|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Department of Cell Biology, University of
Alabama at Birmingham, Birmingham, AL.
Interleukin (IL)-1 The mature fibrinogen molecule is composed of equal
molar amounts of 3 pairs of nonidentical subunits.1
Secretion of fibrinogen requires correct assembly of all 3 chains.
Alterations in the production of any one subunit can influence assembly
and secretion of the mature protein.2,3 Although
fibrinogen is expressed constitutively, its production can be greatly
increased during an acute-phase response by interleukin (IL)-6 and
glucocorticoids4,5; therefore, it is regarded as an
acute-phase reactant (APR).6
The initial proinflammatory cytokines produced in an acute-phase
response are tumor necrosis factor IL-1 Materials
Cell culture and treatment with cytokines
Total RNA isolation and Northern blot analyses Total RNA was prepared from cells treated with different cytokines, using TRIzol reagent (Gibco). Ten micrograms of total RNA samples were fractionated on 1.5% agarose gel and subjected to Northern blot assays. Rat fibrinogen gene complementary DNA (cDNA)
or human fibrinogen gene cDNA was labeled with
[ 32P]-dCTP, using a random primer kit (Amersham Life
Sciences) as the probe. Rat cyclophilin cDNA or human GAPDH cDNA was
radiolabeled and used as the internal probe for rat or human RNA
samples, respectively. Filters that had been hybridized and extensively
washed were exposed to x-ray film or to a phosphoImage screen for
quantification. Quantification of labeled bands was performed using the
ImageQuant program (Molecular Dynamic).
Cell transfection and luciferase activity assay Construct F2 contains the 800 base pair (bp) to +54 bp region
of rat fibrinogen gene promoter in front of the luciferase gene in
the pGL2 vector. Construct F3 contains the 300 bp to +54 bp of rat
fibrinogen gene promoter region. In construct M1, the IL-6RE CTGGGA
region was mutated.20 Construct M3 was made from F3 by
site-directed mutagenesis, changing the  B site from
GGGAATCCC to GGGAAGTAC. The plasmid DNA of each
construct (5 µg) was transfected into H35, H4IIE, HepG2, or Hep3B
cells for reporter analysis. To monitor the transfection efficiency, 1 µg of pCMV- gal vector was always co-transfected with the reporter construct. For overexpression of rat IL-6 receptor, 5 µg of
pCMV-RIL-6R plasmids were co-transfected with the reporter constructs
into HepG2 cells. Transfection was performed in 100-mm dishes, using calcium phosphate precipitation procedures for HepG2 and Hep3B cells.
Transfection of H35 or H4IIE cells was performed, using Lipofectin
reagent (Gibco). After transfection for 48 hours, cells were split into
6-well plates, cultured overnight, and stimulated with cytokines
(IL-1 and IL-6) for 6 hours. Cell lysates were prepared and
luciferase activity was measured using Luciferase Assay System
(Promega) on a Luminometer (Bio-Rad), and -galactosidase activity
was measured using -galactosidase Assay System kit (Promega).
Nuclear protein extraction Nuclear extracts were prepared from rat primary hepatocytes, H35, H4IIE, HepG2, or Hep3B cells, following their treatment with different cytokines.20,29 All procedures were carried out at 4°C, and the extracted proteins were aliquoted and stored at80°C.
