|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 96 No. 1 (July 1), 2000:
pp. 41-49
CHEMOKINES
Expression and coreceptor activity of STRL33/Bonzo on primary
peripheral blood lymphocytes
Matthew Sharron,
Stefan Pöhlmann,
Ken Price,
Elias Lolis,
Monica Tsang,
Frank Kirchhoff,
Robert W. Doms, and
Benhur Lee
From the University of Pennsylvania, Department of Pathology and
Laboratory Medicine, Philadelphia, PA; the Institute for Clinical and
Molecular Virology, University of Erlangen-Nürnberg,
Schlo garten, Erlangen, Germany; R&D Systems,
Minneapolis, MN; and the Department of Pharmacology, Yale University,
New Haven, CT.
 |
Abstract |
CCR5 and CXCR4 are the major coreceptors that mediate human
immunodeficiency virus 1 (HIV-1) infection, while most simian immunodeficiency virus (SIV) isolates use CCR5. A number of alternative coreceptors can also mediate infection of some virus strains in vitro,
although little is known about their in vivo relevance. Therefore, we characterized the expression pattern and coreceptor activity of one of these alternative coreceptors, STRL33/Bonzo, using a
newly developed monoclonal antibody. In addition to being highly
expressed (approximately 1000-7000 STRL33 ABS [antibody binding
sites]) on specific subsets of natural killer cells
(CD3 /CD16 /low/CD56+ and
CD3 /CD16low/CD56 ) and
CD19+ B lymphocytes (approximately 300-5000 STRL33 ABS),
STRL33 was expressed at levels sufficient to support virus infection on
freshly isolated, truly naive
CD4+/CD45RA+/CD62L+
cells (6000-11 000 ABS). STRL33 expression on peripheral blood mononuclear cells (PBMCs) was increased by mitogenic stimulation (OKT3/IL-2 [interleukin-2] had a greater effect than
phytohemaglutinin (PHA)/IL-2), but it was dramatically decreased
upon Ficoll purification. Infection of CCR5 human
peripheral blood lymphocytes (PBLs) showed that 2 different SIV
envelope (Env) proteins mediated entry into STRL33+
cells. More importantly, the preferential infection of
STRL33+ cells in CCR5 PBLs by an
R5/X4/STRL33 HIV-1 maternal isolate in the presence of a
potent CXCR4 antagonist (AMD3100) suggests that STRL33 can be used as a
coreceptor by HIV-1 on primary cells. Rhesus macaque (rh) STRL33 was
used less efficiently than human STRL33 by the majority of SIV Env
proteins tested despite similar levels of expression, thereby making it
less likely that STRL33 is a relevant coreceptor in the rhesus macaque
system. In summary, the expression pattern and coreceptor activity of
STRL33 suggest its involvement in trafficking of tumor-infiltrating
lymphocytes and indicate that STRL33 may be a relevant coreceptor in vivo.
(Blood. 2000;96:41-49)
© 2000 by The American Society of Hematology.
 |
Introduction |
Productive viral entry by primate lentiviruses requires
the cooperative interaction of the viral envelope (Env) protein with CD4 and a coreceptor.1-4 CCR5 and CXCR4 are the major human
immunodeficiency virus 1 (HIV-1) coreceptors, while most simian virus
(SIV) isolates use CCR5 but not CXCR4 for viral entry.5
Most SIV isolates can be propagated in T cell lines (eg, CEMx174) that
express CXCR4 but not CCR5. As a result, coreceptors other than CCR5
and CXCR4 must be responsible for effecting viral entry into these
cells.6-8 Receptors such as APJ, ChemR23, GPR1, GPR15/BOB,
and STRL33/Bonzo, which support infection for some HIV and SIV strains
in vitro,9-14 have been identified, although their in vivo
relevance is not clear.
STRL33/Bonzo was originally cloned from a tumor infiltrating cell line
by degenerate polymerase chain reaction (PCR) during a search for novel
chemokine receptors.15 It was independently isolated in a
functional expression screening assay by its ability to support viral
infection by some SIV strains.9 Subsequent testing revealed
that STRL33 supports efficient cell-cell fusion by a wide variety of
SIV Env proteins,11 although it is generally inefficient at
mediating infection by HIV-1 isolates.11,16 However, most
HIV-1 isolates are derived from peripheral blood, and studying the
coreceptor usage patterns of these isolates may not be optimal for
correlation with the myriad aspects of HIV pathogenesis. Of all the
HIV-1 isolates screened thus far, studies have only described a
maternal-infant pair from a clear case of vertical transmission that
uses STRL33 as efficiently as the major HIV-1 coreceptors CCR5 and
CXCR4.17,18
Given the use of STRL33 by a wide variety of SIV Env proteins and the
prominence of the SIV infection model in the study of HIV pathogenesis,
we sought to finely characterize the expression pattern and coreceptor
activity of STRL33. Expression studies using a monoclonal antibody
(mAb) developed against STRL33 found that STRL33 was expressed on
CD4+ truly naive (CD45RA+/CD62L+) T
cells, B lymphocytes, and specific subsets of natural killer (NK)
cells that are found predominantly in the human decidua during pregnancy.19 These NK cells have also been implicated in
solid tissue surveillance.20 Infection of
ccr5 32 homozygous peripheral blood lymphocytes
(PBLs) was detected in STRL33+ cells using either SIV Env
protein-pseudotyped Green Fluorescent Protein (GFP)
reporter viruses or the maternal STRL33-using primary HIV-1 isolates
described above. The preferential infection of STRL33+,
CCR5 PBLs by the R5/X4/STRL33-tropic maternal
isolate in the presence of a CXCR4 antagonist (AMD3100) strongly
suggests that STRL33 can mediate viral entry into primary cells. In
summary, the restricted but specific expression of STRL33 on cellular
subsets provides potential insights into the physiologic role of
STRL33, and the characterization of its coreceptor activity on primary
PBLs provides insights into its role in SIV and HIV-1 pathogenesis.
