|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMATOPOIESIS
From the Division of Hematology-Oncology, Weill
Medical College of Cornell University, Ithaca, NY; the Bioengineering
Program, Hofstra University, Hempstead, NY; Oncology Research, Novartis
Pharma AG, Basel, Switzerland; and the Division of Developmental
Hematopoiesis, Sloan Kettering Cancer Center, New York, NY.
Despite the discovery of thrombopoietin (TPO) and its contribution
to megakaryocytopoiesis, the exact mechanisms and sites of platelet
production are unknown. It has been shown that mature megakaryocytes
(MKs) functionally express the stromal-derived factor 1 (SDF-1)
receptor, CXCR4. SDF-1-induced migration of mature MKs through
endothelial cell layers results in increased platelet production.
Because the migration of polyploid MKs from the bone marrow
microenvironment requires remodeling of the perivascular extracellular
matrix, it was hypothesized that mature polyploid MKs may express
matrix metalloproteinases (MMPs), facilitating their exit into the bone
marrow extravascular space. In this report, it is demonstrated that
SDF-1 induces the expression and release of gelatinase B (MMP-9) by
purified mature polyploid human MKs and an adeno-CXCR4-infected
megakaryocytic cell line. Neutralizing antibody to MMP-9, but not
MMP-2, blocked SDF-1-induced migration of MKs through reconstituted
basement membrane, suggesting that expression of MMP-9 is critical for
MK migration. Incubation of mature MKs with a synthetic MMP inhibitor,
5-phenyl-1,10-phenanthrolene, resulted in the inhibition of platelet
formation, suggesting that the expression of MMPs is not only critical
for megakaryocyte migration but also for subsequent platelet release.
Confirming these results, adeno-SDF-1 injection into normal mice
resulted in increased platelet counts, a process that could be blocked by a synthetic MMP inhibitor. These results suggest mobilization of MKs
involves sequential expression and activation of chemokine receptors
such as CXCR4, MMP-9, followed by transendothelial migration. MMP
inhibitors may have potential use in the treatment of thrombotic and
myeloproliferative disorders.
(Blood. 2000;96:4152-4159) Thrombopoietin (TPO) has been shown to promote
megakaryocyte (MK) proliferation and maturation and platelet
formation.1-3 Nonetheless, the exact mechanisms and sites
of platelet formation are not well defined. The development of MKs can
be divided into 2 distinct stages or compartments. The initial stage of
MK development involves sequential commitment and proliferation of
CD34+ hematopoietic stem cells into proliferating
megakaryoblasts, a process referred to as megakaryocytopoiesis. The
second phase of MK development comprises a population of
morphologically identifiable mature, large polyploid MKs that undergo
nuclear endoreplication and ultimately fragment into functional
platelets. TPO has been shown to regulate MK proliferation, maturation,
and endoreplication and to directly induce platelet formation in
vitro.4,5 TPO knockout mice have platelet counts 85%
lower than those of normal mice.6 However, despite low
platelet counts, these mice do not bleed, and they have morphologically
normal MKs and platelets.7 These data suggest that other
factors may cooperate with TPO to modulate platelet production. Several
studies have shown that mature polyploid MKs are localized to the
extracellular space of bone marrow endothelial cells
(BMECs).8-11 Electron microscopy studies have shown that
these polyploid MKs transverse through BMECs12 and travel
to the lungs, where they release platelets within the pulmonary
capillaries.13-15
In search of chemokines that may mediate transendothelial migration of
MKs, we and others have discovered that mature MKs express the
chemokine receptor CXCR4.16-18 Stromal-derived factor 1 (SDF-1), the natural ligand for CXCR4, promotes the transendothelial migration of MKs, enhancing platelet production.16
Nevertheless, it is unclear how MKs transmigrate through the basement
membrane, which surrounds the BMEC layer. We hypothesized that such
movement may involve the production of soluble and membrane-bound
proteinases capable of digesting the basement membrane.
