|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the Department of Pathology, Leiden University
Medical Center, Leiden, The Netherlands; Department of
Pathology, Laboratory for Experimental Patho-Oncology, Josephine
Nefkens Institute, University Hospital Rotterdam, The
Netherlands.
In B-cell lymphomas, loss of human leukocyte antigen (HLA)
class I and II molecules might contribute to immune escape from CD8+ and CD4+ cytotoxic T cells, especially
because B cells can present their own idiotype. Loss of HLA expression
and the possible underlying genomic alterations were studied in 28 testicular, 11 central nervous system, and 21 nodal diffuse large
B-cell lymphomas (DLCLs), the first two sites are considered as
immune-privileged sites. The analysis included immunohistochemistry,
loss of heterozygosity analysis, and fluorescent in situ hybridization
(FISH) on interphase cells and isolated DNA fibers. Total loss of HLA-A
expression was found in 60% of the extranodal cases and in 10% of the
nodal cases (P < .01), whereas loss of HLA-DR expression
was found in 56% and 5%, respectively (P < .01). This
was accompanied by extensive loss of heterozygosity within the HLA
region in the extranodal DLCLs. In 3 cases, retention of heterozygosity
for D6S1666 in the class II region suggested a homozygous deletion.
This finding was confirmed by interphase FISH that showed homozygous
deletions in the class II genes in 11 of the 18 extranodal lymphomas
but in none of the 7 nodal DLCLs (P < .001). Mapping by
fiber FISH showed variable deletions that always included HLA-DQ and
HLA-DR genes. Hemizygous deletions and mitotic recombinations often
involving all HLA genes were found in 13 of 18 extranodal and 2 of 7 nodal lymphomas. In conclusion, a structural loss of HLA class I and II
expression might help the B-cell lymphoma cells to escape from immune attack.
(Blood. 2000;96:3569-3577) Approximately 40% of all non-Hodgkin lymphomas
(NHLs) are diffuse large B-cell lymphomas (DLCLs), and from these
approximately 40% present at extranodal sites, most commonly the
gastrointestinal tract. Both the origin and the homing of the tumor
cells play an important role in the distribution at specific nodal and
extranodal sites.1 Few DLCLs present in the testis or in
the central nervous system (CNS) that, together with the eye and ovary,
are considered as immune-privileged sites.2,3 These are
defined as sites in which immune responses do not take place or that
proceed in a manner different from other sites. Strikingly, a link
between the testis, the CNS, and the eye is supported by the
observation that testicular DLCL cells preferentially disseminate to
the contralateral testis and the CNS4 and that at least
20% of the primary CNS lymphomas disseminate to the
eye.5,6 This link suggests that, in addition to specific
homing mechanisms, tumor cells may be locally selected by topographical
differences in immune attack.
The existence of an in vivo immune response against human cancer cells
has been demonstrated for a variety of human tumors, especially virally
mediated tumors. In other neoplasias, tumor-specific antigens are
supposed to be a target of cytotoxic cells. In B-cell lymphomas, the
immunoglobulin idiotype has raised much interest as a unique target for
immunotherapy.7-9
So far, most attention has been given to the role of
CD8+ cytotoxic T cells and in consequence to loss of human
leukocyte antigen (HLA) class I expression on tumor cells as a route
for immune escape.10,11 However, recent observations
indicate that HLA class II and CD4 play an important role as well.
First, HLA class II molecules on the tumor cells may be a direct target
for CD4+ cytotoxic T cells.12-14 Second, to
mount a sufficient immune response, CD8+ cytotoxic T cells
need assistance by antigen-presenting cells (APCs) and CD4+
helper T cells.15 Because, like their normal counterparts, neoplastic B cells potentially express these molecules as well as CD40
and costimulatory molecules, they might have a dual role as APCs and
target cells for cytotoxic T cells.16 In consequence, loss
of HLA molecules on neoplastic B cells likely contributes to the
natural poor in vivo antitumor immune response and the failure of
T-cell-directed immunotherapy.10,11 Interestingly, in a
subset of aggressive B-cell lymphomas (which mainly represent DLCL),
loss of HLA class I and class II expression has been described, and
this loss correlated with extranodal disease17 and poor survival.18-20 Similarly, in a preliminary analysis of 258 DLCL, we found a relatively frequent loss of class II expression in primary extranodal DLCL. Seven DLCLs of the testis, considered as an
immune-privileged site, showed a coordinate loss of class I and class
II expression (unpublished results). At immune-privileged sites,
several factors mediate immune escape2,3; however, the
privilege is not absolute,21 implying that loss of HLA
expression on the tumor cells might additionally help them to escape
from killing by cytotoxic T cells.