 |
Materials and methods |
Cell culture conditions and cell lines
All cell lines (GHOST-STRL33 CELLS) (American Type Culture
Collection and the National Institutes of Health AIDS Research and
Reference Reagent Program, Bethesda, MD) were maintained according to
the suppliers' recommendations. Primary PBLs from either wild-type or
ccr5 32 homozygous individuals, determined by PCR genotyping, were purified by Ficoll-Hypaque gradient (Pharmacia; Uppsala, Sweden) and resuspended in Roswell Park Memorial Institute
medium (RPMI 1640) supplemented with 1% penicillin-streptomycin and
10% fetal calf serum (FCS). For 7-10 days, the cells were left in either unstimulated medium or medium stimulated with interleukin-2 (IL-2) alone, 10 µg/mL phytohemagglutinin (PHA) plus 20 U/mL IL-2 (PHA/IL-2), or 2 µg/mL goat-antimouse cross-linked anti-CD3 plus (20 U/ml) IL-2 (OKT3/IL-2).
Infection studies
GFP was cloned in place of the luciferase gene in
pNL-R-E-luc21,22 to create GFP reporter viruses when the
pNL-R-E-GFP backbone was cotransfected with plasmids expressing the
appropriate Env protein. GFP reporter viruses were used in infection
assays in a similar manner to luc reporter viruses.21,22
All infections were performed in the presence of 8 µg/mL
diethylaminoethyl-dextran (DEAE-dextran). Approximately 48 hours after
infection, infected target cells were harvested with 5 mmol/L
ethylenediamine tetraacetic acid (EDTA) or Versene, washed
once with phosphate-buffered saline (PBS) and either fixed directly
with 2% paraformaldehyde or stained with the appropriate antibodies
and processed for fluorescence activated cell sorter (FACS) analysis.
pcDNA3 transfected cells infected with the same amount of GFP reporter
virus were used as background controls for GFP expression. Inhibition
experiments were carried out by preincubating the target cells with
indicated amounts of appropriate antibodies for 30 minutes prior to
virus exposure. Infection using the maternal-fetal HIV-1 viral isolates (M6v3 and P6v3) was performed as above, but the analysis was done 1 week after infection using intracellular p24-antigen staining and FACS analysis.
Generation of rhesus and human STRL33 expression vectors
Rhesus macaque PBMCs (rhPBMCs) were isolated using
lymphocyte separation medium (Biochrom, Berlin, Germany) and stimulated for 3 days in RPMI 1640 medium containing 4 µg PHA, 100 U/mL IL-2, and 20% FCS. RNA was extracted from 107 cells using Trizol
(Gibco Life Technologies, Karlsruhe, Germany) and reverse transcribed
using an Avian Myeloblastosis Virus (AMV)-RT-based (AMV-reverse
transcription-based) cDNA synthesis kit (Boehringer Mannheim,
Mannheim, Germany). The primer used for amplification of
STRL33/p5Bonzo was 5'-CCGGATCCGGTGTT
CATCAGAACAGACACCATG-3' and for STRL33/p3Bonzo, the primer was
5'-CCGAATTCTTTCGAAACCCT GGCAAGGCCT-3'. The BamHI
(Bacillus amyloliquefaciens H) and EcoRI (Escherichia
coli RY13) restriction sites in the multiple cloning site (MCS)
were used for cloning into pcDNA3 (Invitrogen, San Diego, CA).
STRL33/Bonzo variants with the AU1-tag (DTYRYI) at the N-terminal were
constructed by PCR mutagenesis using primers p5BonzoAU1
5'-CCGGATCCACCATG GACA CCTACAGATACATAGCAGAGTATGATCACTATGA and
p3- Bonzo (for N-terminal tag). The PCR-amplicons were inserted into
the BamHI-EcoRI site in the multiple cloning site of pcDNA3. All
cloned PCR products were completely sequenced to confirm that only the
introduced changes were present. Our sequence was identical to
the GenBank entry AF124380 except that the codon for the last amino
acid was TTA instead of CTA, both of which encode for leucine. Human
STRL33 was PCR-amplified from genomic DNA using previously described
primers11 and cloned into the EcoR1/XbaI MCS of pcDNA3. The
ORF of the cloned human STRL33 was sequenced and was found to be
identical to the deposited GenBank sequence (U73529).
Antibodies
The antibodies used in the study included phycoerythrin-conjugated
(PE-conjugated) CD4 (Q4120, Sigma); allophycocyanin-conjugated (APC-conjugated) anti-CD3, Tricolor-conjugated anti-CD4 (S3.5), anti-CD8(3B5), anti-CD45RA(MEM56), anti-CD56 (NKI-nbl-1), fluorescence isothiocyanate-conjugated (FITC-conjugated) anti-CD19 (SJ35-C1), anti-CD16(3G8), and anti-CD62L (DREG-56) (clone names noted in parentheses; Caltag, Burlingame, CA); FITC- and PE-conjugated anti-p24
(KC57; Coulter, Miami, FL); and PE-conjugated anti-CCR52D7
(PharMingen, San Diego, CA). Biotinylated anti-AU1 mAb (Babco, Berkeley, CA) was detected by secondary staining with PE-conjugated streptavidin (PharMingen). The mAb 699 (mouse anti-STRL33 clone 56811, R&D Systems, Minneapolis, MN) was made by immunizing Balb/c mice using
syngeneic mouse myeloma (NSO) cells stably expressing the full-length
human STRL33 sequence as described.23 Purified mAb 699 was
directly conjugated to PE (by Molecular Probes, Eugene, OR), and only
chromatographic fractions with 565 /280 absorbance ratios of
3.4 ± 0.2 (indicating a fluorochrome-to-conjugate ratio of 1)
were used.
