You-Ten E, Desbarats J, Gamache S, Xenocostas A, Lapp WS.
T cell subsets in the thymus of graft-versus-host immunosuppressed mice: sensitivity of the L3T4+Lyt-2 subset to cortisone.
Transplantation.
1991;51:262[Medline]
[Order article via Infotrieve].
23.
Holländer GA.
Thymic T-cell development. In:
Burakoff SJ,Deeg HJ,Ferrara JLM,Atkinson K, eds.
Graft-Versus-Host Disease. 2nd ed. New York: Marcel Dekker; 1997:1.
24.
Van Ewijk W, Wang B, Holländer GA, et al.
Thymic microenvironments, 3-D versus 2-D?
Semin Immunol.
1999;11:57[Medline]
[Order article via Infotrieve].
25.
Penit C, Lucas B, Vasseur F.
Cell expansion and growth arrest phases during the transition from precursor (CD4CD8) to immature (CD4+CD8+) thymocytes in normal and genetically modified mice.
J Immunol.
1995;154:5103[Abstract].
26.
Godfrey DI, Kennedy J, Suda T, Zlotnik A.
A developmental pathway involving four phenotypically and functionally distinct subsets of CD3CD4CD8 triple-negative adult mouse thymocytes defined by CD44 and CD25 expression.
J Immunol.
1993;150:4244[Abstract].
27.
Gleichmann E, Pals ST, Rolink AG, Radaskiewicz T, Gleichmann H.
Graft-versus-host reactions: clues to the etiopathology of a spectrum of immunological diseases.
Immunol Today.
1984;5:324.
28.
Via CS, Sharrow SO, Shearer GM.
Role of cytotoxic T lymphocytes in the prevention of lupus-like disease occurring in a murine model of graft-versus-host disease.
J Immunol.
1987;139:1840[Abstract].
29.
Via CS, Finkelman FD.
Critical role of interleukin-2 in the development of acute graft-versus-host disease.
Int Immunol.
1993;5:565[Abstract/Free Full Text].
30.
Rus V, Svetic A, Nguyen P, Gause WC, Via CS.
Kinetics of Th1 and Th2 cytokine production during the early course of acute and chronic murine graft-versus-host disease.
J Immunol.
1995;155:2396[Abstract].
31.
Garside P, Reid S, Steel M, Mowat AM.
Differential cytokine production associated with distinct phases of murine graft-versus-host reaction.
Immunology.
1994;82:211[Medline]
[Order article via Infotrieve].
32.
DeWit D, Van Mechelen M, Zanin C, et al.
Preferential activation of Th2 cells in chronic graft-versus-host disease.
J Immunol.
1993;150:361[Abstract].
33.
Doutrelepont JM, Moser M, Leo O, et al.
Hyper IgE in stimulatory graft-versus-host disease: role of interleukin-4.
Clin Exp Immunol.
1991;83:133[Medline]
[Order article via Infotrieve].
34.
Garlisi CG, Pennline KJ, Smith SR, Siegel MI, Umland SP.
Cytokine gene expression in mice undergoing chronic graft-versus-host disease.
Mol Immunol.
1993;30:669[Medline]
[Order article via Infotrieve].
35.
Adkins B, Gandour D, Strober S, Weissman I.
Total lymphoid irradiation leads to transient depletion of the mouse thymic medulla and persistent abnormalities among medullary stromal cells.
J Immunol.
1988;140:3373[Abstract].
36.
Gleichmann E, Van Elven EH, Van der Veen JP.
A systemic lupus erythematosus (SLE)-like disease in mice induced by abnormal T-B cell cooperation: preferential formation of autoantibodies characteristic of SLE.
Eur J Immunol.
1982;12:152[Medline]
[Order article via Infotrieve].
37.
Penit C, Vasseur F.
Expansion of mature thymocyte subsets before emigration to the periphery.
J Immunol.
1997;159:4848[Abstract].
38.
Penit C, Vasseur F.
Phenotype analysis of cycling and postcycling thymocytes: evaluation of detection methods for BrdUrd and surface proteins.