Matrix metalloproteinases (MMPs) comprise a family of zinc-binding
proteins that degrade proteins within the extracellular matrix.19-21 Of the known MMPs, MMP-2 and -9 degrade
collagen IV, one of the main components of the basement membrane, and
are thus relevant to MK transendothelial migration. Guinea pig bone
marrow MKs and activated platelets have been found to secrete
collagenases,22,23 and isolated human platelet releasate
has been shown to contain a 72-kd gelatinase
(pro-MMP-2).24 The release of pro-MMP-2 correlated with
positive in vitro platelet aggregation. With regard to the tissue
inhibitors of metalloproteinases (TIMPs), TIMP-1 and -2 have been
detected on human MKs and platelets.25,26 To date there
are no reports of human MK MMP functional activity, yet MKs have been
shown to actively migrate to the bone marrow vascular sinus
spaces8-11 and to travel to the lungs, where they release platelets.
In this report, we show for the first time that purified mature
polyploid human MKs produce and secrete MMP-9 and that this metalloproteinase is necessary for in vitro MK migration through the
basement membrane in response to a chemoattractant stimulus such as
SDF-1. MMP enzymatic activity is also required for subsequent platelet
formation. Furthermore, administration of a synthetic MMP inhibitor
(MMPi) to normal mice blocked SDF-1-induced platelet increase,
demonstrating that the enzymatic activity of these proteinases is
critical for MK migration out of the bone marrow and subsequent platelet production in vivo. Besides their potential as antimetastatic and antiangiogenic agents,27-31 MMP inhibitors may be
useful in the treatment of thrombotic and myeloproliferative disorders.
All chemicals and reagents were obtained from Sigma Chemical (St
Louis, MO), unless stated otherwise.
Adenovirus vectors
Purification of CD34+ cells from cord blood
In vitro expansion and purification of CD41a+ megakaryocytes from CD34+ cells CD34+ cells were cultured in serum-free Xvivo-20 cell culture media (BioWhittaker, Walkersville, MD) supplemented with 100 ng/mL rhTPO (Peprotech, Piscataway, NJ), penicillin (100 U/mL), streptomycin (100 µg/mL), and Fungizone (0.25 µg/mL). After 12 days in culture CD41a+ MKs were isolated from the TPO-expanded CD34+ cells. The total cell population was incubated with an anti-CD41a fluorescein isothiocyanate (FITC)-labeled mAb. This incubation was conducted in the presence of 1.4 mmol/L adenosine and 2.74 mmol/L theophylline, known inhibitors of MK activation. These cells were subsequently incubated with MACS anti-FITC microbeads and purified using large-cell separation WHM columns (Miltenyi Biotec). Cells were washed 3 times with Xvivo-20 (BioWhittaker) to ensure complete removal of activation inhibitors.RNA extraction, cDNA synthesis, and reverse transcription-polymerase chain reaction Total RNA was extracted from purified MKs with TRI-reagent (Gibco BRL, Grand Island, NY), according to the manufacturer's instructions. cDNA was synthesized using the Ready-to-Go kit (Amersham Pharmacia Biotech) and polymerase chain reaction (PCR) was performed using a PCR thermal cycler (MWG Biotech, High Point, NC). The program used was as follows: an initial cycle of 5 minutes at 94°C, 1 minute at 65°C, and 30 seconds at 72°C. After this initial cycle, the reaction was continued for 35 cycles of 45 seconds at 94°C, 45 seconds at 65°C, and 2 minutes at 72°C, and it concluded with 7 minutes at 72°C. PCR products were run on 1.5% agarose gels with ethidium bromide. The primer sequences for -actin, MMP-9, TIMP-1,
and MMP-2 were as follows: -actin sense primer, TCATGTTTGAGACCTTCAA; -actin antisense primer, GTCTTTGCGGATGTCCACG; MMP-9 sense primer, ACCGCTATGGTTACACTCGG; MMP-9 antisense primer, GCAGGCAGAGTAGGAGCG; TIMP-1 sense primer, CCAAGTTCGTGGGGACAC; TIMP-1 antisense primer, TGCAGTTTTCCAGCAATGAG, MMP2 sense primer,
TCCTTTCACAACCTTCTGTGG; MMP-2 antisense primer, GGGAACCATCACTATGTGGG.
Endothelial cell cDNA was used as a positive control for all 4 sets of
primers. The specificity of all reverse transcription (RT)-PCR
products was confirmed, after extraction from agarose gels, by DNA
sequencing (performed at the Cornell University DNA Sequencing Facility).
Analysis of cell culture supernatants by gelatinolytic zymography Purified CD41a+ MKs and AdCXCR4-infected and AdNull-infected HEL cells were stimulated with and without 200 ng/mL per day rhSDF-1 (R&D Systems, Minneapolis, MN) or 1 U/mL thrombin.
Supernatants were collected after 48 hours, and their metalloproteinase
activity was measured by gelatinolytic zymography as previously
described.33 Briefly, 1 mL cell culture supernatants (from
250 000 viable cells, as determined by trypan blue exclusion) were
treated with 50 µL gelatin-agarose beads for 4 to 5 hours at 4°C
and processed through SDS-PAGE acrylamide gels containing 1% gelatin.
Gels were subsequently incubated in 2.5% Triton X-100 for 1 hour at
room temperature, rinsed in distilled water (DW) and placed in low-salt
collagenase buffer (50 mmol/L Tris, pH 7.6, 0.2 mol/L NaCl, 5 mmol/L
CaCl2, and 0.2% vol/vol Brij-35) at 37°C for 14 to 18 hours. Bands of gelatinolytic activity were visualized after gels were
stained with a solution containing 10 mL of a 0.2% Coomassie blue
stock and 190 mL destain (DW, methanol and glacial acetic acid, 6:3:1) for 30 minutes and left for 1 hour at room temperature. A pro-MMP-2 standard (Oncogene Research Products, Cambridge, MA) was used as a
positive control and to determine the molecular weight of gelatinolytic bands. The Adobe Photoshop 4.0 software application (Adobe Sys Inc, San Jose, CA) and a Umax Astra scanner (Umax
Tech Inc, Fremont, CA) were used to scan the gels, and the intensity of
the gelatinolytic bands was assessed using NIH Image 1.58 (http://rsb.info.nih.gov/nih-image).
Protein extraction and Western blotting Purified CD41a+ MKs were stimulated with and without 200 ng/mL per day rhSDF-1 (R&D Systems) or 1 U/mL thrombin. Samples
used for gelatinolytic zymography were also analyzed by Western blot to
confirm the identity of the MMPs released into the MK supernatant. Briefly, MK supernatant samples were subjected to SDS-PAGE (7.5% gels)
under reducing conditions (in the presence of -mercaptoethanol). Proteins were subsequently blotted onto a nitrocellulose membrane following conventional protocols. Finally, blots were blocked in 1%
BSA/PBS-1% Tween-20 for 1 hour at room temperature, followed by
incubation with primary and secondary antibodies. Mouse monoclonal anti-MMP-9 antibody (clone 7-11C; Oncogene Research Products) was used
at a concentration of 1 µg/mL and secondary antimouse IgG-horseradish peroxidase (Santa Cruz Biotechnology, Santa Cruz, CA)
was used at a 1:6000 dilution. The ECL chemiluminescence detection system and ECL film (Amersham Pharmacia Biotech) were used to visualize
the presence of proteins on the nitrocellulose blots.