FACS analysis
Multicolor FACS analysis was performed essentially as
described.24 Whole blood lysis was carried out using
CAL-Lyse (Caltag, Burlingame, CA) according to manufacturer's
instructions. Results are presented as indicated in the appropriate
figure legends. Quantitative FACS (QFACS) analysis was performed by
converting the geometric mean channel fluorescence to the mean number
of equivalent soluble fluorochrome units (MESFUs) using a standardized microbead kit (Quantibrite, Becton Dickinson, San Jose, CA). For STRL33
quantification, only antibodies with a fluorochrome-to-conjugate ratio
of 1 were used. Therefore, MESFUs are equivalent to the number of ABS
on a cell. The actual number of antigens (STRL33) on a cell may vary
from the number of ABS by 2-fold or more depending on whether the
antibody exhibits monomeric or bivalent binding or whether all STRL33
molecules are conformationally accessible to mAb 699.
 |
Results |
Specificity of the anti-STRL33 mAb
An anti-STRL33 mAb, mAb 699, was derived by immunization of Balb/c
mice with STRL33-stable transfectants. To confirm its specificity, human 293T cells transiently expressing high levels of CD4 or various
chemokine or orphan 7 transmembrane domain receptors (CCR1, CCR2, CCR3,
CCR4, CCR5, CXCR1, CXCR2, CXCR4, GPR1, GPR15, CCR8, ChemR23, APJ, and
CX3CR1), many of which have been shown to have in vitro HIV-1 or SIV
coreceptor activity, were stained with mAb 699 (Figure
1). The mAb only reacted against STRL33
transfectants, and its reactivity was not affected by coexpression of
CD4 (Figure 1). Therefore, mAb 699 was specific for STRL33 among the
known coreceptors for HIV and SIV. Like many other antibodies to
chemokine receptors, mAb 699 recognizes a conformation-dependent
epitope since it did not recognize STRL33 by Western blot analysis
(data not shown).

View larger version (54K):
[in this window]
[in a new window]
| Fig 1.
Specificity of anti-STRL33 mAb 699.
293T cells were transfected with CD4 and/or the chemokine/orphan
receptor constructs listed in the figure. Transfected cells were lifted
off the plate with 5 mmol/L EDTA 18 hours after transfection and were
stained with PE-conjugated anti-STRL33 antibody as indicated in
"Materials and methods." Data are representative of 2 independent
experiments.
|
|
STRL33 expression on fresh whole blood
For multicolor and QFACS analysis, the STRL33 mAb was
directly conjugated to PE, and only high-pressure liquid chromatography (HPLC) fractions with 565 /280 absorbance ratios of
3.4 ± 0.2 (indicating a fluorochrome-to-conjugate ratio of 1)
were used. Fresh whole blood from 8 healthy HIV
donors was obtained in acid citrate dextrose tubes and stained within
the hour for the cell surface markers indicated. There was minimal and
variable expression of STRL33 on bulk CD4+ or
CD8+ T lymphocytes (CD3+). A high expressing
donor is shown in Figure 2A. The majority (more than 80%) of STRL33+ cells were in the B-lymphocyte
(CD19+) gate. Among CD4+ cells, a distinct
subpopulation of truly naive CD45RA+/CD62L+
cells highly expressed STRL33. True memory cells
(CD45RA /CD62L ) or memory cells
targeting to the lymph node
(CD45RA /CD62L+) were essentially
negative for STRL33 (Figure 2B).

View larger version (29K):
[in this window]
[in a new window]
| Fig 2.
STRL33 expression on PBMCs.
We used 4-color FACS analysis to identify the various subpopulations of
PBMCs indicated. Fresh whole blood was stained with
fluorochrome-conjugated mAb within an hour of venupuncture, and FACS
analysis was performed after ammonium chloride-mediated selective red
blood cell lysis. STRL33 expression on (A) bulk CD4+,
CD8+ T cells (CD3+), and CD19+ B
cells; (B) CD4+ naive
(CD45RA+/CD62L+) or memory
(CD45RA ) T cells; and (C) NK cell subsets (R1, R2,
and R3).
|
|
Because STRL33 was originally cloned from a tumor-infiltrating
lymphocyte cell line,15 we investigated the expression of STRL33 on tumor-infiltrating lymphocyte subsets. NK cells, although comprising only 5%-15% of circulating lymphocytes, can account for up
to 45% of tissue- or tumor-infiltrating
lymphocytes.25 At least 3 subsets of NK cells
have been recognized based on the cell surface markers CD16 and CD56
(Figure 2C: R1, R2, and R3).26 STRL33 expression was
confined to the
CD3 / CD16 /low/CD56+
(R2) or
CD3 /CD16low/CD56 (R3)
NK subsets, which have been implicated in solid tissue
surveillance20 and are present in high numbers in the human
decidua during pregnancy.19 STRL33 was not expressed on
CD16high/CD56± NK cells, which are thought
to mediate the classical non-major histocompatibility
complex-restricted (non-MHC-restricted) natural immunity to virally
infected cells.25,27
STRL33 expression levels required for efficient infection
Coreceptor expression levels are important for efficient
viral entry.28,29 This has been shown for
CCR528 and CCR3,30 and it has also been
suggested for STRL33 because infection of GHOST cells stably expressing
STRL33 is typically much less efficient than transient STRL33
transfectants.11,16 Using QFACS analysis,24 we
determined that transient STRL33 transfectants expressed at least 1 to
2 logs more surface STRL33 than the stable GHOST cells (more than
30 000 vs less than 3000 STRL33 ABS), perhaps accounting for the
inability of GHOST-STRL33 cells to support efficient infection in some
cases. To directly compare the efficiency of infection mediated by CCR5
versus STRL33, we titrated the amount of STRL33 and CCR5 transfected
onto 293T cells and infected them in parallel with SIV Env
protein-pseudotyped (SIVmacBK28 and SIVmac316) GFP reporter viruses.