Western blot analysis Nuclear protein (50 µg/lane) were separated on 10% denatured sodium dodecyl sulfate-polyacrylamide gels and transferred onto a polyvinylidene fluoride membrane. The filter was blotted with anti-STAT3 antibodies, and the positive signal was developed with enhanced chemiluminescence reagents (Pierce).Electrophoretic mobility shift assay (EMSA) EMSAs were performed as described previously.20,29 Radiolabeled double-stranded probes were prepared by filling in the 5' overhanging ends of reannealed complementary oligonucleotides with appropriate radioactivity. The DNA sequences of used probes are (top strand only): site II probe, the site II IL-6RE from rat fibrinogen
gene promoter, 5' TGCAAAATCTGGGAATCCCT 3'; SIE probe, mutant 67 of
serum inducible element on c-fos gene promoter, 5'
CGACATTTCCCGTAAATCG 3'; NF-B probe, B site from immunoglobulin chain enhancer, 5' GATCCATGGGGAATTCCCC 3'; C/EBP probe, C/EBP binding site from IL-6 gene promoter, 5' GACGTCACTTGCACAATCTTAA 3'; and
2MG probe: the IL-6RE of rat 2-macroglobulin gene promoter region, 5' TTCTGGGAATTCCC 3'. For competition assays, unlabeled probes
were added at 100-fold molar excess to 32P-labeled probes
in Figure 5A or as indicated in Figure 5C. In EMSA that used antibodies
for identification or verification of DNA binding proteins, nuclear
extracts were incubated with 2 µg antibodies at 4°C for 1 hour
prior to performing EMSA procedures. For DNA binding interference assay
that used IB, 1 ng of purified recombinant IB protein was
added into 20 µg nuclear extracts prior to carrying out EMSA
procedures. For in vitro NF-B and STAT3 DNA binding competition
assays, different amounts (from 0.1 ng to 5 ng) of purified NF-B p50
protein (Promega) were added into 20 µg nuclear extracts (control or
IL-6 treated) before EMSA binding reaction using a labeled site II
probe.29 Samples were analyzed on 6% non-denaturing
polyacrylamide gels in 0.5 × TBE, 5% glycerol at 4°C for 2 to
3 hours. Dried gels were exposed to x-ray film overnight at 80°C
with intensifying screens.
IL-1 inhibits IL-6-induced and IL-6 were examined only on the fibrinogen gene. Primary rat hepatocytes were exposed to IL-1 and
IL-6 individually and together (Figure
1A). IL-1 has no inducing effect
on the rat fibrinogen gene, whereas IL-6 stimulates its expression
(Figure 1A, lanes 1-3). When IL-1 was added simultaneously with
IL-6, the stimulating signal of IL-6 was diminished (Figure 1A, lane
4). Similar findings were shown, using HepG2 human hepatoma cells
(Figure 1B). These findings are consistent with the previously published observations.24 In addition, IL-1 treatment
down-regulated the basal level of fibrinogen gene expression, which
was more pronounced in HepG2 cells (Figure 1B, lane 2).
IL-1 fibrinogen gene promoter responded to the IL-1 inhibitory signal. We chose human HepG2 cells for the transfection studies because
rat H35 and H4IIE cells are unable to respond to IL-1 stimulation
(data not shown). Two constructs, F2 and F3, containing different
lengths of rat fibrinogen promoter region were transfected into
HepG2 cells and tested for responsiveness to IL-6 and IL-1. In cells
transfected with either the F2 or F3 construct, IL-6 stimulation
induced a 2-fold increase of luciferase activity. The finding is
similar to the reported IL-6 response of the A and human
fibrinogen genes.30,31 The addition of IL-1 alone did
not affect the luciferase activity. However, when IL-1 was co-administrated with IL-6, the inductive response of IL-6 was reduced.
These findings demonstrated that IL-1 functions through the promoter
region of rat fibrinogen gene to inhibit downstream gene transcription.
Overexpression of IL-6 receptor gp80 subunit does not affect the
IL-1 down-modulates IL-6 receptor
subunit (gp80) expression.32 Thus inhibition of
IL-6-mediated fibrinogen induction could be due, in part, to a
reduction in the number of IL-6 receptors on the cell surface. To
address this question, we developed a reconstitution system in which
the rat IL-6 receptor (gp80) was overexpressed in HepG2 cells, and
recombinant mouse IL-6 was used to stimulate these cells. Murine IL-6
binds only to the exogenously expressed rat IL-6 receptor and not to the endogenous human IL-6 receptor.32 When the reporter
construct F3 was co-transfected with pCMV-RatIL-6R into HepG2 cells,
exposure to IL-1 showed a similar inhibition of the murine
IL-6-induced reporter gene expression (Figure
2B). These results indicated that
down-regulation of the IL-6 receptor expression is not a mechanism for
the IL-1 inhibition of IL-6 signaling.