The molecular mechanisms leading to loss of HLA class I molecules in
carcinomas and melanoma include defects in expression of
Tumor samples
Immunohistochemistry
Frozen sections were fixed in acetone, washed in phosphate-buffered saline, and subsequently incubated with the mouse MoAb W6/32, a pan-class I MoAb, SPV-L3 directed against DQ,29 and B8.11.2 directed against DR30 for 1 hour. For immunodetection, the same protocol was used for the paraffin sections. In each tumor, T cells, endothelial cells, macrophages, and dendritic cells served as a positive control for class I expression, whereas macrophages and dendritic cells served as a positive control for class II expression. Tumor cells were only scored negative if absolutely no staining was present as compared to a strong staining of internal control cells. If some staining was present but reactive cells stained much stronger, tumor cells were scored weakly positive. Microdissection and DNA extraction DNA was extracted according to the protocol described by Isola et al32 with some adjustments. Paraffin-embedded tissue was cut in 10-µm sections and stained with hematoxylin and eosin. Before the normal dehydration steps, the staining procedure was interrupted for microdissection. To enrich for tumor cells, selected areas that contained more than 70% tumor cells were microdissected by using a needle under direct light microscopic visualization. Normal control tissue was obtained by using the same procedure. DNA was extracted by incubation for 72 hours at 56°C in 1 mL of isolation buffer (100 mmol/L NaCl, 10 mmol/L Tris-HCl, 25 mmol/L EDTA, pH 8, 0.5% sodium dodecyl sulfate). An aliquot of proteinase K (30 µL) was added, and this step was repeated 24 and 48 hours later. DNA was isolated by using phenol-chloroform-isoamyl alcohol, 20 µg/mL glycogen, and 250 µL 7.5 mol/L ammonium acetate and precipitated with 1 mL of 100% ethanol. DNA was dissolved in Tris-EDTA (10 mmol/L Tris, 0.1 mmol/L EDTA, pH 7.6), and 1 µL was used as a template for polymerase chain reaction (PCR).Loss of heterozygosity (LOH) analysis DNA from normal and tumor-microdissected material was analyzed for LOH by PCR amplification. For most microsatellite markers, the primers have been described before,32 except for C125, MICA, TY2A, BAT2, C47, and X87 344 that were retrieved from submitted sequences (GenBank). The sequences of the latter markers are as follows: C125.R, 5'AAGTCAAGCATATCTGCCATTTGG; C125.F, 5'CCCCAAACCCTGAAACTTG; MICA.R, 5'GGTGCTTCAGAGTCATTGG; MICA.F, 5'CTTTTTTTCAGGGAAAGTGC; TY2A.R, 5'TCAAACCAATCAGGGTGGC; TY2A.F, 5'AGAAGCAGTATACAGGGGC; BAT2.R, 5'AAGGGCTTTAGGAGGTCTG; BAT.F, 5'CCAGCCTGGATAACAGAAC; C47.R, 5'TCCTCCAGGTTCATCCATG; C47.F, 5'GTCTGTCCTGCATCAAATGG; X87 344.R, 5'CTCTAACTCCTTTCATGCTGC; and X87 344.F, 5'CAAGCAGAGGAACAAAGTCA.Standard PCR amplifications33 were carried out in a
12-µL reaction volume that contained 1 µL purified template DNA, 6 pmol of each primer, 2 mmol/L dNTP-C, 0.1 mg/mL bovine serum
albumin, Taq polymerase buffer (10 mmol/L Tris-HCl, 1.5 mmol/L MgCl, 50 mmol/L KCl, 0.01% (w/v) gelatin, 0.1% Triton), 0.06 units SuperTaq polymerase (Sphaero Q, HT Biotechnology,
Cambridge, UK), and 1 µCi [ Interphase FISH From the 60 cases used in immunohistochemical and LOH studies, 14 testicular, 4 CNS, and 7 nodal DLCLs with available frozen tissue material were analyzed by interphase FISH as previously described.34 The -satellite centromeric 6-probe (D6Z1,
Oncor, Gaithersburg, MD) was biotin-16dUTP-labeled. PAC 223H1 was
isolated from the RCPI-1 Human PAC Library of the Roswell Park Cancer
Institute (Dr J. den Dunnen, Genome Technology Center, LUMC, Leiden)
with the use of a TAP1 complementary DNA (cDNA) probe.23
According to known DNA sequences, PACs 93N13 and 172K2 were directly
obtained from the RCPI-1 library (GenBank accession No: PAC 93N13,
Z84 489; PAC 172K2, Z84 814). Cosmids 619pWE1, DV19, and U16 were kindly provided by Dr H. Inoko (Tokai University School of Medicine, Kanagawa, Japan), Dr J. Trowsdale (University of Cambridge, Cambridge, UK), and Dr G. Blanck (University of South Florida, Tampa, FL), respectively. Cosmid c109K2118 derived from the ICRF flow-sorted chromosome 6 library was obtained from the Resource Center/Primary Database of the German Human Genome Project (RZPD, Berlin, Germany) and
cosmid M31A was obtained from the American Tissue Culture Center. All
cosmid and PAC probes were labeled with digoxenin-12-dUTP (ROCHE,
Basel, Switzerland) by standard nick translation. Hybridization was
performed as previously described.34 Hybridization mixture (5 µL) that contained 3 ng/µL of the centromere 6 probe combined with 3 ng/µL of each cosmid or PAC probe, 1.5 µg human Cot-1 DNA, and 3.5 µL hybridization mix (50% formamide, 10% dextran sulphate, 50 mmol/L sodium phosphate, pH 7.0, 2 × sodium chloride/sodium citrate [SSC]) was denatured for 8 minutes at 80°C and then
pre-annealed for 30 minutes at 37°C. After denaturation for 3 minutes
at 80°C, nuclei were hybridized overnight at 37°C in a moist
chamber that contained 60% formamide in 2 × SSC. Immunodetection
was performed as previously described.34
In 10 tonsils of healthy individuals, for each probe combination the signal ratio in 200 nuclei was determined; the cut-off level for homozygous or hemizygous loss was set at the average of the controls plus 3 times the SD. Hemizygous deletions were defined by the presence of a lower number of locus-specific PAC or cosmid signals relative to the number of centromere 6 signals (usually 1 locus-specific signal and 2 centromeric signals). Homozygous deletions were defined as the complete absence of PAC or cosmid signals in cells with one or more preserved centromere 6 signals. Thus, in all cases, technical artifacts were as much as possible excluded by inclusion of the centromere 6 probe in each hybridization experiment, by simultaneous hybridization with other probes for the HLA region, and by the analysis of 10 normal controls. Additionally, in all cases, cell counts were performed by two independent investigators (SAR and ESJ). Fiber FISH DNA fibers were prepared according to the halo technique.35 The probe set used to study the genomic abnormalities in extranodal lymphomas consisted of PAC clones 223H1, 93N13, and 172K2 and cosmid clones DV19 and U16 (see section "Interphase FISH"). Additional PAC clones 214F11, 122L3, 60C22, and 71I17 were isolated from the RCPI-1 Human PAC Library with the use, respectively, of a TAP1 cDNA probe (see section "Interphase FISH") or PCR-generated probes for unique sequences (GenBank) in the vicinity of microsatellite marker C47 and the genes TNXB and Hsp70. A normal "bar code" was generated on DNA fiber preparations obtained from normal peripheral blood leukocytes. The hybridization solution consisted of 30% formamide, 10% dextran sulphate, 50 mmol/L sodium phosphate, pH 7.0, 2 × SCC, 3 ng/µL of each probe, and a 50-fold excess of human Cot-1 DNA. Hybridization and immunodetection were performed as previously described.35Fluorescence microscopy Slides were analyzed with a Leica DM-RXA fluorescence microscope (Leica, Wetzlar, Germany). Images were captured with the use of a COHU 4910 series monochrome CCD camera (COHU, San Diego, CA) attached to the fluorescence microscope equipped with a PL Fluotar 100×, NA 1.30 to 0.60 objective and I3 and N2.1 filters (Leica) and Leica QFISH software (Leica Imaging Systems, Cambridge, UK). Images were processed with Paintshop Pro and Corel Draw 8.0.Statistical analysis The Fisher exact test was used for determining the significance of differences in immunohistochemistry and LOH data between extranodal and nodal DLCL cases. Statistical analysis for interphase FISH was performed with the use of the Mann-Whitney test for independent samples. Two-sided tests were used in all calculations. A P value <.05 was considered statistically significant for both tests.
Loss of HLA class I and II expression in DLCL of the testis and CNS Tissue sections of 21 nodal, 28 testicular, and 11 CNS DLCLs were stained for HLA-A and HLA-DR expression (Figure 1). Loss of HLA-A expression was observed in 61% and 55% of the primary testicular and CNS lymphomas, respectively, as compared with 10% of the primary nodal cases (difference between extranodal and nodal DLCLs significant, P < .01; Table 1). A similar trend was observed for W6/32, a well-established pan-class I antibody, which could only be applied on 25 cases of which frozen material was available. The TAP1 and 2M proteins are
essential for respectively transport and stabilization of HLA class I
molecules, and loss of expression of either results in very low or
undetectable levels of class I expression.22,23 In 7 of 12 cases with total loss of HLA class I expression as assessed for W6/32,
absence of 2M or TAP1 expression provided an explanation
for the loss of class I expression.
Significant differences between extranodal and nodal lymphomas were
also found for expression of HLA class II molecules, with 61% and 46%
of the testicular and CNS lymphomas completely lacking HLA-DR
expression compared with only 5% of the nodal DLCLs (difference between extranodal and nodal DLCLs significant; P < .05;
Table 1). Similar results were obtained with antibodies that recognized HLA-DR and HLA-DQ on frozen tissue sections (Table
2). Interestingly, 15 of the 23 cases
analyzed on paraffin sections showed a coordinate loss of both class I
and class II expression.
Increased LOH at 6p21 in DLCLs of the testis and CNS To investigate whether genetic alterations of the HLA region at 6p21.3 contributed to loss of class I or class II expression, the same 60 cases were studied by LOH analysis. Nineteen microsatellite markers on chromosome 6, including 12 markers in the HLA region, were used (Figure 2A). In contrast to allelic imbalances at 6q,36 which were equally frequent in nodal and extranodal DLCLs of our series, the testicular and the CNS lymphomas frequently showed allelic imbalance in the HLA region. The differences between these extranodal and nodal DLCLs were statistically significant for C125, TY2A, BAT2, and X8344 (Figure 2A). However, the individual markers are closely linked; therefore, allelic imbalances for adjacent markers are not independent from each other.37 Furthermore, homozygous deletions will counterbalance allelic imbalance and thus will give rise to discontinuous patterns of allelic imbalance if a set of adjacent markers are used.38
Three testicular lymphomas (T18, T20, and T25) showed retention of heterozygosity at marker D6S1666 but allelic imbalance at the flanking markers C47 and X87 344 (Figure 2B). This finding suggested the presence of a homozygous deletion at D6S1666 in the class II region, with the remaining signal resulting from contaminating normal cells in the tumor sample. Interphase FISH shows frequent homozygous deletions in the class II region and larger hemizygous deletions in DLCLs of the testis and CNS To evaluate homozygous deletion of HLA class II genes, we applied two-color FISH on isolated nuclei of all cases with available frozen tissue material (ie, 14 testicular, 4 CNS, and 7 nodal lymphomas). Six digoxigenin-labeled PAC and cosmid clones specific for the HLA region, each in combination with a biotin-labeled centromere 6 probe, were used (Table 2; Figure 3A). The panel consisted of 3 PAC clones specific for the class II region, including PAC 93N13 that contains marker D6S1666 and covers the DQA1 and DRB1 genes. For each probe combination, the cut-off level was determined as the average plus 3 times the SD as assessed on 10 normal tonsils (Table 2, homozygous and hemizygous deletion columns). For the detection of homozygous deletions (loss of all HLA allele-specific signals in combination with retention of chromosome 6 centromeric signals), this cut-off level varied between 0% and 5.8%. To exclude the possibility that hybridization artifacts accounted for loss of signals, we fixed the cut-off level for homozygous deletion at more than 6% cells. With the use of this threshold, the homozygous deletion was confirmed in all 3 cases, 64.5% (T18), 59.5% (T20), and 60.5% (T25) of the cells showing loss of both allelic signals for PAC 93N13 (Table 2; Figures 3B-D). In fact, PAC 93N13 was homozygously lost in 8 of 14 testicular (T2, T11, T14, T16, T18, T19, T20, and T25) and 2 of 4 CNS lymphomas (C1 and C9) but in none of the nodal cases (difference between extranodal and nodal DLCLs significant; P < .001; Table 2). Similarly, PAC 172K2 that covers the HLA-DRA gene was homozygously lost in respectively 7 of 14 testicular DLCLs (T2, T11, T13, T14, T16, T18, and T25) and in the same 2 CNS lymphomas (C1 and C9) but in none of 7 nodal lymphomas (difference between extranodal and nodal DLCLs significant, P < .001; Table 2). Two lymphomas (T18 and C9) showed extension of the homozygous deletion to 223H1, a PAC that covers TAP1 (Table 2). In case C9, a similar fraction (ie, 30%, 44%, and 52%) of the cells showed a homozygous deletion for probes 223H1, 93N13, and 172K2, whereas, in T18, 223H1 was deleted only in a small fraction (7%) of the cells.
The percentage of cells with homozygous deletion varied between 7.0% and 71.5%. The occasionally low percentages of cells with homozygous deletion might have been caused by either the presence of many reactive cells in the frozen tissue sample or by the presence of tumor heterogeneity. The first could be the case in T16, T19, and C1 in which maximally 32.5% of all cells showed any abnormality (loss of 1 or 2 spots; see Table 2). Tumor heterogeneity was likely present in cases T11, T13, T16, T18, and T25, showing variable percentages of cells with loss of one or both HLA allele specific signals (Table 2). For instance, in case T11, a small fraction (9% to 15.5%) of all cells contained a homozygous deletion for probes 93N13 and 172K2, whereas a larger fraction (35% to 58%) contained a hemizygous deletion covered by the probes 93N13, 172K2, and M31A (Table 2). For the hemizygous deletions (loss of one HLA-specific signal while both centromere signals were retained), the individual cut-off levels on the normal tonsils varied between 8.5% and 20.4%. With the use of a general cut-off level of more than 21%, 7 of 18 extranodal DLCLs and 1 of 7 nodal cases (N4) contained a hemizygous deletion covered by PAC 93N13. Similarly, 9 of 18 extranodal and 1 of 7 nodal DLCLs contained a hemizygous deletion covered by PAC 172K2. In all but one case (T3), these deletions were part of much larger hemizygous deletions also involving the region that contains the HLA-DP genes and/or the HLA class III and even the HLA class I region (see below). The percentage of cells with hemizygous deletions varied between 24% and 79.5% (Table 2). We combined all data for the HLA class II region covered by PAC 93N13 and/or 172K2 and found 4 of 18 extranodal cases contained exclusively homozygous deletions, 2 cases showed only hemizygous deletions, and 7 cases showed combined homo- and hemizygous deletions. In contrast, only 2 of 7 nodal DLCLs contained a small hemizygous deletion in this region. HLA class I and class III genes were mainly affected by large hemizygous deletions (Table 2). Only case T25 contained 12% of cells with loss of both signals for C109K2118 that covers HLA-A, suggesting a small tumor subclone with a homozygous deletion in the class I region. With respect to the class III region covered by M31A, 9 of 18 extranodal versus none of 7 nodal DLCLs contained hemizygous deletions. For the class I region covered by C109K2118, these numbers were 8 of 18 extranodal versus none of 7 nodal DLCLs. Aneuploidy of chromosome 6 was observed in 7 cases, including one nodal case. Five centromeric signals were seen in T3 and C11 (data not shown). T20 showed monosomy for chromosome 6. T23 showed trisomy 6 and loss of one allele on LOH analysis, indicating that 1 of the 2 chromosomes was lost and the other was present in triplicate. In addition, T18, T25, and N8 contained subclones with aneuploidy for chromosome 6 (Figure 3). DNA fiber FISH mapping of the homozygous deletions in the HLA-DR and -DQ region To determine the size of the deletions of each allele, 10 cases were also analyzed by high-resolution DNA fiber FISH with the use of a probe set covering approximately 900 kilobase (kb) of the class II region (Figure 4). Within the normal HLA class II region, the genomic organization of the different DR haplotypes differs in size between HLA-DRB1 and HLA-DRA. The size of DR 4, 7, and 9 haplotypes is approximately 110 kb, and DR 1, 2, and 10 haplotypes are 30 kb larger compared with the size of DR 3, 5, and 6 haplotypes.39 To determine these polymorphisms, HLA-DR and -DQ typing of the patients was performed with the use of PCR and oligo-hybridization according to standard protocols (courtesy Prof F.H.J. Claas, Dept. of Immunohematology, LUMC).40,41
In cases T11 and T13, no abnormal fibers were observed, likely because of the too low percentage of aberrant cells (15.5% and 16% as determined by interphase FISH for 172K2; Table 2). In all other 8 cases (T2, T14, T16, T18, T19, T20, T25, and C9), the deletions were confirmed (Figure 4). In all cases except T16, one allele was affected by a deletion involving the entire probe set. In 2 cases (C9 and T18), the deletion of the other allele involved all functional HLA-DQ and HLA-DR genes, and the other HLA-DQ genes outside the deletion are pseudogenes. Furthermore, in 2 cases (T2 and T14), the deletion involved HLA-DQA1 and all HLA-DR genes; in 3 cases (T19, T20, and T25), it involved both HLA-DQ genes and a part of the HLA-DR genes. In one case (T16), the allele with the smallest deletion involved only the DQB1, DQA1, and DRB1 genes covered by cosmid DV19 and PAC 93N13, whereas the other allele had a deletion involving DQA1 and all DR genes. In cases T16 and T25, interphase FISH showed homozygous deletion of the area covered by PAC 93N13 and in a small fraction (8% and 11.5%) also of the area covered by PAC 172K2. Probably, because of the relative insensitivity, this deletion of PAC 172K2 was not detected by using fiber FISH. As shown in Figure 4, the deletions were relatively variable at the telomeric side but never extended to the class III genes covered by PAC71 117. In T20 (HLA-DR typed DR6) with monosomy 6 (as detected by interphase FISH for the centromere of chromosome 6), a deletion of PAC 93N13 and cosmid U16 was detected by fiber FISH. However, PAC 172K2 was not on the same fiber as PAC 223H1, suggesting a chromosomal breakpoint in addition to the deletion. This finding was in agreement with the absence of co-localization of these PACs as determined by interphase FISH (not shown). Correlation between homozygous deletions and loss of HLA class II expression Table 3 shows the association between the homo- and hemizygous deletions in the class II region and the loss of HLA-DR and HLA-DQ expression as assessed on frozen tissue sections. Most importantly, in 8 of 15 cases without HLA-DQ expression, homozygous deletions of PAC 93N13 were present, and in 3 additional cases a hemizygous deletion was found. In 4 cases, we did not find any gross genetic alterations. Similarly, 10 of 14 DLCL cases with loss of HLA-DR expression showed homozygous deletions of PAC 172K2, whereas in 2 cases extensive hemizygous deletions were present. In only 2 DLCL cases, we did not find any explanation for loss of expression.
We show that homozygous deletions within the HLA class II region of primary testicular and CNS lymphomas account for an important mechanism of loss of HLA-DR and HLA-DQ expression. In addition, in most cases large hemizygous deletions and/or mitotic recombination involved the entire HLA region. In solid tumors and corresponding cell lines, investigators have mainly
focused on loss of HLA class I expression as a route for tumor cells to
escape killing by class I-restricted CD8+ cytotoxic T
cells.10,11 According to these studies using pan-class I,
locus- or allele-specific antibodies, between 39% and 88% of the
epithelial tumors are completely or partially deficient in HLA class I
expression. Mainly on the basis of studies of cell lines, distinct
phenotypes can be related to separate molecular mechanisms:
(a) absence or strongly reduced class I
expression is often attributed to the absence of In our series of primary DLCLs of the testis and CNS, aberrant class I
expression was very frequent with more than half of these lymphomas
showing complete loss of HLA-A expression. Our data are in line with
previous studies49,50 that show loss of class I expression
in 6% to 30% of aggressive B-cell lymphomas. In those studies, loss
of expression was associated with extranodal presentation, and also
with a relatively poor prognosis. In the present study, this loss could
be explained by absence of So far, little attention has been given to loss of HLA class II expression in cancer, probably because class II molecules are not constitutively expressed on normal epithelial cells. We showed loss of HLA class II expression in approximately half of the testicular and CNS lymphomas but in only 5% of the nodal cases. Previously, loss of HLA class II expression has been reported in DLCLs,18-20 especially those presenting at extranodal sites.17 In primary testicular and CNS lymphomas, homozygous deletions are a very important mechanism for loss of class II expression because more than half of these DLCLs contained such homozygous deletions (Table 2). In addition to these homozygous deletions, several class II negative DLCLs showed large hemizygous deletions. Similar to the situation in the class I region, other structural abnormalities, such as point mutations or small homozygous deletions undetectable by FISH, or methylation of the promoter region might have caused loss of expression of the other allele. Of note, several cases showed tumor heterogeneity with different subpopulations that contain homo- and hemizygous deletions. In few cases, this was also represented by heterogeneous staining pattern for HLA-DR and -DQ. The homozygous deletions within the HLA class II region covered a minimal region of approximately 100 kb and always included the HLA-DQA1 and HLA-DRB1 genes (Figure 4). Because HLA-DQB2, -DQA2, and -DQB3 are pseudogenes, loss of HLA-DQA1 and in consequence the inability to form a heterodimer with HLA-DQB1 is sufficient to explain the total loss of expression of HLA-DQ. The situation is almost similar but more complex for HLA-DR, because the smallest homozygously deleted areas involved PAC 93N13 that contains HLA-DRB1 and a variable area downstream of this PAC that contains DRB3-5, the other functional alleles.39 The presence of a length of polymorphism in this area and the lack of appropriate probes for this polymorphic region hampered the exact deletion mapping within this region. However, it should be noted that at least 4 cases showed homozygous deletion of all HLA-DR genes. Interestingly, in Epstein-Barr virus-transformed irradiated human B-lymphoblastoid cell lines selected for absence of HLA class II expression, similar homozygous deletions within the HLA class II region have been observed.51 In one cell line, the homozygously deleted region only contained the HLA-DRB1 and HLA-DQA1 genes, whereas in two other cell lines the homozygous deletion also included the HLA-DQB1 gene. No other genes have been identified in the recently published complete sequence of this region.52 This suggests that the HLA-DR and HLA-DQ genes are the real target of the deletion and that loss of these genes results in a growth advantage through immune selection. Furthermore, in none of the cases the class III region was affected, suggesting that genes essential for B-cell lymphomagenesis reside in this region. What could be the implication of loss of HLA class II expression in lymphoma cells? HLA class I expression on tumor cells is essential for killing by CD8+ cytotoxic T cells. However, recent studies also suggest an important role for cytotoxic CD4+ effector T cells and thus for HLA class II expression on tumor cells.12-14 Additionally, cytotoxic CD8+ cells are only effective after activation by CD4+ helper T cells (ie when both CD8+ and CD4+ cells recognize tumor-specific antigenic determinants on the same APCs).16,53,54 Like normal B cells, neoplastic B cells may function as APCs as they can express both class I and II molecules, CD40, and costimulatory molecules.55 This is supported by the observation that murine lymphoma cells can present their own idiotype to CD4+ T cells.56 In consequence, loss of both HLA class I and II expression may result in an impaired activation of cytotoxic CD8+ T cells and may facilitate the growth of the tumor cells. Tumor cells growing in immune-privileged sites, such as the CNS, testis, and the eye, experience a relative protection from immune attack. Various mechanisms may account for this effect, including the presence of an organ-blood barrier and the specific microenvironment with local production of immunosuppressive neuropeptides and cytokines2,3 as well as expression of Fas ligand on preexisting cells.2 However, immune protection at immune-privileged sites is not absolute as inoculated tumors are eventually killed by adoptively transferred cytotoxic T cells.21 This suggests that not only host factors but also tumor cell characteristics, such as loss of HLA class I and II expression, contribute to the phenomenon of immune privilege. Interestingly, primary DLCLs of the CNS preferentially express the immunoglobulin heavy chain gene V4-34.57-60 The V4-34 gene product, which is implied in several autoimmune disorders, might, therefore, function as a specific-tumor antigen in these lymphomas, and one could speculate that the lack of presentation in HLA molecules might give the tumor cells a selective immune privilege. Strategies for the treatment of B-cell lymphomas are currently focusing on T-cell-mediated antitumor responses based on recognition of tumor-specific antigens.9 Our study shows that assessment of the HLA expression status and irreversible HLA gene defects is important to choose the optimal therapeutic regimen as the extranodal lymphomas we describe here likely will not be susceptible to T-cell-mediated immunotherapy.
Submitted January 31, 2000; accepted July 26, 2000.
Supported by grant RUL99-1997 from the Dutch Cancer Society.
S.A.R. and E.S.J. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Sietske A Riemersma, Department of Pathology, (L1-Q), Leiden University Medical Center, Albinusdreef 2, 2333 ZA Leiden, The Netherlands; e-mail: s.a.riemersma{at}lumc.nl.
1.
Drillenburg P, Pals ST.
Cell adhesion receptors in lymphoma dissemination.
Blood.
2000;95:1900-1910 2. Ferguson TA, Griffith TS. A vision of cell death: insights into immune privilege. Immunol Rev. 1997;156:167-184[Medline] [Order article via Infotrieve]. 3. Owens T, Renno T, Taupin V, Krakowski M. Inflammatory cytokines in the brain: does the CNS shape immune responses? Immunol Today. 1994;15:566-571[Medline] [Order article via Infotrieve]. 4. Touroutoglou N, Dimopoulos MA, Younes A, et al. Testicular lymphoma: late relapses and poor outcome despite doxorubicin-based therapy. J Clin Oncol. 1995;13:1361-1367[Abstract]. 5. Hochberg FH, Miller DC. Primary central nervous system lymphoma. J Neurosurg. 1988;68:835-853[Medline] [Order article via Infotrieve]. 6. Herrlinger U. Primary CNS lymphoma: findings outside the brain. J Neurooncol. 1999;43:227-230[Medline] [Order article via Infotrieve]. 7. Kwak LW, Campbell MJ, Czerwinski DK, Hart S, Miller RA, Levy R. Induction of immune responses in patients with B-cell lymphoma against the surface-immunoglobulin idiotype expressed by their tumors. N Engl J Med. 1992;327:1209-1215[Abstract].
8.
Nelson EL, Li X, Hsu FJ, et al.
Tumor-specific, cytotoxic T-lymphocyte response after idiotype vaccination for B-cell, non-Hodgkin's lymphoma.
Blood.
1996;88:580-589 9. Schultze JL, Nadler LM. T-cell mediated immunotherapy for B-cell lymphoma. J Mol Med. 1999;77:322-331[Medline] [Order article via Infotrieve]. 10. Garrido F, Ruiz Cabello F, Cabrera T, et al. Implications for immunosurveillance of altered HLA class I phenotypes in human tumours. Immunol Today. 1997;18:89-95[Medline] [Order article via Infotrieve]. 11. Ruiz Cabello F, Garrido F. HLA and cancer: from research to clinical impact. Immunol Today. 1998;19:539-542[Medline] [Order article via Infotrieve].
12.
Ohminami H, Yasukawa M, Kaneko S, et al.
Fas-independent and nonapoptotic cytotoxicity mediated by a human CD4+ T-cell clone directed against an acute myelogenous leukemia-associated DEK-CAN fusion peptide.
Blood.
1999;93:925-935
13.
Yasukawa M, Ohminami H, Arai J, Kasahara Y, Ishida Y, Fujita S.
Granule exocytosis, and not the Fas/Fas ligand system, is the main pathway of cytotoxicity mediated by alloantigen-specific CD4+ as well as CD8+ cytotoxic T lymphocytes in humans.
Blood.
2000;95:2352-2355
14.
Falkenburg JH, Wafelman AR, Joosten P, et al.
Complete remission of accelerated phase chronic myeloid leukemia by treatment with leukemia-reactive cytotoxic T lymphocytes.
Blood.
1999;94:1201-1208
15.
Toes RE, Ossendorp F, Offringa R, Melief CJ.
CD4 T-cells and their role in antitumor immune responses.
J Exp Med.
1999;189:753-756
16.
Keene JA, Forman J.
Helper activity is required for the in vivo generation of cytotoxic T lymphocytes.
J Exp Med.
1982;155:768-782 17. Momburg F, Herrmann B, Moldenhauer G, Moller P. B-cell lymphomas of high-grade malignancy frequently lack HLA-DR, -DP and -DQ antigens and associated invariant chain. Int J Cancer. 1987;40:598-603[Medline] [Order article via Infotrieve]. 18. Slymen DJ, Miller TP, Lippman SM, et al. Immunobiologic factors predictive of clinical outcome in diffuse large-cell lymphoma. J Clin Oncol. 1990;8:986-993[Abstract]. 19. Guy K, Krajewski AS, Dewar AE. Expression of MHC class II antigens in human B-cell leukemia and non-Hodgkin's lymphoma. Br J Cancer. 1986;53:161-173[Medline] [Order article via Infotrieve]. 20. O'Keane JC, Mack C, Lynch E, Harrington D, Neiman RS. Prognostic correlation of HLA-DR expression in large cell lymphoma as determined by LN3 antibody staining. An Eastern Cooperative Oncology Group (ECOG) study. Cancer. 1990;66:1147-1153[Medline] [Order article via Infotrieve].
21.
Schurmans LR, den Boer AT, van der Voort EI, et al.
Successful immunotherapy of an intraocular tumor in mice.
Cancer Res.
2000;59:5250-5254 22. D'Urso CM, Wang ZG, Cao Y, Tatake R, Zeff RA, Ferrone S. Lack of HLA class I antigen expression by cultured melanoma cells FO-1 due to a defect in B2m gene expression. J Clin Invest. 1991;87:284-292. 23. Spies T, DeMars R. Restored expression of major histocompatibility class I molecules by gene transfer of a putative peptide transporter. Nature. 1991;351:323-324[Medline] [Order article via Infotrieve].
24.
Koopman LA, van der Slik A, Giphart MJ, Fleuren GJ.
Human leukocyte antigen class I gene mutations in cervical cancer.
J Natl Cancer Inst.
2000;91:1669-1677 25. Isaacson PG. The revised European-American lymphoma (REAL) classification [editorial]. Clin Oncol (R Coll Radiol). 1995;7:347-348[Medline] [Order article via Infotrieve].
26.
Kramer MH, Hermans J, Parker J, et al.
Clinical significance of BCL2 and P53 protein expression in diffuse large B-cell lymphoma: a population based study.
J Clin Oncol.
1996;14:2131-2138
27.
de Boer CJ, Schuuring E, Dreef E, et al.
Cyclin D1 protein analysis in the diagnosis of mantle cell lymphoma.
Blood.
1995;86:2715-2723
28.
Cromme FV, Airey J, Heemels MT, et al.
Loss of transporter protein, encoded by the TAP-1 gene, is highly correlated with loss of HLA expression in cervical carcinomas.
J Exp Med.
1994;179:335-340 29. Watson AJ, DeMars R, Trowbridge IS, Bach FH. Detection of a novel human class II HLA antigen. Nature. 1983;304:358-361[Medline] [Order article via Infotrieve]. 30. Rebai N, Malissen B, Pierres M, Accolla RS, Corte G, Mawas C. Distinct HLA-DR epitopes and distinct families of HLA-Dr molecules defined by 15 monoclonal antibodies (mAb) either anti-DR or allo-anti-Iak cross-reacting with human DR molecule. I. Cross-inhibition studies of mAB-cell surface fixation and differential binding of mAb to detergent-solubilized HLA molecules immobilized to a solid phase by a first mAb. Eur J Immunol. 1983;13:106-111[Medline] [Order article via Infotrieve]. 31. Isola J, DeVries S, Chu L, Ghazvini S, Waldman F. Analysis of changes in DNA sequence copy number by comparative genomic hybridization in archival paraffin-embedded tumor samples. Am J Pathol. 1994;145:1301-1308[Abstract]. 32. Foissac A, Cambon Thomsen A. Microsatellites in the HLA region: 1998 update. Tissue Antigens. 1998;52:318-352[Medline] [Order article via Infotrieve]. 33. Kersemaekers AM, Kenter GG, Hermans J, Fleuren GJ, van de Vijver MJ. Allelic loss and prognosis in carcinoma of the uterine cervix. Int J Cancer. 1998;79:411-417[Medline] [Order article via Infotrieve]. 34. Vaandrager JW, Schuuring E, Raap AK, Philippo K, Kleiverda KK, Kluin PM. Interphase FISH detection of BCL2 rearrangement in follicular lymphoma using breakpoint-flanking probes. Genes Chromosomes Cancer. 2000;27:85-94[Medline] [Order article via Infotrieve].
35.
Vaandrager JW, Schuuring E, Zwikstra E, et al.
Direct visualization of dispersed 11q13 chromosomal translocations in mantle cell lymphoma by multicolor DNA fiber fluorescence in situ hybridization.
Blood.
1996;88:1177-1182
36.
Johansson B, Mertens F, Mitelman F.
Cytogenetic evolution patterns in non-Hodgkin's lymphoma.
Blood.
1995;86:3905-3914 37. Newton MA, Gould MN, Reznikoff CA, Haag JD. On the statistical analysis of allelic-loss data. Stat Med. 1998;17:1425-1445[Medline] [Order article via Infotrieve]. 38. Cairns P, Polascik TJ, Eby Y, et al. Frequency of homozygous deletion at p16/CDKN2 in primary human tumours. Nat Genet. 1995;11:210-212[Medline] [Order article via Infotrieve]. 39. Dunham I, Sargent CA, Dawkins RL, Campbell RD. An analysis of variation in the long-range genomic organization of the human major histocompatibility complex class II region by pulsed-field gel electrophoresis. Genomics. 1989;5:787-796[Medline] [Order article via Infotrieve]. 40. Olerup O, Zetterquist H. HLA-DR typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours: an alternative to serological DR typing in clinical practice including donor-recipient matching in cadaveric transplantation. Tissue Antigens. 1992;39:225-235[Medline] [Order article via Infotrieve]. 41. Kennedy LJ, Poulton KV, Dyer PA, Ollier WE, Thomson W. Definition of HLA-C alleles using sequence-specific oligonucleotide probes (PCR-SSOP). Tissue Antigens. 1995;46:187-195[Medline] [Order article via Infotrieve]. 42. Koopman LA, Mulder A, Corver WE, et al. HLA class I phenotype and genotype alterations in cervical carcinomas and derivative cell lines. Tissue Antigens. 1998;51:623-636[Medline] [Order article via Infotrieve]. 43. Torres MJ, Ruiz Cabello F, Skoudy A, et al. Loss of an HLA haplotype in pancreas cancer tissue and its corresponding tumor derived cell line. Tissue Antigens. 1996;47:372-381[Medline] [Order article via Infotrieve]. 44. Browning M, Petronzelli F, Bicknell D, et al. Mechanisms of loss of HLA class I expression on colorectal tumor cells. Tissue Antigens. 1996;47:364-371[Medline] [Order article via Infotrieve].
45.
Versteeg R, Kruse Wolters KM, Plomp AC, et al.
Suppression of class I human histocompatibility leukocyte antigen by c-myc is locus specific.
J Exp Med.
1989;170:621-635 46. Peltenburg LT, Schrier PI. Transcriptional suppression of HLA-B expression by c-myc is mediated through the core promoter elements. Immunogenetics. 1994;40:54-61[Medline] [Order article via Infotrieve]. 47. Soong TW, Hui KM. Locus-specific transcriptional control of HLA genes. J Immunol. 1992;149:2008-2020[Abstract]. 48. Browning MJ, Krausa P, Rowan A, et al. Loss of human leukocyte antigen expression on colorectal tumor cell lines: implications for anti-tumor immunity and immunotherapy. J Immunother. 1993;14:163-168. 49. Moller P, Lammler B, Herrmann B, Otto HF, Moldenhauer G, Momburg F. The primary mediastinal clear cell lymphoma of B-cell type has variable defects in MHC antigen expression. Immunology. 1986;59:411-417[Medline] [Order article via Infotrieve]. 50. Amiot L, Onno M, Lamy T, et al. Loss of HLA molecules in B lymphomas is associated with an aggressive clinical course. Br J Haematol. 1998;100:655-663[Medline] [Order article via Infotrieve]. 51. DeMars R, Chang CC, Shaw S, Reitnauer PJ, Sondel PM. Homozygous deletions that simultaneously eliminate expressions of class I and class II antigens of EBV-transformed B-lymphoblastoid cells. I. Reduced proliferative responses of autologous and allogeneic T-cells to mutant cells that have decreased expression of class II antigens. Hum Immunol. 1984;11:77-97[Medline] [Order article via Infotrieve]. 52. Complete sequence and gene map of a human major histocompatibility complex. The MHC sequencing consortium. Nature. 2000;401:921-923.
53.
Ossendorp F, Mengede E, Camps M, Filius R, Melief CJ.
Specific T helper cell requirement for optimal induction of cytotoxic T lymphocytes against major histocompatibility complex class II negative tumors.
J Exp Med.
1998;187:693-702
54.
Bennett SR, Carbone FR, Karamalis F, Miller JF, Heath WR.
Induction of a CD8+ cytotoxic T lymphocyte response by cross-priming requires cognate CD4+ T-cell help.
J Exp Med.
1997;186:65-70
55.
Dorfman DM, Schultze JL, Shahsafaei A, et al.
In vivo expression of B7-1 and B7-2 by follicular lymphoma cells can prevent induction of T-cell anergy but is insufficient to induce significant T-cell proliferation.
Blood.
1997;90:4297-4306
56.
Weiss S, Bogen B.
B-lymphoma cells process and present their endogenous immunoglobulin to major histocompatibility complex-restricted T-cells.
Proc Natl Acad Sci U S A.
1989;86:282-286
57.
Montesinos-Rongen M, Kuppers R, Schluter D, et al.
Primary central nervous system lymphomas are derived from germinal-center B-cells and show a preferential usage of the V4-34 gene segment.
Am J Pathol.
1999;155:2077-2086
58.
Thompsett AR, Ellison DW, Stevenson FK, Zhu D.
V(H) gene sequences from primary central nervous system lymphomas indicate derivation from highly mutated germinal center B-cells with ongoing mutational activity.
Blood.
1999;94:1738-1746
59.
Silberstein LE, Jefferies LC, Goldman J, et al.
Variable region gene analysis of pathologic human autoantibodies to the related i and I red blood cell antigens.
Blood.
1991;78:2372-2386
60.
Baranzini SE, Jeong MC, Butunoi C, Murray RS, Bernard CC, Oksenberg JR.
B-cell repertoire diversity and clonal expansion in multiple sclerosis brain lesions.
J Immunol.
1999;163:5133-5144
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  H.-W. Bernd, M. Ziepert, C. Thorns, W. Klapper, H.-H. Wacker, M. Hummel, H. Stein, M.-L. Hansmann, G. Ott, A. Rosenwald, et al. Loss of HLA-DR expression and immunoblastic morphology predict adverse outcome in diffuse large B-cell lymphoma - analyses of cases from two prospective randomized clinical trials Haematologica, November 1, 2009; 94(11): 1569 - 1580. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Montesinos-Rongen, R. Siebert, and M. Deckert Primary lymphoma of the central nervous system: just DLBCL or not? Blood, January 1, 2009; 113(1): 7 - 10. [Full Text] [PDF]
|
|
|
|
 |
|
 K.-C. Chang, G.-C. Huang, D. Jones, and Y.-H. Lin Distribution Patterns of Dendritic Cells and T Cells in Diffuse Large B-Cell Lymphomas Correlate with Prognoses Clin. Cancer Res., November 15, 2007; 13(22): 6666 - 6672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Booman, J. Douwes, M.-C. Legdeur, J. van Baarlen, E. Schuuring, and P. Kluin From brain to testis: immune escape and clonal selection in a B cell lymphoma with selective out-growth in two immune sanctuariesy Haematologica, June 1, 2007; 92(6): e69 - e71. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H Veelken, S Vik Dannheim, J Schulte Moenting, U. Martens, J Finke, and A Schmitt-Graeff Immunophenotype as prognostic factor for diffuse large B-cell lymphoma in patients undergoing clinical risk-adapted therapy Ann. Onc., May 1, 2007; 18(5): 931 - 939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Roberts, G. Wright, A. R. Rosenwald, M. A. Jaramillo, T. M. Grogan, T. P. Miller, Y. Frutiger, W. C. Chan, R. D. Gascoyne, G. Ott, et al. Loss of major histocompatibility class II gene and protein expression in primary mediastinal large B-cell lymphoma is highly coordinated and related to poor patient survival Blood, July 1, 2006; 108(1): 311 - 318. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Booman, J. Douwes, A. M. Glas, S. A. Riemersma, E. S. Jordanova, K. Kok, A. Rosenwald, D. de Jong, E. Schuuring, and P. M. Kluin Mechanisms and Effects of Loss of Human Leukocyte Antigen Class II Expression in Immune-Privileged Site-Associated B-Cell Lymphoma. Clin. Cancer Res., May 1, 2006; 12(9): 2698 - 2705. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Rimsza, R. A. Roberts, E. Campo, T. M. Grogan, S. Bea, I. Salaverria, A. Zettl, A. Rosenwald, G. Ott, H. K. Muller-Hermelink, et al. Loss of major histocompatibility class II expression in non-immune-privileged site diffuse large B-cell lymphoma is highly coordinated and not due to chromosomal deletions Blood, February 1, 2006; 107(3): 1101 - 1107. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Rimsza, R. A. Roberts, T. P. Miller, J. M. Unger, M. LeBlanc, R. M. Braziel, D. D. Weisenberger, W. C. Chan, H. K. Muller-Hermelink, E. S. Jaffe, et al. Loss of MHC class II gene and protein expression in diffuse large B-cell lymphoma is related to decreased tumor immunosurveillance and poor patient survival regardless of other prognostic factors: a follow-up study from the Leukemia and Lymphoma Molecular Profiling Project Blood, June 1, 2004; 103(11): 4251 - 4258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Demanet, A. Mulder, V. Deneys, M. J. Worsham, P. Maes, F. H. Claas, and S. Ferrone Down-regulation of HLA-A and HLA-Bw6, but not HLA-Bw4, allospecificities in leukemic cells: an escape mechanism from CTL and NK attack? Blood, April 15, 2004; 103(8): 3122 - 3130. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Zucca, A. Conconi, T.I. Mughal, A.H. Sarris, J.F. Seymour, U. Vitolo, R. Klasa, M. Ozsahin, G.M. Mead, M.A. Gianni, et al. Patterns of Outcome and Prognostic Factors in Primary Large-Cell Lymphoma of the Testis in a Survey by the International Extranodal Lymphoma Study Group J. Clin. Oncol., January 1, 2003; 21(1): 20 - 27. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. S. Robetorye, S. D. Bohling, J. W. Morgan, G. C. Fillmore, M. S. Lim, and K. S. J. Elenitoba-Johnson Microarray Analysis of B-Cell Lymphoma Cell Lines with the t(14;18) J. Mol. Diagn., August 1, 2002; 4(3): 123 - 136. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