Cytometry.
1993;14:757[Medline]
[Order article via Infotrieve].
39.
Rodewald HR, Fehling HJ.
Molecular and cellular events in early thymocyte development.
Adv Immunol.
1998;69:1[Medline]
[Order article via Infotrieve].
40.
Sant'Angelo DB, Lucas B, Waterbury PG, et al.
A molecular map of T cell development.
Immunity.
1998;9:179[Medline]
[Order article via Infotrieve].
41.
Ellison CA, Fischer JM, HayGlass KT, Gartner JG.
Murine graft-versus-host disease in an F1-hybrid model using IFN-gamma gene knockout donors.
J Immunol.
1998;161:631[Abstract/Free Full Text].
42.
Kelso A.
Frequency analysis of lymphokine-secreting CD4+ and CD8+ T cells activated in a graft-versus-host reaction.
J Immunol.
1990;145:2167[Abstract].
43.
Dulude G, Brochu S, Fontaine P, et al.
Thymic and extrathymic differentiation and expansion of T lymphocytes following bone marrow transplantation in irradiated recipients.
Exp Hematol.
1997;25:992[Medline]
[Order article via Infotrieve].
44.
Douek DC, McFarland RD, Keiser PH, et al.
Changes in thymic function with age and during the treatment of HIV infection.
Nature.
1998;396:690[Medline]
[Order article via Infotrieve].
45.
Cavenagh JD, Milne TM, Macey MG, Newland AC.
Thymic function in adults: evidence derived from immune recovery patterns following myeloablative chemotherapy and stem cell infusion.
Br J Haematol.
1997;97:673[Medline]
[Order article via Infotrieve].
46.
Malek TR, Porter BO, He YW.
Multiple c-dependent cytokines regulate T-cell development.
Immunol Today.
1999;20:71[Medline]
[Order article via Infotrieve].
47.
Munoz-Fernandez MA, Pimentel-Muinos FX, Gonzalez A, Gambon F, Alvarez-Vallina L, Fresno M.
Differential effect of tumor necrosis factor on human thymocyte subpopulations.
Immunology.
1992;76:439[Medline]
[Order article via Infotrieve].
48.
Suda T, Murray R, Guidos C, Zlotnik A.
Growth-promoting activity of IL-1 alpha, IL-6, and tumor necrosis factor-alpha in combination with IL-2, IL-4, or IL-7 on murine thymocytes: differential effects on CD4/CD8 subsets and on CD3+/CD3 double-negative thymocytes.
J Immunol.
1990;144:3039[Abstract].
49.
Naquet P, Naspetti M, Boyd R.
Development, organization and function of the thymic medulla in normal, immunodeficient or autoimmune mice.
Semin Immunol.
1999;11:47[Medline]
[Order article via Infotrieve].
50.
Kato Y, Morikawa A, Sugiyama T, et al.
Role of tumor necrosis factor-alpha and glucocorticoid on lipopolysaccharide (LPS)-induced apoptosis of thymocytes.
FEMS Immunol Med Microbiol.
1995;12:195[Medline]
[Order article via Infotrieve].
51.
Agus D, Surh C, Sprent J.
Reentry of T cells to the adult thymus is restricted to activated T cells.
J Exp Med.
1991;173:1039[Abstract/Free Full Text].
52.
Ramsdell F, Jenkins M, Dinh Q, Fowlkes BJ.
The majority of CD4+8 thymocytes are functionally immature.
J Immunol.
1991;147:1779[Abstract].
53.
Dulude G, Roy DC, Perreault C.
The effect of graft-versus-host disease on T cell production and homeostasis.
J Exp Med.
1999;189:1329[Abstract/Free Full Text].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
E. Clave, M. Busson, C. Douay, R. Peffault de Latour, J. Berrou, C. Rabian, M. Carmagnat, V. Rocha, D. Charron, G. Socie, et al.