IL-1 fibrinogen gene expression through
activation of transcription factor STAT3.20 Under normal
conditions, STAT3 remains in a latent (nonphosphorylated) state in the
cytoplasm. On activation, STAT3 dimerizes and translocates into the
nucleus.17,19 To determine if IL-1 affects IL-6-induced
STAT3 activation, we performed immunoblotting to analyze the nuclear
distribution of STAT3 following co-stimulation with IL-6 and IL-1
(Figure 3). Under control conditions,
little to no STAT3 could be detected in the nuclear extract (Figure 3,
lane 1). IL-1 stimulation did not change the STAT3 nuclear
distribution because it does not activate STAT3 (Figure 3, lane 2).
With IL-6 stimulation, STAT3 was activated, translocated, and
accumulated in the nucleus (Figure 3, lane 3). Co-stimulation with
IL-1 did not affect the STAT3 nuclear accumulation mediated by IL-6
(Figure 3, lane 4). These findings demonstrated that IL-1 does not
interfere with the IL-6-mediated STAT3 activation and nuclear
accumulation.
IL-1 fibrinogen gene promoter, there are 3 identified IL-6REs (containing the CTGGGAA motif). Binding of
IL-6-activated STAT3 to these 3 elements is essential for the
transactivation of rat fibrinogen gene.20 To further
understand the molecular basis for the IL-1 inhibitory function, we
performed EMSA, using the oligonucleotide probes that correspond to the
3 IL-6REs (designated site I, site II, and site III) and nuclear
extracts prepared from rat primary hepatocytes following their
treatment with different cytokines (Figure
4). IL-6-activated STAT3 complexes
associated with all 3 probes as described previously (Figure 4, lanes
3, 4, 7, 8, 11, and 12). IL-1 activated a distinct protein complex (complex X) that was strongly associated with the site II and site III
probes (Figure 4, lanes 6, 8, 10, and 12) but was very weakly associated with the site I probe (Figure 4, lanes 3 and 4).
Similar results were also obtained, using nuclear extracts prepared
from HepG2 or Hep3B cells (data not shown).
IL-1 -induced protein complexes associated
with the site II probe, we first performed competition EMSAs (Figure
5A). The addition of unlabeled site II
probe competes away both IL-6- and IL-1-induced protein complexes
(Figure 5A, lane 3), verifying the binding specificity of both
complexes. The addition of unlabeled SIEm67 probe (a STAT3-specific
probe17) only competes away the IL-6-induced protein
complex that contains activated STAT3, but it has no effect on the
formation of IL-1-induced protein complex (Figure 5A, lane 4). The
addition of unlabeled B probe blocks IL-1-induced protein
complexes but does not affect IL-6-induced complex formation (Figure
5A, lane 5). Unlabeled C/EBP probe used as a negative control showed no
effect on any complex formation (Figure 5A, lane 6). These findings
indicated that the IL-1-induced protein complex formed on the site
II probe contains factors that bind to NF-B binding
sequences.
The composition of the IL-1 We had noted in earlier experiments that IL-1 NF- -induced protein complexes have a higher affinity to
the site II and site III probes than STAT3 does. This finding was
confirmed by a cross-competition EMSA (Figure 5C). Previously, with the
use of nuclear extracts prepared from rat hepatocytes co-stimulated
with IL-1 and IL-6, we were able to show that both STAT3 and NF-B
formed complexes on 2MG probe (Figure 5C, lane 1), which has a
perfect palindromic STAT3 binding motif overlapping with a B site.