Flow cytometry Cell populations were assessed by flow cytometry using a Coulter Elite flow cytometer (Coulter, Hialeah, FL). The following monoclonal antibodies were used: anit-CD34-phycoerythrin (PE) (clone HPCA2; Becton Dickinson, San Jose, CA), anti-CD41a-FITC (clone HIP8; PharMingen, San Diego, CA), anti-CXCR4-PE (clone 12G5; PharMingen), and IgG isotype control FITC/PE (PharMingen). A minimum of 5 × 104 cells was used for flow cytometry.Immunohistochemistry Cytospin preparations of freshly isolated mouse MKs and cultured human MKs were stained for the expression of MMPs following standard protocols. The antibodies used were: anti-MMP-2 mAb (clone 42-5011 for both human and murine samples; Oncogene Research), anti-MMP-9 mAb (clone 6-613 for human samples and clone 7-11C for murine; Oncogene Research), anti-TIMP-1 mAb (clone 7-6C1 for human and murine samples; Oncogene Research), and goat-antimouse-FITC secondary antibody (Kierkegaard & Perry Laboratories, Gaithersburg, MD). Briefly, cell suspensions were spun at 300 rpm for 5 minutes and fixed in 100% methanol for 10 minutes. Slides were washed with PBS 3 times for 5 minutes each and then incubated with 1.5% goat serum for 1 hour at room temperature. Primary antibodies were subsequently applied to the slides at a concentration of 1 µg/mL and incubated for 1 hour at room temperature. Slides were washed twice in PBS for 5 minutes before the application of secondary antibody (20 µg/mL) for 1 hour at room temperature. Finally, the slides were washed with PBS 3 times for 5 minutes each and mounted using SlowFade mounting reagent (Molecular Probes, Eugene, OR). The slides were observed and photographed under a fluorescent light microscope.Migration assays A modified version of a previously described transwell migration technique16 was used. Briefly, ex vivo-expanded MK were washed once with serum-free Xvivo-20 and prepared to a final concentration of 106 cells/mL. MK aliquots (100 µL) were added to 8 µm pore transwell inserts, coated with 25 µL growth factor-reduced Matrigel (Becton Dickinson), and placed into the wells of a 24-well plate. The lower compartment contained 600 µL Xvivo-20 serum-free media with or without 100 ng rhSDF-1 (R&D Systems). For
the purpose of blocking migration, each condition was prepared in a
separate aliquot and incubated with 500 ng/condition of anti-MMP-2
(clone 42-5011; Oncogene Research) or anti-MMP-9 (clone 6-613;
Oncogene Research), monoclonal neutralizing antibodies, rhTIMP-1 (300 ng/condition; Oncogene Research), and broad-range proteinase inhibitors
such as 2.5 mmol/L EDTA and 100 µmol/L
5-phenyl-1,10-phenanthrolene.34-38 The neutralizing
activity of the anti-MMP-2 and anti-MMP-9 antibodies was verified by
performing migration assays using leukemic cell lines that express both
metalloenzymes and thus require MMP-2 and MMP-9 for SDF-1-induced
migration through Matrigel (data not shown). The MK migration was
carried out at 37°C and 5% CO2 for 24 hours. Migrated
cells were collected from the lower compartment and counted using a
hemocytometer, and the percentage of migrated CD41a+ MKs
was determined by flow cytometry. Results are shown as a percentage of
migrated CD41a+ MKs in response to rhSDF-1.
Production of platelets by MK in vitro Day 14 ex vivo-expanded MK were washed once with serum-free Xvivo-20 and prepared to a final concentration of 0.5 × 106 cells/mL, with or without 0.2 mmol/L of a synthetic MMPi, 5-phenyl-1,10-phenanthrolene, supplemented with 100 ng/mL rhTPO and penicillin-streptomycin-Fungizone. After 7 days in culture, the number of CD41a+ platelet particles in culture was determined by flow cytometry.Animal studies AdSDF-1 and AdNull vectors were administered to Balb/c mice, treated with or without the MMPi CGS-27 023A (N-hydroxy-2(R)-[4-methoxybenzenesulfonyl]-(3-picoly)amino]-3 methyl-butanamide hydrochloride, a chiral hydroxamic acid derived from D-valine, with a molecular weight of 429.93), provided by Novartis Pharma AG.39,40 The MMPi was administered subcutaneously at 300 µg/mouse twice daily. Control mice were injected with an identical volume of sterile water diluent control. Orbital bleeding was used to determine platelet levels at the start of the experiment, after 3 days, and for the remaining time points (up to day 28). Quantification of peripheral blood platelet levels was performed using a manual determination method (UNOPETTE Test 5854/5855; Becton Dickinson, Rutherford, NJ).Statistical analysis Statistical analysis was performed using Microcal Origin 5.0 SR2 (Microcal Software, Northampton, MA). Data are expressed as mean (SEM of 3 to 5 independent experiments). To detect differences between data sets, the Student t test was applied. P < .05 was considered statistically significant.