Two days after infection, the CCR5 and STRL33 levels were quantified
only on transfected cells to directly correlate the efficiency of
infection with the levels of coreceptor expression. In separate
experiments, we found that infection of cells with our
env- and nef-deleted reporter viruses did
not down-modulate receptor expression (data not shown). For both
SIVmacBK28 and SIVmac316, we found that below a threshold level of
coreceptor molecules, STRL33 was much less efficient than CCR5 in
supporting infection (Figure 3). This was
in stark contrast to CCR5, where the efficiency of infection was
linearly reduced as far as the threshold of our QFACS assay
(approximately 200-400 ABS) (Figure 3).31 Therefore,
efficient infection via STRL33 requires a higher threshold level than
CCR5, at least for the virus strains tested here.

View larger version (23K):
[in this window]
[in a new window]
| Fig 3.
Effects of receptor expression levels on virus infection.
Serial dilutions (1 µg to 0.009 µg per 12 wells) of STRL33 and CCR5
expression plasmids were transiently transfected into 293T cells along
with a constant amount of 1 µg CD4. Two days later, cells were
harvested with Versene and stained for either CCR5 (mAb 2D7) or STRL33
(mAb 699). CCR5 and STRL33 levels on gated GFP+ cells (ie,
infected cells) were quantified using QFACs as described. The relative
percentage (%) of GFP+ cells was linearly regressed
against CCR5 or STRL33 levels (presented as the number of ABS). Data
from 1 representative experiment out of 3 experiments with SIVmac316
and SIVmacBK28 env protein-pseudotyped reporter viruses are presented.
The linear trend for the CCR5 infections can be extrapolated back to
approximately 400 ABS as previously shown.31
|
|
Quantification of STRL33 levels on primary PBLs
To determine if the minimal levels of STRL33 required for efficient
infection were present on primary PBLs, the levels of STRL33 on the
various PBL subsets described in Figure 2 were quantified using QFACS
analysis.24 We found that expression levels could vary by
more than 10-fold between donors, depending on the lymphocyte subset
analyzed (Figure 4A). STRL33 levels were
highest on a subset of naive
CD45RA+/CD62L+/CD4+ T cells,
ranging from approximately 6000-11 000 ABS per cell. The relative
differences between subsets were not always the same between donors.
For example, on most donors, STRL33 expression was higher on bulk
CD4+ T cells compared with CD8+ T cells,
but the opposite was true for 2 of 8 donors (Figure 4B). Variable
expression was also seen on NK subsets. While STRL33 expression was
uniformly absent on the CD3 /CD16high
subset of NK cells, there was a differential expression of STRL33 among
donors between the remaining 2 NK subsets (Figures 2C and 4B). Whether
this differential expression of STRL33 on specific NK subsets can be
correlated to the activation status or functional activity of these NK
cells is a matter for future studies. Nevertheless, at least on
some subsets and in some volunteers, there were sufficient cell surface levels of STRL33 to mediate efficient virus infection.

View larger version (29K):
[in this window]
[in a new window]
| Fig 4.
Quantification of STRL33 levels on PBL subsets.
Levels of STRL33 expression on various PBL subsets delineated in Figure
2 were quantified using QFACS as described in "Materials and
methods." (A) STRL33 ABS from 8 different donors on the various PBL
subsets are shown. (B) Variation in STRL33 expression levels within
each donor among bulk CD4+/CD8+ T cells
(CD3+) and NK cell subsets are shown.
|
|
STRL33 expression can be modulated by isolation and stimulation
protocols
Ficoll-Hypaque purification of PBMCs can acutely affect chemokine
receptor expression.24,32 Indeed, we found that STRL33 expression on CD19+ B cells (the most abundant
STRL33+ cell type) was almost completely down-regulated
after Ficoll-Hypaque purification and overnight incubation in media
supplemented with 10% FCS (Figure 5A).
Ficoll-Hypaque-induced transient down-regulation also occurred in bulk
T cells (data not shown) and appears to be true for STRL33, CCR5, and
CXCR4.24,32 Therefore, until this phenomenon is better
characterized, we believe it is more accurate to use whole blood for
native chemokine receptor expression studies.

View larger version (34K):
[in this window]
[in a new window]
| Fig 5.
Modulation of STRL33 expression levels by isolation and
stimulation protocols.
(A) STRL33 levels were quantified on fresh whole blood
(CD19+ B-cell subset) and after Ficoll-Hypaque gradient
purification and overnight incubation in RPMI 1640 supplemented with
10% FCS. Each symbol represents a different donor out of 8 total
donors. (B) PBLs from a homozygous ccr5 32 donor were
Ficoll-Hypaque purified and either left unstimulated (U/S) in media
(RPMI 1640 plus 10% FCS) or stimulated with IL-2, PHA/IL-2, or
cross-linked anti-CD3/IL-2 (OKT3/IL-2) for 7 days. Cells were then
costained for STRL33 and CD25 (as an activation marker). Note the
increase in STRL33 levels only on the CD25+ subset. Similar
data were obtained from 8 donors who had a wild-type for CCR5.
|
|
To determine if STRL33 expression can be up-regulated upon in vitro
stimulation, we purified PBMCs with Ficoll-Hypaque and stimulated them
for 7-10 days as shown in Figure 5B. Mitogenic stimulation was required
for the induction of STRL33 expression in the presence of IL-2, and
OKT3 was a more potent inducer than PHA (Figure 5B, middle column). By
contrast, IL-2 treatment alone resulted in minimal STRL33 expression.
STRL33 up-regulation was confined to acutely activated lymphocytes
(CD25++; Figure 5B, upper right quadrant). As an additional
specificity control, a 50-fold excess of unconjugated anti-STRL33 mAb
699 was used as a competitor and was able to compete off the positive STRL33 staining in the CD25++ gate (Figure 5B). Our results
show that STRL33 expression in cultured PBLs is highly dependent on the
stimulation protocol used, and studies into the use of STRL33 as a
coreceptor on primary cells will need to take this important variable
into account.
Infection of STRL33+ CCR5 PBLs
A number of SIV strains that use CCR5 but not CXCR4 have been shown
to infect CCR5 human PBMCs or T cell lines, which
indicates that an alternative coreceptor, such as STRL33, may be
used.6,8 To determine if SIV strains can infect
CCR5 , STRL33+ human cells, SIV Env
protein-pseudotyped GFP reporter viruses were used to infect
stimulated PBLs from ccr5 32 homozygous donors. Infection was
obtained with SIV and Murine Leukemia Virus (MLV) (amphotropic) Env protein-pseudotyped viruses but not with an HIV-1 R5
Env protein-pseudotyped virus (Figure 6A,
first column). The addition of 20 µg/mL neutralizing anti-CD4
antibody (Leu3A) completely inhibited infection by SIVmacBK28, but the
anti-CD4 antibody only inhibited infection by SIVsm B670clone3 by
about 50% (Figure 6A, second column). We have previously shown that SIVsm B670clone3 exhibits a considerable degree of CD4 independence with regard to CCR5-mediated infection.31,33 The addition
of 20 µg/mL STRL33 mAb had no significant effect on SIV infection. However, infection inhibition experiments on transfected cells indicated that our STRL33 antibody was nonneutralizing (Figure 6B), a
not uncommon property of antichemokine receptor
antibodies.23,34,35 In addition, preliminary evidence
indicates that the mAb 699 epitope is distinct from the regions in
STRL33 that are required for coreceptor activity.54 Therefore, the lack of inhibition by mAb 699 does not imply that STRL33 is not used as a coreceptor on primary
cells. Nevertheless, we costained the infected ccr5 32
homozygous PBLs for STRL33 and found GFP+ cells within the
STRL33+ populations (Figure 6C). This provides at least
circumstantial evidence that STRL33 can be used as a coreceptor on
stimulated ccr5 32 homozygous PBLs.

View larger version (44K):
[in this window]
[in a new window]
| Fig 6.
SIV infection of homozygous ccr5 32 PBLs.
We stimulated ccr5 32 PBLs with OKT3/IL-2. (A) One week after
stimulation, the indicated pseudotyped GFP reporter viruses were used
to infect the stimulated cells in the presence or absence of the
indicated antibodies (10 µg/mL anti-CD4 [leu3A], 20 µg/mL
anti-CCR52D7, and 20 µg/mL anti-STRL33 [mAb 699]). The
cells were fixed and analyzed by FACS for GFP expression 3 days later.
(B) Pseudotyped GFP reporter viruses were also used to infect CD4- and
CCR5- or STRL33-transfected 293T cells in the presence or absence of 20 µg/mL of the indicated antibodies (anti-CD4 [leu3A], 2D7 [R5
mAb], and anti-STRL33 [mAb 699]). The cells were harvested, fixed,
and analyzed for GFP expression 2 days later. The results are presented
as the percent of infected cells (GFP+) normalized against
the negative control (percent of infected cells in the presence of 20 µg/mL mouse IgG). (C) Infected ccr5 32 PBLs from panel A
were costained with anti-STRL33. GFP+ cells can clearly be
seen in the STRL33+ gate (compare with uninfected/isotype
control, at far right dot-plot). Data shown is representative of
results from 2 donors.
|
|
Zhang and colleagues17,18 have shown that a
maternal-infant (R5/X4/STRL33-R5/STRL33) HIV-1 isolate pair derived
from a case of vertical transmission uses STRL33 as efficiently as CCR5 and/or CXCR4. We used the R5/X4/STRL33 maternal isolate to infect PHA/IL-2 stimulated ccr5 32 homozygous PBLs. Intracellular
p24-antigen staining 1 week after infection clearly indicated
p24-antigen-positive cells (Figure 7A).
Infection was inhibited completely by neutralizing anti-CD4 antibodies,
but it was only inhibited by about 85% in the presence of excess
AMD3100 (a potent CXCR4 inhibitor that abrogates X4-mediated infection
by this and other virus strains)36,37 (Figure 7A, upper
panel). Although CD4 is largely down-regulated upon productive viral
infection,38 if one assumes that p24-antigen-positive cells were all initially CD4+, costaining with CD4
indicated that close to 10% of the initial CD4+ population
was infected with the M6 virus (data not shown). Of these cells, up to
15% may be infectable via STRL33; AMD3100 only inhibited infection by
about 85%, and the remaining p24-antigen-positive cells were largely
in the STRL33 gate (Figure 7A, lower panel, and 7B). It should be noted
that while this strain can also use the APJ coreceptor,
the expression of APJ on PBLs has not been confirmed.10,14

View larger version (43K):
[in this window]
[in a new window]
| Fig 7.
HIV-1 infection of homozygous ccr5 32 PBLs.
We stimulated ccr5 32 PBLs with PHA/IL-2 and infected with
approximately 1200 TICD50 units of M6-v3 in the presence or
absence of the indicated amounts of antibodies or the CXCR4 antagonist
(AMD3100). The cells were stained for cell surface STRL33 and
intracellular p24 antigen 1 week after infection. The
p24-antigen-positive gate was defined as the region giving less than
0.01% of p24-antigen-positive cells when the p24-antigen
antibody was used on uninfected donor cells (negative control).
The p24-antigen-positive cells are indicated in red. (A)
Upper panel: The percent of p24-antigen-positive cells in the presence
or absence of the indicated antibodies or AMD3100 are shown in their
respective dot-plots. Lower panel: The distribution of
p24-antigen-positive cells in the STRL33+ or
STRL33 gates under the same conditions. (B) Lower
panel: Graphic representation of part A. The total number of
p24-antigen-positive cells in the presence or absence of AMD3100 or
the nonneutralizing anti-STRL33 antibody was normalized to 100%, and
the proportion of p24-antigen-positive cells in the
STRL33+ or STRL33 gates are shown.
|
|
Human STRL33 functions more efficiently as a coreceptor than
rhesus STRL33
Rhesus CCR5 functions more effectively as a coreceptor than human
CCR5 for many SIV isolates when CD4 levels are limiting or
nonexistent.31 We sought to determine if this was also true for rhesus STRL33. An alignment profile shows 94% amino acid identity between human and rhesus STRL33, with most of the differences being in
the N-terminal region (Figure 8A). Using
SIVmacBK28 Env protein-pseudotyped GFP reporter viruses in infection
assays on transfected cells, we found that rhesus STRL33 was used far
less efficiently than huSTRL33 (Figure 8B, top row, and 8C). However, because rhesus STRL33 was not recognized by mAb 699, we generated an
epitope-tagged rhesus STRL33 to ensure adequate cell surface expression
(Figure 8B, middle row). Both tagged and untagged rhesus STRL33-supported SIV Env protein-mediated infection to a similar degree, albeit far less efficiently than human STRL33. Additional SIV
Env proteins were also tested for their abilities to use human and
rhesus STRL33 to infect cells. We found that SIVmac316 was unable to
use rhesus STRL33, while SIVmac/17-E-Fr (Fred) used rhesus STRL33 at
about 40%-60% efficiency compared with human STRL33 (Figure 8C).
SIVsm B670clone3 minimally used rhesus STRL33. Preliminary studies
have identified key residues in the divergent STRL33 N-terminal that
are critical for coreceptor activity54.


View larger version (98K):
[in this window]
[in a new window]
| Fig 8.
Rhesus STRL33 is a less efficient coreceptor than human
STRL33.
(A) Schematic diagram of human STRL33. Human and rhesus STRL33 are 94%
identical at the amino acid level, with most of the extracellular loop
differences (inset) clustered at the amino terminus. Differences
between human and rhesus STRL33 are indicated by the shaded residues.
The conserved "DRY" motif in chemokine receptors implicated for
coupling to G-proteins is modified in human and rhesus STRL33 (filled
circle residues). (B) SIVmac251(BK28 clone) env protein-pseudotyped
GFP reporter virus was used to infect cells expressing CD4 and the
indicated coreceptor (top row). Receptor expression was confirmed by
staining with the indicated antibodies (middle row). Note that mAb 699 does not recognize rhesus STRL33, but AU1-tagged rhesus STRL33
indicated that rhesus STRL33 was expressed at similar levels to human
STRL33. Infection was seen only on the transfected cell population
(bottom row). Results were similar for SIV B670 clone 3 (Clone3),
SIVmac/17E-Fr (Fred), SIVmac316 (316) and HIV-1 JR-FL and are
quantified in panel C, where infection efficiency (% of
GFP+ cells) was normalized against that obtained for human
CCR5.
|
|
 |
Discussion |
All primary strains of HIV-1 studied to date use CCR5, CXCR4, or
both of these major coreceptors in conjunction with CD4 to enter
cells.5 Alternative coreceptors, such as CCR2, CCR3, CCR8,
CX3CR1, STRL33, APJ, ChemR23, GPR1, GPR15, and
STRL33,9-13,30,39,40 can also support virus
infection, but typically do so less efficiently than the major
coreceptors and are used by smaller numbers of virus
strains.5,11,16,17,30,41 The fact that SIV strains (which
do not use CXCR4) can infect CCR5 human
PBMCs6,8 indicates that at least some alternative coreceptors are expressed at levels sufficient to support virus infection on primary cell types. Our evidence indicates that STRL33 is
a likely candidate for supporting infection of primary cells. In
addition to being expressed on B cells and some NK cell subsets, STRL33
was expressed on freshly isolated truly naive
CD45RA+/CD62L+ T lymphocytes at levels
(approximately 6000-11 000 ABS) sufficient to support virus infection.
In fact, STRL33 was more highly expressed on this CD4+
T-cell subset than CXCR4 (approximately 2000-5000 ABS24).
Furthermore, mitogenic (PHA or OKT3) stimulation of primary PBLs in the
presence of IL-2 increased STRL33 expression on bulk
CD4+/CD25+ T cells (Figure 5B and data not
shown), potentially rendering additional cell types susceptible to
infection via this coreceptor.
Coreceptor expression levels can impact the efficiency of viral entry,
and indeed we found that STRL33 expression levels strongly impacted its
coreceptor function. While there was a linear relationship between CCR5
expression and infection efficiency down to very low levels of
coreceptor molecules (less than 103 CCR5 ABS),
STRL33-dependent infection fell sharply below a threshold level of ABS.
This threshold differed depending on the virus strain used
(approximately 3000 ABS for SIVmac316 and approximately 30 000 for
SIVmacBK28), and the differing threshold most likely accounts for the
reported differences in the ability of HIV-1 strains to use STRL33 as a
coreceptor since transient transfectants express far more STRL33 (at
least 30 000 STRL ABS) than GHOST-STRL33 stable cells (less than 3000 STRL33 ABS).11,16 Our results suggest that expression
levels of alternative coreceptors, such as STRL33 and
CCR3,30 may more strongly impact coreceptor activity
compared with the major coreceptors CCR5 and CXCR4.
Our STRL33 mAb did not block infection, which is not an uncommon
feature of chemokine receptor antibodies. Therefore we used GFP
reporter viruses bearing different Env proteins to infect stimulated CCR5 PBLs and asked whether
STRL33+ cells became infected. We found that
infection mediated by the SIVmacBK28 and SIVsm B670clone3
Env proteins, which do not use CXCR4, was clearly but not exclusively
detected in STRL33+ cells (Figure 6C). More importantly,
infection of STRL33+, CCR5 cells was
also seen when using a maternal HIV-1 isolate (M6-v3), which was
previously determined to be R5/X4/STRL33-tropic.18 M6-v3
infection of STRL33+, CCR5 cells in the
presence of a potent CXCR4 antagonist (AMD3100)37,42,43 resulted in the majority of p24-antigen-positive cells appearing in
the STRL33+, CXCR4 gate, which suggests
that STRL33 can mediate viral entry on primary PBLs. This observed
difference from the published report18 is likely due to
donor variability and the conditions under which the cells were grown.
(We observed a 10-fold donor variability with regard to STRL33
expression.) To our knowledge, this is the first report of an HIV-1
infection of human PBMCs that occurs independently of CCR5 and CXCR4.
It is interesting to note that the only HIV-1 isolates known to use
STRL33 as efficiently as the major HIV-1 coreceptors (CCR5 and CXCR4)
were isolated from a case of maternal-infant
transmission.17,18 There is evidence that bidirectional
traffic of leukocytes may occur across the placental barrier during
pregnancy,44 and contact with infectious
maternal blood may be a route for HIV transmission. Naive
CD45RA+/CD62L+ cells that express STRL33 are
much more abundant in umbilical cord blood than in adult peripheral
blood.43 It is interesting to note that
CD3 /CD56+/CD16 /low NK
cells (which express STRL33) are also present in high numbers in the
human decidua during pregnancy19,45 and are known to be
intimately associated with the fetal trophoblast cells during placental
invasion.45 Although CD4 is not known to be expressed on NK
cells, soluble33,46 or membrane-bound47 CD4 can
in some circumstances mediate viral infection in trans. Whether
transactivation by membrane-bound CD4 from neighboring CD4+
lymphocytes in the crowded cellular environment of the maternal-fetal placental interface allows infection of STRL33-expressing NK cells remains to be determined.
Given the broad use of STRL33 by SIV strains,5,11 we were
surprised to find that rhesus STRL33 was used much less efficiently than human STRL33, a deficiency that cannot be explained simply by
expression levels. Rhesus and human STRL33 share a 94% identity at the
amino acid level, with most of the differences clustered at the
N-terminal (Figure 8A). Preliminary evidence indicates that single
amino acid changes in the N-terminal from rhesus to human residues can
make rhesus STRL33 as efficient as human STRL33 in terms of coreceptor
activity and that the mAb 699 epitope is distinct from
residues required for coreceptor activity.54 These results
call into question the in vivo importance of STRL33 in the rhesus
macaque system and underscores the importance of using coreceptors
derived from appropriate nonhuman primates when studying primary SIV strains.
The expression pattern of STRL33 suggests possible in vivo functions
for this orphan receptor. While the expression of STRL33 tended to
track more with CXCR4 than CCR5, its pattern was certainly unique. In
addition to naive CD45RA+/CD62L+ cells, STRL33
was expressed on B cells and on
CD56+/CD16 /low or
CD56 /CD16low NK cells, but it was not
expressed not on CD16high/CD56± NK cells
that were thought to target virally infected cells. STRL33 was
originally cloned from a tumor-infiltrating cell line.15 NK
cells possess non-MHC-restricted cytolytic activity and are thought to
be the first line of defense against both virus infected cells and
nascent tumorgenesis.25,27 Tumors known to elicit high
numbers of infiltrating NK cells include bronchiogenic carcinomas and
melanomas.48-50 We speculate that the immune system may
have evolved a receptor (such as STRL33) to home in on specific
tumor-secreted or membrane-associated products. This hypothesis can be
tested by transplanting STRL33 knock-out mice with TIL-attracting tumors.
The proliferation of alternative coreceptors for primate lentiviruses,
as determined by in vitro assays, underscores the need for
understanding the roles these coreceptors may play in the immunopathogenesis of acquired immunodeficiency syndrome (AIDS). Whether these receptors support infection of primary cells is not yet
clear. But reports that infection of CCR5 primary
human cells can be invariably inhibited by CXCR4
antagonists18,51,52 argue that if alternative coreceptors
do contribute to viral pathogenesis in vivo, it is apt to be via
infection of very specific cell subsets. However, given the recent
development of CCR5 and CXCR4 antagonists, it is important to ask if
HIV-1 could evolve to use receptors other than CCR5 or CXCR4 in
the face of strong selective pressure. A naturally occurring
example of adaptive coreceptor use is provided by studies of Red-capped
mangabeys, many of which are CCR5 due to the
presence of a common CCR5 polymorphism (ccr5 24). SIV
isolates taken from CCR5 Red-capped mangabeys
(SIVrcm) exhibit highly efficient use of CCR2.53 We
are not aware of other examples in which primary SIV strains can use
CCR2 to infect cells in conjunction with CD4, which indicates that
unexpected patterns of coreceptor use may arise if use of major
coreceptors is prevented.
Interestingly, the only other coreceptor that can be detectably used by
SIVrcm is STRL33. In dissecting the expression profile of STRL33 and
delineating its responses to various mitogenic stimuli, we provide
evidence that STRL33 may be a relevant coreceptor for HIV-1 in vivo. It
is expressed on some CD4+ cells at levels sufficient to
support virus infection. In addition, mitogenic stimulation could well
result in additional cell types becoming positive for STRL33.