By using increasing concentrations of unlabeled site I, site II, and
site III probes, we tested the relative binding affinity of the 3 fibrinogen probes to both STAT3 and NF-B by comparing their
capacities to compete the formation of the STAT3 and NF-B complexes
on the 2MG probe. The addition of 100-fold molar excess of unlabeled
site I probe only partially competed the STAT3 complex (Figure 5C, lane
4), whereas the addition of 100-fold molar excess of site II probe
completely competed away the STAT3 complex (Figure 5C, lane 8). The
addition of 100-fold molar excess of site III probes did not compete
the STAT3 complex (Figure 5C, lane 12). These results allowed us to
tentatively assign the binding affinity of STAT3 to these 3 probes in
the following order: site II > site I > site III. In the
case of NF-B binding affinity, the addition of 100-fold molar excess
of site I probes did not affect the NF-B complexes (Figure 5C, lane
5). The addition of 10-fold molar excess of the site II probe competed away most of the NF-B binding (Figure 5C, lane 7). The addition of
unlabeled site III probes was somewhat less effective than that of
unlabeled site II probes (Figure 5C, lanes 11-13). These findings
demonstrated that NF-B complexes associate with site II and site III
probes with higher affinity than does the site I probe. Finally, a
direct comparison of the binding affinity of STAT3 complex and NF-B
complex to site II probe can be seen in Figure 5C, lane 7. The addition
of 10-fold molar excess of unlabeled site II probes competed away the
majority of the NF-B complex but only partially competed away the
STAT3 complexes (Figure 5C, lane 7). This finding indicates that the
binding affinity of NF-B to the site II probe is higher than that of
STAT3 to the site II probe.
NF- B and STAT3 bind to sites II and III on the rat fibrinogen gene promoter region. IL-1-activated NF-B binding on
this region does not promote transcription of rat fibrinogen gene,
as shown in the Northern blot analysis (Figure 1) and in the
transfection analysis in HepG2 cells (Figure 2). Instead, when IL-1
is added together with IL-6, IL-1 inhibits the IL-6 function. One
possible explanation for the IL-1 inhibition is that NF-B
associates with the B site and blocks STAT3 from binding to its DNA
element. To test this hypothesis, we carried out in vitro binding
assays, using purified recombinant NF-B p50 protein (Figure
6). As shown previously, IL-6-activated
STAT3 weakly associates with the site II probe (Figure 6,
lane 6). NF-B p50 proteins form homodimers and strongly bind to the
site II probe (Figure 6, lanes 1-5). The inclusion of p50 proteins into
the IL-6-stimulated nuclear extracts resulted in the interference of
STAT3 DNA binding (Figure 6, lanes 7 and 8), whereas higher
concentrations of p50 protein completely blocked STAT3 association with
the site II probe (Figure 6, lanes 9 and 10).
B site on the fibrinogen
promoter, functional assays were performed, using a construct (M3) in
which half of the B site was mutated (Figure
7A). The different constructs were tested
for their IL-6 response first in rat hepatoma H35 cells (Figure 7B).
Construct F3 showed a normal IL-6 response in H35 cells (up to 8-fold
induction). Mutating the site II CTGGGAA region in construct M1 almost
completely abolished IL-6 response. Mutating the B site that
overlaps the STAT3 binding site in M3 caused a modulation of the IL-6
response; however, a reproducible 5-fold induction of luciferase
activity on IL-6 stimulation was still evident. The 3 constructs were
then transfected into HepG2 cells to analyze the IL-1 effects
(Figure 7C). Construct F3 responds to IL-6, and IL-1 inhibits the
IL-6 induction, as shown previously. Construct M1, lacking the CTGGGA
region, shows no IL-6 response and no IL-1 inhibition. Construct M3,
lacking the B site, was still able to respond to IL-6. However,
IL-1 failed to inhibit the IL-6 induction on this construct. These results suggest that the B site overlapping the STAT3 binding site
is important for IL-1 inhibition, although deletion of this region
also affects the IL-6 response.
We described a nucleotide sequence motif corresponding to a
NF-
STAT factors recognize the palindromic DNA motifs
(TTC-GAA).33,34 NF- In most cases, NF- Sequence alignment of several potential STAT3 and NF-
We thank our colleagues Drs Mitchell Olman and James Hagood for critical review of the manuscript.
Submitted February 21, 2000; accepted July 21, 2000.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Gerald M. Fuller, MCLM 680, Department of Cell Biology, University of Alabama at Birmingham, Birmingham, AL 35294; e-mail: gmfuller{at}bmg125.cmc.uab.edu.
1. Doolittle RF. Fibrinogen and fibrin. Annu Rev Biochem. 1984;53:195-229[Medline] [Order article via Infotrieve]. 2. Fuller GM. The molecular biology of fibrinogen. In: Mackiewicz A,Kusher I,Baumann H, eds. Acute Phase Protein: Molecular Biology, Biochemistry, and Clinical Applications. Boca Raton, FL: CRC Press; 1993:170-181. 3. Crabtree GR. The molecular biology of fibrinogen. In: Stamatoyannopoulos G,et al., eds. The Molecular Basis of Blood Diseases. Philadelphia, PA: Saunders; 1987:631-657.
4.
Zhang Z, Jones S, Hagood JS, Fuentes NL, Fuller GM.
STAT3 acts as a co-activator of glucocorticoid receptor signaling.
J Biol Chem.
1997;272:30607-30610
5.
Otto JM, Grenett HE, Fuller GM.
The coordinated regulation of fibrinogen gene transcription by hepatocyte-stimulating factor and dexamethasone.
J Cell Biol.
1987;105:1067-1072 6. Fey GH, Fuller GM. Regulation of acute phase gene expression by inflammatory mediators. Mol Biol Med. 1987;4:323-338[Medline] [Order article via Infotrieve].
7.
Dinarello CA.
Biologic basis for interleukin-1 in disease.
Blood.
1996;87:2095-2147 8. Dinarello CA. The interleukin-1 family: 10 years of discovery. FASEB J. 1994;8:1314-1325[Abstract]. 9. Castell JV, Gomez-Lechon MJ, David M, et al. Interleukin-6 is the major regulator of acute phase protein synthesis in adult human hepatocytes. FEBS Lett. 1989;242:237-239[Medline] [Order article via Infotrieve].
10.
Siebenlist U, Franzoso G, Brown K.
Structure, regulation and function of NF-
11.
Baeuerle PA.
I
12.
Baeuerle PA, Baltimore D.
I
13.
Huxford T, Huang DB, Malek S, Ghosh G.
The crystal structure of the I
14.
Malek S, Huxford T, Ghosh G.
I 15. Akira S, Isshiki H, Sugita T, et al. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J. 1990;9:1897-1906[Medline] [Order article via Infotrieve]. 16. Poli V, Mancini FP, Cortese R. IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP. Cell. 1990;63:643-653[Medline] [Order article via Infotrieve].
17.
Zhong Z, Wen Z, Darnell JE Jr.
STAT3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6.
Science.
1994;264:95-98
18.
Zhong Z, Wen Z, Darnell JE Jr.
STAT3 and STAT4: members of the family of signal transducers and activators of transcription.
Proc Natl Acad Sci U S A.
1994;91:4806-4810 19. Akira S, Nishio Y, Inoue M, et al. Molecular cloning of APRF, a novel IFN-stimulated gene factor 3 p91-related transcription factor involved in the gp130-mediated signaling pathway. Cell. 1994;77:63-71[Medline] [Order article via Infotrieve].
20.
Zhang Z, Fuentes NL, Fuller GM.
Characterization of the IL-6 responsive elements in the gamma fibrinogen gene promoter.
J Biol Chem.
1995;270:24287-24291 21. Rokita H, Loose LD, Bartle LM, Sipe JD. Synergism of interleukin 1 and interleukin 6 induces serum amyloid A production while depressing fibrinogen: a quantitative analysis. J Rheumatol. 1994;21:400-405[Medline] [Order article via Infotrieve].
22.
Zhang D, Sun M, Samols D, Kushner I.
STAT3 participates in transcriptional activation of the C-reactive protein gene by interleukin-6.
J Biol Chem.
1996;271:9503-9509
23.
Baumann H, Morella KK, Campos SP, Cao Z, Jahreis GP.
Role of CAAT-enhancer binding protein isoforms in the cytokine regulation of acute-phase plasma protein genes.
J Biol Chem.
1992;267:19744-19751 24. Conti P, Bartle L, Barbacane RC, Reale M, Sipe JD. The down-regulation of IL-6-stimulated fibrinogen steady state mRNA and protein levels by human recombinant IL-1 is not PGE2-dependent: effects of IL-1 receptor antagonist (IL-1RA). Mol Cell Biochem. 1995;142:171-178[Medline] [Order article via Infotrieve]. 25. Rokita H, Neta R, Sipe JD. Increased fibrinogen synthesis in mice during the acute phase response: co-operative interaction of interleukin 1, interleukin 6, and interleukin 1 receptor antagonist. Cytokine. 1993;5:454-458[Medline] [Order article via Infotrieve]. 26. Grenett HE, Danley DE, Strick CA, et al. Isolation and characterization of biologically active murine interleukin-6 produced in Escherichia coli. Gene. 1991;101:267-271[Medline] [Order article via Infotrieve].
27.
Grenett HE, Fuentes NL, Fuller GM.
Cloning and sequence analysis of the cDNA for murine interleukin-6.
Nucleic Acids Res.
1990;18:6455
28.
Baumann H, Jahreis GP, Morella KK.
Interaction of cytokine- and glucocorticoid-response elements of acute-phase plasma protein genes: importance of glucocorticoid receptor level and cell type for regulation of the elements from rat alpha 1-acid glycoprotein and beta-fibrinogen genes.
J Biol Chem.
1990;265:22275-22281
29.
Zhang Z, Fuller GM.
The competitive binding of STAT3 and NF-
30.
Hu CH, Harris JE, Davie EW, Chung DW.
Characterization of the 5'-flanking region of the gene for the alpha chain of human fibrinogen.
J Biol Chem.
1995;270:28342-28349
31.
Mizuguchi J, Hu CH, Cao Z, Loeb KR, Chung DW, Davie EW.
Characterization of the 5'-flanking region of the gene for the gamma chain of human fibrinogen.
J Biol Chem.
1995;270:28350-28356
32.
Baumann M, Baumann H, Fey GH.
Molecular cloning, characterization and functional expression of the rat liver interleukin 6 receptor.
J Biol Chem.
1990;265:19853-19862
33.
Seidel HM, Milocco LH, Lamb P, Darnell JEJ, Stein RB, Rosen J.
Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcription) DNA binding and transcriptional activity.
Proc Natl Acad Sci U S A.
1995;92:3041-3045
34.
Becker S, Groner B, Muller CW.
Three-dimensional structure of the STAT3
35.
Cramer P, Larson CJ, Verdine GL, Muller CW.
Structure of the human NF-
36.
Muller CW, Rey FA, Sodeoka M, Verdine GL, Harrison SC.
Structure of the NF-
37.
Chen FE, Huang DB, Chen YQ, Ghosh G.
Crystal structure of p50/p65 heterodimer of transcription factor NF-
38.
Ghosh G, van Duyne G, Ghosh S, Sigler PB.
Structure of NF-
39.
Thanos D, Maniatis T.
The high mobility group protein HMG I(Y) is required for NF-
40.
Wang Z, Liebhaber SA.
A 3'-flanking NF- 41. Chen X, Vinkemeier U, Zhao Y, Jeruzalmi D, Darnell JE Jr, Kuriyan J. Crystal structure of a tyrosine phosphorylated STAT-1 dimer bound to DNA. Cell. 1998;93:827-839[Medline] [Order article via Infotrieve].
42.
Hattori M, Abraham LJ, Northemann W, Fey GH.
Acute-phase reaction induces a specific complex between hepatic nuclear proteins and the interleukin 6 response element of the rat alpha 2-macroglobulin gene.
Proc Natl Acad Sci U S A.
1990;87:2364-2368
43.
Brown RT, Ades IZ, Nordan RP.
An acute phase response factor/NF- 44. Coffer P, Lutticken C, van Puijenbroek A, Klop-de JM, Horn F, Kruijer W. Transcriptional regulation of the junB promoter: analysis of STAT-mediated signal transduction. Oncogene. 1995;10:985-994[Medline] [Order article via Infotrieve].
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  A. Dehghan, Q. Yang, A. Peters, S. Basu, J. C. Bis, A. R. Rudnicka, M. Kavousi, M.-H. Chen, J. Baumert, G. D.O. Lowe, et al. Association of Novel Genetic Loci With Circulating Fibrinogen Levels: A Genome-Wide Association Study in 6 Population-Based Cohorts Circ Cardiovasc Genet, April 1, 2009; 2(2): 125 - 133. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-Y. Youn, H.-S. Yoo, M.-J. Kim, S.-Y. Hwang, Y. Choi, S. V. Desiderio, and J.-Y. Yoo hCTR9, a Component of Paf1 Complex, Participates in the Transcription of Interleukin 6-responsive Genes through Regulation of STAT3-DNA Interactions J. Biol. Chem., November 30, 2007; 282(48): 34727 - 34734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Hagihara, T. Nishikawa, Y. Sugamata, J. Song, T. Isobe, T. Taga, and K. Yoshizaki Essential role of STAT3 in cytokine-driven NF-{kappa}B-mediated serum amyloid A gene expression Genes Cells, November 1, 2005; 10(11): 1051 - 1063. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Verschuur, M. de Jong, L. Felida, M. P. M. de Maat, and H. L. Vos A Hepatocyte Nuclear Factor-3 Site in the Fibrinogen {beta} Promoter Is Important for Interleukin 6-induced Expression, and Its Activity Is Influenced by the Adjacent -148C/T Polymorphism J. Biol. Chem., April 29, 2005; 280(17): 16763 - 16771. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-P. Yang, U. Albrecht, V. Zakowski, R. M. Sobota, D. Haussinger, P. C. Heinrich, S. Ludwig, J. G. Bode, and F. Schaper Dual Function of Interleukin-1{beta} for the Regulation of Interleukin-6-induced Suppressor of Cytokine Signaling 3 Expression J. Biol. Chem., October 22, 2004; 279(43): 45279 - 45289. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yoshida, A. Kumar, Y. Koyama, H. Peng, A. Arman, J. A. Boch, and P. E. Auron Interleukin 1 Activates STAT3/Nuclear Factor-{kappa}B Cross-talk via a Unique TRAF6- and p65-dependent Mechanism J. Biol. Chem., January 16, 2004; 279(3): 1768 - 1776. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B. Boffa, J. D. Hamill, D. Maret, D. Brown, M. L. Scott, M. E. Nesheim, and M. L. Koschinsky Acute Phase Mediators Modulate Thrombin-activable Fibrinolysis Inhibitor (TAFI) Gene Expression in HepG2 Cells J. Biol. Chem., March 7, 2003; 278(11): 9250 - 9257. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. A. Feister, B. J. Auerbach, L. A. Cole, B. R. Krause, and S. K. Karathanasis Identification of an IL-6 response element in the human LCAT promoter J. Lipid Res., June 1, 2002; 43(6): 960 - 970. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
inhibits interleukin 6-mediated rat 
fibrinogen gene expression
Top
Abstract
Introduction
6 mol/L) in all treatments to maximize the
IL-6 induction.
-globin gene mediated
developmental silencing of this gene. Here, our data show that NF-
-globin gene.
EMBO J.
1999;18:2218-2228