Acute graft-versus-host disease transiently impairs thymic output in young patients after allogeneic hematopoietic stem cell transplantation
Blood,
June 18, 2009;
113(25):
6477 - 6484.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Borsotti, A. R. K. Franklin, S. X. Lu, T. D. Kim, O. M. Smith, D. Suh, C. G. King, A. Chow, C. Liu, O. Alpdogan, et al.
Absence of donor T-cell-derived soluble TNF decreases graft-versus-host disease without impairing graft-versus-tumor activity
Blood,
July 15, 2007;
110(2):
783 - 786.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Chakraverty and M. Sykes
The role of antigen-presenting cells in triggering graft-versus-host disease and graft-versus-leukemia
Blood,
July 1, 2007;
110(1):
9 - 17.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. M. Hauri-Hohl, M. P. Keller, J. Gill, K. Hafen, E. Pachlatko, T. Boulay, A. Peter, G. A. Hollander, and W. Krenger
Donor T-cell alloreactivity against host thymic epithelium limits T-cell development after bone marrow transplantation
Blood,
May 1, 2007;
109(9):
4080 - 4088.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. W. Rossi, L. T. Jeker, T. Ueno, S. Kuse, M. P. Keller, S. Zuklys, A. V. Gudkov, Y. Takahama, W. Krenger, B. R. Blazar, et al.
Keratinocyte growth factor (KGF) enhances postnatal T-cell development via enhancements in proliferation and function of thymic epithelial cells
Blood,
May 1, 2007;
109(9):
3803 - 3811.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. H. Terwey, T. D. Kim, A. A. Kochman, V. M. Hubbard, S. Lu, J. L. Zakrzewski, T. Ramirez-Montagut, J. M. Eng, S. J. Muriglan, G. Heller, et al.
CCR2 is required for CD8-induced graft-versus-host disease
Blood,
November 1, 2005;
106(9):
3322 - 3330.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A.-M. Wagner, K. Beier, E. Christen, G. A. Hollander, and W. Krenger
Leydig cell injury as a consequence of an acute graft-versus-host reaction
Blood,
April 1, 2005;
105(7):
2988 - 2990.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Krenger, H. Schmidlin, G. Cavadini, and G. A. Hollander
On the Relevance of TCR Rearrangement Circles as Molecular Markers for Thymic Output during Experimental Graft-versus-Host Disease
J. Immunol.,
June 15, 2004;
172(12):
7359 - 7367.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. A. Caligiuri, A. Velardi, D. A. Scheinberg, and I. M. Borrello
Immunotherapeutic Approaches for Hematologic Malignancies
Hematology,
January 1, 2004;
2004(1):
337 - 353.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-F. Poulin, M. Sylvestre, P. Champagne, M.-L. Dion, N. Kettaf, A. Dumont, M. Lainesse, P. Fontaine, D.-C. Roy, C. Perreault, et al.
Evidence for adequate thymic function but impaired naive T-cell survival following allogeneic hematopoietic stem cell transplantation in the absence of chronic graft-versus-host disease
Blood,
December 15, 2003;
102(13):
4600 - 4607.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Rossi, B. R. Blazar, C. L. Farrell, D. M. Danilenko, D. L. Lacey, K. I. Weinberg, W. Krenger, and G. A. Hollander
Keratinocyte growth factor preserves normal thymopoiesis and thymic microenvironment during experimental graft-versus-host disease
Blood,
June 28, 2002;
100(2):
682 - 691.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Min, P. A. Taylor, A. Panoskaltsis-Mortari, B. Chung, D. M. Danilenko, C. Farrell, D. L. Lacey, B. R. Blazar, and K. I. Weinberg
Protection from thymic epithelial cell injury by keratinocyte growth factor: a new approach to improve thymic and peripheral T-cell reconstitution after bone marrow transplantation
Blood,
May 29, 2002;
99(12):
4592 - 4600.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Weinberg, B. R. Blazar, J. E. Wagner, E. Agura, B. J. Hill, M. Smogorzewska, R. A. Koup, M. R. Betts, R. H. Collins, and D. C. Douek
Factors affecting thymic function after allogeneic hematopoietic stem cell transplantation
Blood,
March 1, 2001;
97(5):
1458 - 1466.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction