|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the Laboratory of Cellular and Molecular Biology,
National Cancer Institute, Bethesda, MD; Department of Oncology,
Lombardi Cancer Center, Georgetown University Medical Center,
Washington, DC ; Oral and Pharyngeal Cancer Branch, National Institute
of Dental and Craniofacial Research; and Molecular Tumor Biology
Section, Basic Research Laboratory, National Cancer Institute,
Bethesda, MD.
Mouse plasma cell tumor (PCT) and human multiple myeloma (MM) are
terminal B-cell malignancies sharing many similarities. Our recent work
demonstrated that activation of the insulin-like growth factor receptor
(IGF-IR)/insulin receptor substrate (IRS)/phosphatidylinositol 3'
kinase (PI 3'K) pathway was evident in the tumor lines derived from
both species. Although PI 3'K activity was higher in mouse tumor lines
than that in human tumors, activation of Akt serine/threonine kinase
was markedly lower in mouse lines. This discrepancy prompted us to test
the status of PTEN tumor suppressor gene, as it has been shown to be a
negative regulator of PI 3'K activity. Although all the mouse lines
expressed intact PTEN, 2 of the 4 human lines ( Multiple myeloma (MM) is a terminal B-cell
malignancy, which accounts for 1% of total cancers, and to date,
available treatment options are largely ineffective. The etiology and
signaling pathways leading to the tumorigenesis are not fully
elucidated.1 However, activation of interleukin 6 (IL-6)
signaling and the translocation of IgH locus to other chromosomes,
resulting in their subsequent activation, are common phenomena in the
pathogenesis of myeloma development.2 Stimulation of the
IL-6 receptor pathway leading to the activation of the Ras/Raf/MAPK
cascade3 and constitutive activation of signal transducer
and activator of transcription (STAT) 34 have been linked
to disease development. Loss of chromosome fragments in chromosome 11 and 13 has been well documented from patient samples, although the
potential tumor suppressor genes from these chromosomes have not
been cloned.5
Mouse plasma cell tumor (PCT) is the counterpart disease of human
MM.6 It can arise either spontaneously or be chemically induced by mineral oil or pristane,7-9 or by retroviral
infections, including
v-raf/v-myc10-12 and
v-abl/v-myc13 oncogenes.
Genetically, chromosome translocation involving IgH locus linked to
c-myc activation is almost invariably detected from the
spontaneous PCTs.6 Recently, the T-cell and IL-6
dependency has been demonstrated for the induction of PCTs by
v-raf/v-myc oncogenes.14-16 On the
other hand, v-abl/v-myc oncogenes seem to be able
to bypass the IL-6 and T-cell requirement to induce
tumors.16 Interestingly, the constitutive and
IL-6-dependent STAT3 activation has also been observed in
v-abl/v-myc- and
v-raf/v-myc-induced PCTs,
respectively.16 Because both mouse and human plasma tumors share many similarities, including IL-6 and T-cell dependency for
tumorigenicity, chromosome translocation involving IgH loci, and signal
transduction affecting the STAT3 pathway, the mouse model mimics human
disease, which allows us to compare the signal transduction
pathways.17
Recently, our group has attempted to uncover the molecular mechanisms
involved in PCT development.18 Our results indicated that
overexpression and activation of insulin-like growth factor I (IGF-I)
receptor (IGF-IR) was detected in both raf/myc and
chemically induced PCT lines. Constitutive activation of the insulin
receptor substrate (IRS)-2 and phosphatidylinositol 3' kinase (PI 3'K) cascade was evident in all mouse tumors induced by either
raf/myc or abl/myc oncogenes or by chemical
reagents. The importance of IGF-IR activation in tumorigenesis was
further demonstrated by expressing a dominant-inhibitory mutant of
IGF-IR in several mouse lines, which specifically inhibited tumor
development in syngeneic Balb/c mice. In human MM, activation of IGF-IR
resulting in IRS-1 tyrosine phosphorylation and PI 3'K association with
IRS-1 has also been observed (W. Li, unpublished observation). These
results suggest that the enhanced IGF-IR activity and the IRS/PI 3'K
pathway may be involved in the terminal B-cell tumor development.
Activation of PI 3'K leading to generation of phosphatidylinositol (PI)
phosphates, including PI-3,4,5-P3 (PIP3), has
been linked to proliferating and survival pathways.19,20
The Akt/PKB serine/threonine kinase, which binds to PIP3
with high affinity, has been defined to be an important signaling
molecule downstream of PI 3'K.21 In response to growth
factor or cytokine stimulation, the elevated PIP3 recruits
Akt from the cytosol to the plasma membrane, where it can be
phosphorylated by 3'-phosphoinositide-dependent kinase 1 and another
unknown kinase on Thr308 and Ser473, respectively. Activated Akt
subsequently phosphorylates several substrates, including BAD
(BCL-2/Bcl-XL-antagonist, causing cell death), glycogen synthase kinase-3, forkhead transcription factor, and nitric oxide synthase, leading to the suppression of apoptosis by several different mechanisms.22
PTEN is a recently identified tumor suppressor gene,23,24
which has a dual phosphatase activity toward both
phosphotyrosine25 and phospholipid
substrates.26 Dephosphorylation of PI 3'K products, mainly
PIP3, by PTEN leads to the decreased level of this
important phospholipid and the concomitant reduction in Akt activity.
Thus, PTEN expression is considered to be an important negative
regulator controlling the PI 3'K/Akt activation in vivo.27
Conversely, loss of PTEN expression has been detected in many cancers,
including glioblastomas, breast and prostate carcinomas, and several
syndromes with multiple tumor incidences, including Cowden disease,
Lhermitte-Duclos disease, and Bannayan-Zonana syndrome.28
When PTEN gene is restored in glioblastomas or other PTEN null cells,
the Akt activity is suppressed, linking the role of PTEN to Akt
activation directly.29-32 Interestingly, high incidence of
hematopoietic tumors and lymphoid hyperplasia were observed in several
PTEN heterozygous mice,33,34 strongly suggesting the role
of PTEN in regulating hematopoietic cell proliferation, cell death, and
malignant transformation.
Although both human and mouse tumors were found to utilize
IGF-IR/IRS/PI 3'K as a major signaling cascade to transmit signals, we
present data here that they diverge significantly downstream of PI 3'K
activation. Although Akt activation, due to loss of PTEN, is observed
in MM lines, the p70S6K activity, also controlled by PI 3'K, is not
affected by PTEN expression.
Cell lines and culture
DNA constructs, transfection, and
retroviral infection
Cell lysates, immunoprecipitation, and immunoblot analysis Cells were serum starved for 2 hours in Dulbecco's Modified Essential Medium containing 25 µmol/L of Na3VO4 and were either not treated or stimulated with human IGF-I (100 ng/mL) (Intergen, Purchase, NY) for 10 minutes at 37°C. Cell pellets were lysed in a Triton X100 containing buffer.36 Equivalent amounts of cell lysates (2 mg per sample) were immunoprecipitated with anti-PTEN (Santa Cruz, SC7974, Santa Cruz, CA). Washed immunoprecipitates were electrophoresed on 8% SDS-PAGE gels, transferred to Immobilon P (Millipore, Bedford, MA), and immunoblotted with anti-Flag (Kodak, New Haven, CT). For direct Western analysis, anti-PTEN (Santa Cruz; SC6818), anti-Akt (Santa Cruz; SC1618), or anti-P-Akt (Ser473) (New England BioLab, Beverly, MA) was utilized. Proteins were detected using an ECL system from Amersham (Piscataway, NJ).PI 3'K activity assay Cells were similarly treated and lysed as described previously. Equivalent amounts of cell lysates were immunoprecipitated with anti-IRS-2,37 anti-IRS-1,37 or anti-phosphotyrosine (Upstate Biotechnology, Lake Placid, NY) and subjected to PI 3'K activity assay by measuring the phosphorylation of PI to yield PIP3 as previously reported.38Akt activity assay using Histone H2B as a substrate The method used for measuring Akt activity in vitro has been reported elsewhere.39The p70S6K activity assay Various cell lines were similarly treated, as stated previously, and lysed. Equivalent amounts of cell lysates were immunoprecipitated with anti-p70S6K (Santa Cruz; SC230) or anti-Grb2 (Santa Cruz; SC255; negative control). Washed immunoprecipitates were subjected to a S6K activity assay using a kit from Upstate Biotechnology containing a peptide AKRRRLSSLRA as substrate. The results were the mean value from 2 independent experiments.Genomic Southern blot analysis Genomic DNA was isolated using an Easy DNA kit from Invitrogen (Carlsbad, CA) according to the manufacturer's instructions. The 10 µg of genomic DNA was digested with either HindIII or EcoRI overnight and separated by 0.7% agarose gel. DNA transfer and hybridization were performed according to the standard protocol.40 Human PTEN cDNA (1.2 kilobase [kb]) was labeled using a random primer labeling kit from Stratagene (La Jolla, CA) and used as a probe for the hybridization. Washed membranes were autoradiographed.Northern blot analysis The method of total RNA preparation and Northern blot analysis has been previously described.38One-step reverse transcriptase-polymerase chain reaction, TOPO TA cloning, and sequencing analysis One-step reverse transcriptase-polymerase chain reaction (RT-PCR) was performed according to the instruction from the manufacturer (Gibco, BRL). The 5' primer used was 5'ACGAATTCATGACAGCCATCATCA 3' and the 3' one was 5' ATGGATCCTCAGACTTTTGTAATT 3'. PCR was run for 30 cycles (94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 1 minute). The PCR products were subcloned to TOPO TA cloning vector (Invitrogen) and subsequently sequenced using the ABI system.In vivo tumorigenesis Parental and PTEN infected cells were injected intraperitoneally (2 × 106 cells per mouse) into female BALB/c mice 24 hours after pristane priming. Tumor development was monitored twice per week.
PI 3'K activity was strongly detected in all mouse PCTs, but only weakly detected in human MM lines To determine the downstream signaling events linked to IGF-IR activation and IRS phosphorylation, we analyzed PI 3'K activity from the human MM and mouse PCT lines. As shown in Figure 1A, PI 3'K activity estimated as PIP3 yields in anti-IRS-2 immunoprecipitates was greatly increased in response to IGF-I stimulation in S107 (chemically induced) and 7.2 and 12.2 (raf/myc induced) mouse plasma cell tumors. Constitutive PI 3'K activity was detected in the 128.3 mouse plasma cell line (abl/myc induced). The PI 3'K activity measured by PIP3 production correlated with our previous observation in which p85 subunit of PI 3'K was coprecipitated with the phosphorylated IRS-2 in vivo, either IGF-I dependently for chemical and raf/myc PCTs or constitutively for abl/myc lines.18 Because IRS-1, instead of IRS-2, was preferentially phosphorylated in response to IGF-I in human MM lines (W. Li, unpublished observation), anti-IRS-1 immunoprecipitates were used to recover PI 3'K activity from MM lines. Again, the IGF-I-dependent PI 3'K activity associated with IRS-1 was detectable. However, the activity was much lower in MM than in PCT lines. Stimulation of mouse NIH3T3 fibroblasts with the platelet-derived growth factor-BB (PDGF-BB) resulted in a robust increase in PI 3'K activity as determined by using anti-PDGF- R for immunoprecipitation
and showed as a positive control.
To exclude that the affinities of anti-IRS-1 versus anti-IRS-2 used for immunoprecipitation led to the differences in PI 3'K activities in human and mouse lines, we included antiphosphotyrosine (anti-pTyr) for immunoprecipitation in a subsequent PI 3'K activity assay. As shown in Figure 1B, stimulation of both chemical (S107) and raf/myc (7.2 and 12.2) PCT lines with IGF-I led to the greatest induction of PIP3. Again, abl/myc lines (121.1 and 128.3) possessed constitutive PI 3'K activity independent of IGF-I. All 3 human MM lines responded to IGF-I for PIP3 induction. Consistent with the results shown in Figure 1A, the PI 3'K activity in human lines was much lower than that of mouse lineages. Together, these results indicate that stimulation of the IGF-IR pathway leads to PI 3'K activation in both mouse and human terminal B-cell tumors. Akt activities detected in mouse and human tumor lines do not correlate with their PI 3'K activation We next measured Akt activity, as it is known to be a downstream target of PI 3'K and to play a key role in tumor development by suppressing apoptosis.22 To our great surprise, IGF-I-stimulated Akt activities were only weakly induced in chemically (S107) and raf/myc (7.2 and 12.2)-induced plasma cell tumors, but not in abl/myc (128.3 and 121.1) lines and another chemical line (X24) (Figure 2A). In contrast, 2 of 3 human lines (OPM2 and 47) analyzed possessed
extremely high levels of basal Akt activities, which was further
enhanced in response to IGF-I. In contrast, the Brown human MM line had
a similar low level of Akt activity as the mouse plasma cell lines. As
a positive control, stimulation of NIH 3T3 fibroblasts with PDGF-BB
resulted in a strong induction of Akt activity.
Phosphorylation of Akt on Ser473, another indicator of Akt
activation41 was subsequently tested. Although
phosphorylation on this site was easily detectable in OPM-2 and
The lower Akt activities in all the mouse plasma cell lines, compared
with the 2 human MM lines (OPM-2 and Loss of PTEN expression in
OPM2 and 47), as determined by Western blot
analysis using anti-PTEN antibody recognizing the N-terminus of the
sequence (Figure 3A). The other 2 human
myeloma lines (Brown and ANBL-6) possessed wild-type PTEN, and Brown
had low Akt activity (Figure 2). Similarly, PTEN expression was
detected in all mouse PCT lines. One mouse B lymphoma line,
WEHI231, had very low PTEN expression. Together, the expression pattern
of PTEN between human and mouse plasma cell tumor lines
conversely correlates with Akt activity.
To further characterize the loss of PTEN expression in those 2 human MM lines, we performed genomic Southern blot analyses by using
human PTEN cDNA as a probe. As shown in Figure 3B in the left panel,
HindIII digestion showed that OPM2 lost 2 bands of 6.6 and
4.6 kb when compared with the digestion pattern in the Brown line, but
generated one extra band of 4.2 kb. The intensities of 2.5-kb bands
were much weaker in both OPM2 and To determine the expression of PTEN at the transcriptional levels, we
performed a Northern blot analysis using human PTEN cDNA as a probe. As
seen in Figure 3C, 2 major transcripts of 5.5 and 3.0 kb were detected
in most of the lines analyzed. However, the sizes of the transcripts
were much smaller in both OPM2 and Internal deletion of PTEN gene is
detected in OPM2 and 47 are about 600 and
850 base pair (bp), respectively (Figure 4A). By omitting reverse
transcriptase in the reaction of 7.2 raf/myc line, we did
not amplify any bands, indicating no genomic DNA contamination in our
RNA preparation. When PCR products were subsequently cloned into the
TOPO TA cloning vector, 2 complementary DNA (cDNA) inserts in the sizes
of about 900 and 700 bp were detected from 47 and were thus
designated 47 long (47-l) and short (47-s), respectively (Figure 4B).
Sequencing analysis indicates that the exons 3 to 5 and to 6 were
deleted in Restoration of PTEN expression in
OPM2 and 47 lines than in those lines
expressing either the vector alone or with C124S mutant (data not
shown). Furthermore, many apoptotic cells were detected by PTENWT
infection of these 2 lines (data not shown).
The PTEN-infected human lines were subsequently subjected to an Akt
activity assay using Histone H2B as a substrate (Figure 5B). About a
50% reduction of Akt activity in response to IGF-I was reproducibly
detected from To substantiate our finding that expression of PTENWT in those PTEN
null lines did negatively regulate Akt activity, we again measured
Ser473 Akt phosphorylation. As shown in Figure 5C, a similar level of
reduction of Akt phosphorylation was achieved in both The PTEN/Akt pathway is dispensable for mouse plasma cell tumor development in vivo To fully exclude the role of PTEN as a tumor suppressor gene for mouse tumor development, we expressed either PTENWT or C124S mutant in the 7.2 raf/myc line by using retroviral gene transfer with pLXIN vector (Figure 6A). On drug selection, more than a 100-fold increase of PTEN protein was achieved (Figure 6B). However, expression of PTENWT did not further affect endogenous Akt activity (Figure 6C), suggesting that endogenously expressed PTEN may be sufficient to negatively control endogenous Akt activation. Similarly, expression of the C124S mutant did not enhance endogenous Akt activity, which may indicate the difficulty of reversing the inhibition of Akt imposed by the existing PTEN. When the new infectants were subjected to tumorigenicity study by injecting the various lines into Balb/c syngeneic mice, tumor developed among all the lines (5 of 5 mice for each group, 2- week latent period, similar sizes for all the 4 groups). Subsequently, tumor cells were harvested from peritoneal cavities and lysed. Expression of either PTENWT or C124S mutant was detected in the corresponding infectants injected (Figure 6D), indicating that overexpression of PTEN does not affect the growth of mouse plasma cell tumors in vivo.
The p70S6K activity is not negatively regulated by PTEN expression and is induced in mouse tumor lines in response to IGF-I stimulation Having demonstrated that Akt was not active among the all mouse PCT lines, we were interested to know whether other known PI 3'K downstream signaling molecules, such as p70S6K,42 would also be negatively controlled by the expression of PTEN. Conversely, would the p70S6K activity be highly induced in the 2 human MM lines null for PTEN? Thus, p70S6K activity was measured by immunoprecipitating equivalent amounts of cell lysates with anti-p70S6K, followed by an in vitro phosphorylation assay using a peptide, AKRRRLSSLRA, as substrate. As shown in Figure 7A, all the mouse PCT lines responded to IGF-I for p70S6K induction, ranging from 1.6- to 5.2-fold. Three human MM lines showed 1.5- to 2.5-fold increases in kinase activities in response to IGF-I. The specific detection of p70S6K activity was demonstrated by using an isotype-matched anti-Grb2 antibody for immunoprecipitation as a negative control. Dependency on PI 3'K for p70S6K activity was established by including wortmannin, which completely reversed IGF-I-induced p70S6K activities in several lines analyzed. The net counts per minute of basal and induced kinase activities were much higher in mouse lines when compared with that of human lines and correlate with the protein levels (Figure 7B). IGF-I stimulation of the 2 abl/myc lines (128.3 and 121.1) reproducibly induced p70S6K activity by 2.2-fold, suggesting that some other pathways other than IRS-2 may be induced by IGF-I to stimulate extra PI 3'K activity in abl transformed lines.
Direct immunoblot analysis using anti-p70S6K antibody showed that more p70S6K protein is expressed in mouse than in human lines (Figure 7B). Furthermore, slower migration indicating kinase activation in response to IGF-I fully correlated with the kinase activities measured using the known substrate (Figure 7A). Again, wortmannin reversed slower migration of p70S6K in several mouse lines in response to IGF-I. Combining the results of p70S6K activity assay and mobility shifting pointing to the stronger induction of p70S6K activity in mouse than in those 2 human lines lacking PTEN expression, our results clearly indicate that p70S6K activation is not negatively regulated by PTEN. The p70S6K may be responsible for transmitting signals downstream of PI 3'K in mouse PCTs.
In this study, we present data that PI 3'K was activated in both mouse plasma cell tumors and human multiple myelomas. Interestingly, Akt serine/threonine kinase activity was only induced in 2 of 4 human lines, but not in any of the mouse tumor lines analyzed. By testing the expression of the PTEN tumor suppressor gene, we found a strong inverse correlation between PTEN expression and Akt activation. Ectopic expression of wild-type PTEN was able to suppress Akt activity in the 2 human MM lines lacking the PTEN gene, establishing the causative role of PTEN in regulating PI 3'K/Akt activation loop in human myeloma development. On the other hand, stable expression of PTENWT or C124S mutant in a mouse cell line did not affect Akt activity, or the tumorigenicity in vivo, suggesting that the PTEN/Akt cascade may be dispensable for mouse tumor development. Finally, strong evidence was provided that p70S6K activity was not affected by the status of PTEN in both species. These results reveal a significant difference in signaling pathways downstream of PI 3'K in the terminal B-cell tumors derived from the 2 species. Whereas uncontrolled activation of Akt because of the loss of PTEN may lead to malignant transformation of human MM cells, p70S6K may be preferentially utilized by most of the mouse PCT lines for cell signaling and tumor development. The pivotal role of PI 3'K in B lymphocyte proliferation has been
suggested by the finding that the knockout of p85 Signal transduction through the IGF-IR pathway involving the up-regulation and activation of IGF-IR, the activation of the IRS-2/PI 3'K cascade in mouse plasma cell tumor development has been previously elucidated.18 Although either spontaneous (abl/myc) or IGF-I-induced (raf/myc and chemical) PI 3'K activity was very high in the mouse tumors (Figure 1), we failed to detect Akt activation, which may be due to the negative regulation by PTEN. However, we cannot conclude that the endogenous PTEN caused Akt inactivation, as the expression of its C124S mutant in the raf/myc mouse line did not reverse the low level of Akt activation (Figure 6C). Nevertheless, we do not believe that PTEN can have any influence on tumorigenicity, as its overexpression did not affect the size and latency of tumor development in the animal study (Figure 6). Furthermore, several mouse lines expressing the Akt K179M mutant did not suppress mouse tumor development in vivo (W. Li, unpublished observation), excluding the possibility of PTEN/Akt involvement in the pathogenesis of mouse plasma cell tumors. Despite no induction of Akt activation, stimulation of the mouse lines with IGF-I significantly induced p70S6K activity. On the other hand, the 2 MM lines null for PTEN expression did not show as high p70S6K activity as that of Akt in response to IGF-I. Because it has been known that both Akt and p70S6K are dependent on PI 3'K for activation and that wortmannin can completely suppress both kinase activities, these results no doubt emphasize that p70S6K and Akt are differentially regulated downstream of PI 3'K. Our results are also in agreement with several findings using different cell models in which differential regulation of p70S6K and Akt was observed.48,49 Because PTEN is mainly able to dephosphorylate PIP3 in vivo, it will be tempting to speculate that p70S6K may not fully rely on PIP3 for its activation. It is also possible that the protein kinase activity, rather than lipid kinase activity of PI 3'K may directly activate p70S6K. Regardless of how these 2 molecules are regulated by PI 3'K, our results strongly suggest that signals can be transduced in mouse tumor lines through IRS-2/PI 3'K/p70S6K cascade independent of PTEN expression. In striking contrast to mouse plasma cell tumors, expression of PTENWT in the 2 human PTEN null lines suppressed the IGF-I-induced Akt activity by 50%, as determined by both kinase activity assay and Ser473 phosphorylation in the stably infected cells (Figure 5). Because the endogenous Akt activity was not completely inhibited by PTENWT expression, it is possible that other signaling pathway(s) independent of PI 3'K activation and PTEN negative regulation may induce Akt activity. It is more likely that the tumor suppressor effect of PTEN expression directly affected cell growth (unpublished observation), which only allowed selection of the lower PTEN expression in the infectants, thus leading to the partial inhibition of Akt. We are currently attempting to establish an inducible system to express PTEN in the human MM lines lacking PTEN expression, to overcome the potential toxicity of high levels of PTEN toward cell growth. However, on the basis of the reconstitution experiment, together with genomic and biochemical data, it is clear that PTEN is a major player controlling Akt activity and cell survival of several human MM lines. On the cloning of the PTEN tumor suppressor gene, many
reports documented its involvement in the etiology and/or the pathology of tumor development, including glioblastoma, prostate carcinoma, thyroid cancer, lung carcinoma, melonoma, and several syndromes exhibiting multiple tumor incidence.28 Recently, several
studies indicated that the PTEN gene is mutated and deleted
in several kinds of hematopoietic malignancies.50-52 We
also observed the extremely low level of PTEN expression in WEHI231
mouse lymphoma line. However, the mutation rate for lymphoma was not
very high in those cell lines and fresh samples analyzed. Furthermore,
whether the loss of PTEN expression could lead to high Akt activity
remains to be determined in lymphomas. We demonstrated the loss of PTEN expression in 2 of 4 human myeloma lines and established the role of
PTEN in regulating Akt activity by re-expressing PTEN in the 2 cell
lines. To our knowledge, this represents the first evidence for such a
large internal deletion of PTEN gene in tumor cells. Because
no protein expression was detected and RT-PCR only showed the truncated
allele in the OPM2 line, these data suggest that the other allele
appears to be completely deleted or nontranscriptional. For the When PTEN was expressed in those 2 PTEN null lines using the pLXIN vector, slower growth and higher apoptotic population of the infected cells were observed (W. Li, unpublished observation), consistent with its role in the inhibition of cell cycle entry and induction of apoptosis.27,30,32,53 Currently, we are attempting to define the functional role of PTEN in the pathogenesis of human myeloma by testing tumorigenicity of PTEN-expressing lines in animal models. Furthermore, the pathologic role of PTEN dysregulation in the various stages of myeloma, particularly at the onset of the disease is another important area for further exploration.
We thank Drs Stuart Rudikoff and Jacalyn Pierce for encouragement and Drs Michael Kuehl and John Dixon for reagents. The critical reviewing of the manuscript by Dr Robert Dickson is also greatly appreciated.
Submitted May 4, 2000; accepted July 21, 2000.
T.H. and A.Y. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Weiqun Li, Department of Oncology, Lombardi Cancer Center, Georgetown University Medical Center, New Research Building, E407, 3970 Reservoir Rd NW, Washington, DC 20007; e-mail:wwl{at}gunet.georgetown.edu.
1. Niesvizky R, Siegel D, Michaeli J. Biology and treatment of multiple myeloma. Blood Rev. 1993;7:24-33[Medline] [Order article via Infotrieve].
2.
Hallek M, Leif Bergsagel P, Anderson KC.
Multiple myeloma: increasing evidence for a multistep transformation process.
Blood.
1998;91:3-21 3. Nishimoto N, Shima Y, Yoshizaki K, Kishimoto T. Myeloma biology and therapy: present status and future developments. Hematol Oncol Clin North Am. 1997;11:159-172[Medline] [Order article via Infotrieve]. 4. Catlett-Falcone R, Landowski TH, Oshiro MM, et al. Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. Immunity. 1999;10:105-115[Medline] [Order article via Infotrieve]. 5. Feinman R, Sawyer J, Hardin J, Tricot G. Cytogenetics and molecular genetics in multiple myeloma. Hematol Oncol Clin North Am. 1997;11:1-25[Medline] [Order article via Infotrieve].
6.
Potter M, Wiener F.
Plasmacytomagenesis in mice: model of neoplastic development dependent upon chromosomal translocations.
Carcinogenesis.
1992;13:1681-1697 7. Potter M, Boyce C. Induction of plasma cell neoplasms in strain BALB/c mice with mineral oil and mineral oil adjuvants. Nature. 1962;193:1086-1087[Medline] [Order article via Infotrieve].
8.
Potter M, Morrison S, Wiener F, Zhang XK, Miller FW.
Induction of plasmacytomas with silicone gel in genetically susceptible strains of mice [see comments].
J Natl Cancer Inst.
1994;86:1058-1065 9. Anderson PN, Potter M. Induction of plasma cell tumours in BALB-c mice with 2,6,10,14-tetra-methylpentadecane (pristane). Nature. 1969;222:994-995[Medline] [Order article via Infotrieve]. 10. Hilbert DM, Pumphrey JG, Troppmair J, Rapp UR, Rudikoff S. Susceptibility and resistance to J3V1 retrovirus-induced murine plasmacytomagenesis in reconstituted severe combined immunodeficient mice. Oncogene. 1993;8:1993-2000[Medline] [Order article via Infotrieve]. 11. Kurie JM, Morse HC, Principato MA, et al. v-myc and v-raf act synergistically to induce B-cell tumors in pristane-primed adult BALBC mice. Oncogene. 1990;5:577-582[Medline] [Order article via Infotrieve].
12.
Troppmair J, Potter M, Wax JS, Rapp UR.
An altered v-raf is required in addition to v-myc in J3V1 virus for acceleration of murine plasmacytomagenesis.
Proc Natl Acad Sci U S A.
1989;86:9941-9945 13. Largaespada DA, Kaehler DA, Mishak H, et al. A retrovirus that expresses v-abl and c-myc oncogenes rapidly induces plasmacytomas. Oncogene. 1992;7:811-819[Medline] [Order article via Infotrieve].
14.
Hilbert DM, Kopf M, Mock BA, Kohler G, Rudikoff S.
Interleukin 6 is essential for in vivo development of B lineage neoplasms.
J Exp Med.
1995;182:243-248
15.
Hilbert DM, Shen MY, Rapp UR, Rudikoff S.
T cells induce terminal differentiation of transformed B cells to mature plasma cell tumors.
Proc Natl Acad Sci U S A.
1995;92:649-655 16. Hilbert DM, Migone TS, Kopf M, Leonard WJ, Rudikoff S. Distinct tumorigenic potential of abl and raf in B cell neoplasia: abl activates the IL-6 signaling pathway. Immunity. 1996;5:81-89[Medline] [Order article via Infotrieve]. 17. Potter M. Experimental plasmacytomagenesis in mice. Hematol Oncol Clin North Am. 1997;11:323-347[Medline] [Order article via Infotrieve].
18.
Li W, Hyun T, Heller M, et al.
Activation of insulin-like growth factor I receptor signaling pathway is critical for mouse plasma cell tumor growth.
Cancer Res..
2000;60:3909-3915
19.
Rameh LE, Cantley LC.
The role of phosphoinositide 3-kinase lipid products in cell function.
J Biol Chem.
1999;274:8347-8350 20. Fruman DA, Meyers RE, Cantley LC. Phosphoinositide kinases. Annu Rev Biochem. 1998;67:481-507[Medline] [Order article via Infotrieve]. 21. Franke TF, Kaplan DR, Cantley LC. PI3K: downstream AKTion blocks apoptosis. Cell. 1997;88:435-437[Medline] [Order article via Infotrieve]. 22. Vanhaesebroeck B, Alessi DR. The PI3K-PDK1 connection: more than just a road to PKB. Biochem J. 2000;346:561-576.
23.
Li J, Yen C, Liaw D, et al.
PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer [see comments].
Science.
1997;275:1943-1947 24. Steck PA, Pershouse MA, Jasser SA, et al. Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet. 1997;15:356-362[Medline] [Order article via Infotrieve].
25.
Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM.
Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN.
Science.
1998;280:1614-1617
26.
Maehama T, Dixon JE.
The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate.
J Biol Chem.
1998;273:13375-13378
27.
Cantley LC, Neel BG.
New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway.
Proc Natl Acad Sci U S A.
1999;96:4240-4245 28. Di Cristofano A, Pandolfi PP. The multiple roles of PTEN in tumor suppression. Cell. 2000;100:387-390[Medline] [Order article via Infotrieve].
29.
Myers MP, Pass I, Batty IH, et al.
The lipid phosphatase activity of PTEN is critical for its tumor supressor function.
Proc Natl Acad Sci U S A.
1998;95:13513-13518 30. Stambolic V, Suzuki A, de la Pompa JL, et al. Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell. 1998;95:29-39[Medline] [Order article via Infotrieve]. 31. Haas-Kogan D, Shalev N, Wong M, Mills G, Yount G, Stokoe D. Protein kinase B (PKB/Akt) activity is elevated in glioblastoma cells due to mutation of the tumor suppressor PTEN/MMAC. Curr Biol. 1998;8:1195-1198[Medline] [Order article via Infotrieve].
32.
Davies MA, Koul D, Dhesi H, et al.
Regulation of Akt/PKB activity, cellular growth, and apoptosis in prostate carcinoma cells by MMAC/PTEN.
Cancer Res.
1999;59:2551-2556
33.
Podsypanina K, Ellenson LH, Nemes A, et al.
Mutation of Pten/Mmac1 in mice causes neoplasia in multiple organ systems.
Proc Natl Acad Sci U S A.
1999;96:1563-1568 34. Suzuki A, de la Pompa JL, Stambolic V, et al. High cancer susceptibility and embryonic lethality associated with mutation of the PTEN tumor suppressor gene in mice. Curr Biol. 1998;8:1169-1178[Medline] [Order article via Infotrieve].
35.
Bergsagel PL, Chesi M, Nardini E, Brents LA, Kirby SL, Kuehl WM.
Promiscuous translocations into immunoglobulin heavy chain switch regions in multiple myeloma.
Proc Natl Acad Sci U S A.
1996;93:13931-13936
36.
Li W, Jiang Y-X, Zhang J, et al.
Protein kinase C-
37.
Wang LM, Michieli P, Lie WR, et al.
The insulin receptor substrate-1-related 4PS substrate but not the interleukin-2R gamma chain is involved in interleukin-13-mediated signal transduction.
Blood.
1995;86:4218-4227
38.
Soon L, Flechner L, Gutkind JS, et al.
Insulin-like growth factor I synergizes with interleukin 4 for hematopoietic cell proliferation independent of insulin receptor substrate expression.
Mol Cell Biol.
1999;19:3816-3828
39.
Li W, Zhang J, Flechner L, et al.
Protein kinase C- 40. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.; 1989. 41. Alessi DR, Andjelkovic M, Caudwell B, et al. Mechanism of activation of protein kinase B by insulin and IGF-I. EMBO J. 1996;15:6541-6551[Medline] [Order article via Infotrieve]. 42. Chou MM, Blenis J. The 70 kDa S6 kinase: regulation of a kinase with multiple roles in mitogenic signalling. Curr Opin Cell Biol. 1995;7:806-814[Medline] [Order article via Infotrieve].
43.
Fruman DA, Snapper SB, Yballe CM, et al.
Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85alpha.
Science.
1999;283:393-397
44.
Suzuki H, Terauchi Y, Fujiwara M, et al.
Xid-like immunodeficiency in mice with disruption of the p85alpha subunit of phosphoinositide 3-kinase.
Science.
1999;283:390-392 45. Jimenez C, Jones DR, Rodriguez-Viciana P, et al. Identification and characterization of a new oncogene derived from the regulatory subunit of phosphoinositide 3-kinase. EMBO J. 1998;17:743-753[Medline] [Order article via Infotrieve].
46.
Bellacosa A, Testa JR, Staal SP, Tsichlis PN.
A retroviral oncogene, akt, encoding a serine-threonine kinase containing an SH2-like region.
Science.
1991;254:274-277
47.
Jones PF, Jakubowicz T, Pitossi FJ, Maurer F, Hemmings BA.
Molecular cloning and identification of a serine/threonine protein kinase of the second-messenger subfamily.
Proc Natl Acad Sci U S A.
1991;88:4171-4175
48.
Conus NM, Hemmings BA, Pearson RB.
Differential regulation by calcium reveals distinct signaling requirements for the activation of Akt and p70S6k.
J Biol Chem.
1998;273:4776-4782
49.
Dufner A, Andjelkovic M, Burgering BM, Hemmings BA, Thomas G.
Protein kinase B localization and activation differentially affect S6 kinase 1 activity and eukaryotic translation initiation factor 4E-binding protein 1 phosphorylation.
Mol Cell Biol.
1999;19:4525-4534 50. Nakahara Y, Nagai H, Kinoshita T, et al. Mutational analysis of the PTEN/MMAC1 gene in non-Hodgkin's lymphoma. Leukemia. 1998;12:1277-1280[Medline] [Order article via Infotrieve].
51.
Dahia PL, Aguiar RC, Alberta J, et al.
PTEN is inversely correlated with the cell survival factor Akt/PKB and is inactivated via multiple mechanismsin haematological malignancies.
Hum Mol Genet.
1999;8:185-193
52.
Sakai A, Thieblemont C, Wellmann A, Jaffe ES, Raffeld M.
PTEN gene alterations in lymphoid neoplasms.
Blood.
1998;92:3410-3415
53.
Sun H, Lesche R, Li DM, et al.
PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway.
Proc Natl Acad Sci U S A.
1999;96:6199-6204
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  L. Salazar, T. Kashiwada, P. Krejci, P. Muchowski, D. Donoghue, W. R. Wilcox, and L. M. Thompson A novel interaction between fibroblast growth factor receptor 3 and the p85 subunit of phosphoinositide 3-kinase: activation-dependent regulation of ERK by p85 in multiple myeloma cells Hum. Mol. Genet., June 1, 2009; 18(11): 1951 - 1961. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Frost, Y. Shi, B. Hoang, J. Gera, and A. Lichtenstein Regulation of D-cyclin translation inhibition in myeloma cells treated with mammalian target of rapamycin inhibitors: rationale for combined treatment with extracellular signal-regulated kinase inhibitors and rapamycin Mol. Cancer Ther., January 1, 2009; 8(1): 83 - 93. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Zollinger, T. Stuhmer, M. Chatterjee, S. Gattenlohner, E. Haralambieva, H.-K. Muller-Hermelink, M. Andrulis, A. Greiner, C. Wesemeier, J. C. Rath, et al. Combined functional and molecular analysis of tumor cell signaling defines 2 distinct myeloma subgroups: Akt-dependent and Akt-independent multiple myeloma Blood, October 15, 2008; 112(8): 3403 - 3411. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Younes, X. Leleu, E. Hatjiharissi, A.-S. Moreau, T. Hideshima, P. Richardson, K. C. Anderson, and I. M. Ghobrial Targeting the Phosphatidylinositol 3-Kinase Pathway in Multiple Myeloma Clin. Cancer Res., July 1, 2007; 13(13): 3771 - 3775. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Stanford, J. W. Barrett, S. H. Nazarian, S. Werden, and G. McFadden Oncolytic Virotherapy Synergism with Signaling Inhibitors: Rapamycin Increases Myxoma Virus Tropism for Human Tumor Cells J. Virol., February 1, 2007; 81(3): 1251 - 1260. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X.-Y. Pei, W. Li, Y. Dai, P. Dent, and S. Grant Dissecting the Roles of Checkpoint Kinase 1/CDC2 and Mitogen-Activated Protein Kinase Kinase 1/2/Extracellular Signal-Regulated Kinase 1/2 in Relation to 7-Hydroxystaurosporine-Induced Apoptosis in Human Multiple Myeloma Cells Mol. Pharmacol., December 1, 2006; 70(6): 1965 - 1973. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Tang, A. M. Powelka, N. A. Soriano, M. P. Czech, and A. Guilherme PTEN, but Not SHIP2, Suppresses Insulin Signaling through the Phosphatidylinositol 3-Kinase/Akt Pathway in 3T3-L1 Adipocytes J. Biol. Chem., June 10, 2005; 280(23): 22523 - 22529. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Uddin, A. R. Hussain, K. A. Al-Hussein, P. S. Manogaran, A. Wickrema, M. I. Gutierrez, and K. G. Bhatia Inhibition of Phosphatidylinositol 3'-Kinase/AKT Signaling Promotes Apoptosis of Primary Effusion Lymphoma Cells Clin. Cancer Res., April 15, 2005; 11(8): 3102 - 3108. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Descamps, C. Pellat-Deceunynck, Y. Szpak, R. Bataille, N. Robillard, and M. Amiot The Magnitude of Akt/Phosphatidylinositol 3'-Kinase Proliferating Signaling Is Related to CD45 Expression in Human Myeloma Cells J. Immunol., October 15, 2004; 173(8): 4953 - 4959. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. H. Min, J.-W. Cheong, M. H. Lee, J. Y. Kim, S. T. Lee, J. S. Hahn, and Y. W. Ko Elevated S-Phase Kinase-Associated Protein 2 Protein Expression in Acute Myelogenous Leukemia: Its Association with Constitutive Phosphorylation of Phosphatase and Tensin Homologue Protein and Poor Prognosis Clin. Cancer Res., August 1, 2004; 10(15): 5123 - 5130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Hideshima, P. L. Bergsagel, W. M. Kuehl, and K. C. Anderson Advances in biology of multiple myeloma: clinical applications Blood, August 1, 2004; 104(3): 607 - 618. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Fonseca, B. Barlogie, R. Bataille, C. Bastard, P. L. Bergsagel, M. Chesi, F. E. Davies, J. Drach, P. R. Greipp, I. R. Kirsch, et al. Genetics and Cytogenetics of Multiple Myeloma: A Workshop Report Cancer Res., February 15, 2004; 64(4): 1546 - 1558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zhou, L. Gu, H. W. Findley, R. Jiang, and W. G. Woods PTEN Reverses MDM2-mediated Chemotherapy Resistance by Interacting with p53 in Acute Lymphoblastic Leukemia Cells Cancer Res., October 1, 2003; 63(19): 6357 - 6362. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Hu, Y. Shi, J.-h. Hsu, J. Gera, B. Van Ness, and A. Lichtenstein Downstream effectors of oncogenic ras in multiple myeloma cells Blood, April 15, 2003; 101(8): 3126 - 3135. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Suzuki, T. Kaisho, M. Ohishi, M. Tsukio-Yamaguchi, T. Tsubata, P. A. Koni, T. Sasaki, T. W. Mak, and T. Nakano Critical Roles of Pten in B Cell Homeostasis and Immunoglobulin Class Switch Recombination J. Exp. Med., March 3, 2003; 197(5): 657 - 667. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Gojo, B. Zhang, and R. G. Fenton The Cyclin-dependent Kinase Inhibitor Flavopiridol Induces Apoptosis in Multiple Myeloma Cells through Transcriptional Repression and Down-Regulation of Mcl-1 Clin. Cancer Res., November 1, 2002; 8(11): 3527 - 3538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Chatterjee, D. Honemann, S. Lentzsch, K. Bommert, C. Sers, P. Herrmann, S. Mathas, B. Dorken, and R. C. Bargou In the presence of bone marrow stromal cells human multiple myeloma cells become independent of the IL-6/gp130/STAT3 pathway Blood, October 16, 2002; 100(9): 3311 - 3318. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G Pratt Molecular aspects of multiple myeloma Mol. Pathol., October 1, 2002; 55(5): 273 - 283. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Shi, J. Gera, L. Hu, J.-h. Hsu, R. Bookstein, W. Li, and A. Lichtenstein Enhanced Sensitivity of Multiple Myeloma Cells Containing PTEN Mutations to CCI-779 Cancer Res., September 1, 2002; 62(17): 5027 - 5034. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Novak, E. Oppliger Leibundgut, J. Hager, D. Muhlematter, M. Jotterand, C. Besse, N. Leupin, D. Ratschiller, J. Papp, G. Kearsey, et al. A high-resolution allelotype of B-cell chronic lymphocytic leukemia (B-CLL) Blood, August 13, 2002; 100(5): 1787 - 1794. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ogawara, S. Kishishita, T. Obata, Y. Isazawa, T. Suzuki, K. Tanaka, N. Masuyama, and Y. Gotoh Akt Enhances Mdm2-mediated Ubiquitination and Degradation of p53 J. Biol. Chem., June 7, 2002; 277(24): 21843 - 21850. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Zhang, I. Gojo, and R. G. Fenton Myeloid cell factor-1 is a critical survival factor for multiple myeloma Blood, March 15, 2002; 99(6): 1885 - 1893. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. N. Ivanov, M. Krasilnikov, and Z.'e. Ronai Regulation of Fas Expression by STAT3 and c-Jun Is Mediated by Phosphatidylinositol 3-Kinase-AKT Signaling J. Biol. Chem., February 8, 2002; 277(7): 4932 - 4944. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-h. Hsu, Y. Shi, S. Krajewski, S. Renner, M. Fisher, J. C. Reed, T. F. Franke, and A. Lichtenstein The AKT kinase is activated in multiple myeloma tumor cells Blood, November 1, 2001; 98(9): 2853 - 2855. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Donato, J. Y. Wu, L. Zhang, H. Kantarjian, and M. Talpaz Down-regulation of interleukin-3/granulocyte-macrophage colony-stimulating factor receptor {beta}-chain in BCR-ABL+ human leukemic cells: association with loss of cytokine-mediated Stat-5 activation and protection from apoptosis after BCR-ABL inhibition Blood, May 1, 2001; 97(9): 2846 - 2853. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. S. Dalton, P. L. Bergsagel, W. M. Kuehl, K. C. Anderson, and J. L. Harousseau Multiple Myeloma Hematology, January 1, 2001; 2001(1): 157 - 177. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
WEHI231; and plasma cell lines 
subunit of PI 3'K
resulted in the failure of B-cell proliferation and development.
is an important signaling molecule in insulin-like growth factor I receptor-mediated cell transformation.
Mol Cell. Biol.
1998;18:5888-5898