Importantly, we have found a primary HIV-1 strain that can infect human
PBLs independently of CCR5 and CXCR4, most likely via STRL33. Does this
mean that inhibitors to STRL33 will have to be developed? At this point
it is not clear. Only a single HIV-1 isolate studied thus far uses
STRL33 efficiently, and this is the first reported case of HIV
infection of human PBLs in a CCR5- and CXCR4-independent manner. In
addition, STRL33 is expressed on a much smaller fraction of
CD4+ T cells than are CCR5 or CXCR4. However, the use of
CCR2 by SIV strains isolated from Red-capped mangabeys clearly
demonstrates that unexpected coreceptor use patterns might
occur in the face of strong selective pressure. Thus, studies into the
coreceptor activity, expression patterns, and biologic function of
STRL33, as well as other alternative coreceptors, will clearly be of
value in complementing the development of effective coreceptor inhibitors.
 |
Acknowledgments |
We thank Drew Weissman, Luis Montaner, and Jim Hoxie for
helpful discussions. We would also like to thank Y. J. Zhang and John Moore for providing the maternal-fetal viral isolates used in this study and for sharing unpublished results. The technical help
provided by George Leslie is also appreciated. We also thank Mary Dietz, Dorothy Shroeder, John Humphrey, James
David, and Frank Mortari at R&D Systems for invaluable help in
generating the hybridoma.
 |
Footnotes |
Supported in part by K08 grant HL03923-01 (B.L.) from the
National Heart, Lung, and Blood Institute, the National Institutes of
Health (NIH), Bethesda, MD; by grant R01 40880 (R.W.D.) from the NIH;
by a Burroughs Wellcome Fund Award for translation research, Burroughs
Wellcome Fund, Research Triangle Park, NC; and by Small Business Innovation Grant (SBIR) R44 AI41299 (collaboration between R&D
Systems and R.W.D.). R.W.D. is an Elizabeth Glaser Scientist of the
Pediatric AIDS Foundation.
Submitted January 17, 2000; accepted February 22, 2000.
Reprints: Benhur Lee, Room 806, or Robert W. Doms,
Room 807A, Department of Pathology and Laboratory Medicine, Abramson Bldg, 34th Street & Civic Center Blvd, Philadelphia, PA, 19104; e-mail: benhur{at}mail.med.upenn.edu or
doms{at}mail.med.upenn.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
 |
References |
1.
Moore JP, Trkola A, Dragic T.
Co-receptors for HIV-1 entry.
Curr Opinion Immunol.
1997;9:551-562[Medline]
[Order article via Infotrieve].
2.
Doms RW, Peiper SC.
Unwelcome guests with master keys: how HIV uses chemokine receptors for cellular entry.
Virology.
1997;235:179-190[Medline]
[Order article via Infotrieve].
3.
Bieniasz PD, Cullen BR.
Chemokine receptors and human immunodeficiency virus infection.
Frontiers Biosci.
1998;3:44-58.
4.
Berger EA, Murphy PM, Farber JM.
Chemokine receptors as HIV-1 coreceptors: roles in viral entry, tropism, and disease.
Annu Rev Immunol.
1999;17:657-700[Medline]
[Order article via Infotrieve].
5.
Doms RW, Edinger AL, Moore JP.
Coreceptor use by primate lentiviruses: human retroviruses and AIDS 1998. Los Alamos, NM Los Alamos National Laboratory: Theoretical Biology and Biophysics; 1998.
6.
Chen Z, Zhou P, Ho DD, Landau NR, Marx PA.
Genetically divergent strains of simian immunodeficiency virus use CCR5 as a coreceptor for entry.
J Virol.
1997;71:2705-2714[Abstract].
7.
Hill CM, Deng H, Unutmaz D, et al.
Envelope glycoproteins from human immunodeficiency virus types 1 and 2 and simian immunodeficiency virus can use human CCR5 as a coreceptor for viral entry and make direct CD4-dependent interactions with this chemokine receptor.
J Virol.
1997;71:6296-6304[Abstract].
8.
Kirchhoff F, Pohlmann S, Hamacher M, et al.
Simian immunodeficiency virus variants with differential T-cell and macrophage tropism use CCR5 and an unidentified cofactor expressed in CEMX174 cells for efficient entry.
J Virol.
1997;71:6509-6516[Abstract].
9.
Deng H, Unutmaz D, Kewalramani VN, Littman DR.
Expression cloning of new receptors used by simian and human immunodeficiency viruses.
Nature.
1997;388:296-300[Medline]
[Order article via Infotrieve].
10.
Edinger AL, Hoffman TL, Yi Y, et al.
An orphan seven transmembrane domain receptor expressed widely in brain functions as a coreceptor for HIV-1 and SIV.
J Virol.
1998;72:7934-7940[Abstract/Free Full Text].
11.
Edinger AL, Hoffman TL, Sharron M, et al.
Use of GPR1, GPR15, and STRL33 as coreceptors by diverse HIV-1 and SIV envelope proteins.
Virology.
1998;249:367-378[Medline]
[Order article via Infotrieve].
12.
Farzan M, Choe H, Martin K, et al.
Two orphan seven-transmembrane segment receptors which are expressed in CD4-positive cells support simian immunodeficiency virus infection.
J Exp Med.
1997;186:405-411[Abstract/Free Full Text].
13.
Samson M, Edinger AL, Stordeur P, et al.
ChemR23, a putative chemoattractant receptor, is expressed in dendritic cells and is a coreceptor for SIV and some primary HIV-1 strains.
Eur J Immunol.
1998;28:1688-1700.
14.
Choe H, Farzan M, Konkel M, et al.
The orphan seven-transmembrane receptor apj supports the entry of primary T-cell-line-tropic and dualtropic human immunodeficiency virus type 1.
J Virol.
1998;72:6113-6118 |