Mature human MKs express and secrete MMP-9 in vitro Purified human CD34+ cells were incubated with TPO for 12 to 21 days. CD41a+ MKs were purified from day 14 ex vivo-expanded cells (98% pure population) (Figure 1). Purified MKs were analyzed for the expression of MMPs by RT-PCR, immunohistochemistry, zymography, and Western blot analysis. RT-PCR analysis of total RNA extracted from purified MKs showed that these cells expressed MMP-9 and TIMP-1, but not MMP-2, at the RNA level (Figure 2A). Immunohistochemistry analysis revealed that mostly mature (polyploid) mouse and human MKs express MMP-9 (Figure 3B,C,E,F) and TIMP-1, but not MMP-2 (Figure 3D). The surface expression of MMP-9 suggested that these cells exported this proteinase to the culture supernatant. This was subsequently confirmed by zymography (Figure 2B) and Western blot analysis (Figure 2D). MK cell culture supernatants had gelatinolytic activity corresponding to human MMP-9 (92 kd), but not to MMP-2 (72 kd MMP-2 standard shown), confirming the results obtained by immunohistochemistry. Zymographic analysis of supernatants from purified MK cultures confirms MKs as the main cell type in those cultures and MMP-9 as the main gelatinase released by these cells. Finally, there was no gelatinolytic activity detected when gels were incubated overnight in buffer containing 1 mmol/L 5-phenyl-1,10-phenanthrolene, confirming the nature of this proteolytic activity.
Thrombin and SDF-1 induce MMP-9 secretion by MKs Treatment of MKs with thrombin or SDF-1 increased pro-MMP-9 (92 kd41) release into the culture supernatant (Figure 2B). Moreover, a lower band of gelatinolytic activity (80-88 kd41) increased in expression after treatment with these cytokines (Figure 2B), corresponding to active MMP-9. Quantification of the gelatinolytic activity by densitometry showed that SDF-1 and thrombin increased pro-MMP-9 release by 95% and 60% and active MMP-9 by 200% and 65%, respectively (Figure 2C). Western blot analysis was performed on the supernatants from SDF-1- and thrombin-stimulated MKs (Figure 2D) to confirm the regulatory effects seen by gelatinolytic zymography. It is worth mentioning that the antibody used to detect MMP-9 recognizes only the pro form of this proteinase. Importantly, Western blot analysis of MK supernatants confirmed the significant increase in MMP-9 levels after thrombin and SDF-1 treatment of mature MKs. In addition, MK cell lysates contained TIMP-1, but not MMP-2, as determined by Western blot analysis (data not shown). These results suggest that the induction of MMP-9 may play a role on MK-induced migration in response to chemokines such as SDF-1.SDF-1 induces MMP production of Adeno-CXCR4 transfected megakaryocytic leukemic cells Transfection of HEL cells with AdCXCR4 confirmed that SDF-1 signaling, through its receptor, results in increased MMP-9 production. Unstimulated HEL cells release almost undetectable MMP levels (data not shown). SDF-1 treatment of AdNull-infected HEL cells resulted in no detectable increases in gelatinolytic activity. However, SDF-1 treatment of AdCXCR4-infected HEL cells resulted in a 100% increase in pro-MMP-9 levels compared to basal levels (Figure 4).
TIMP-1 and immunoneutralizing antibody to MMP-9, but not to MMP-2, blocks SDF-1-induced migration of MK through Matrigel-coated transwells Others and we have shown that SDF-1, but not other chemokines, can induce the migration of MKs through bare transwells and endothelial monolayers.16-18 To examine the capacity of MKs to migrate through an extracellular matrix similar to endothelial basement membrane, the abluminal surface of 8-µm transwell inserts was coated with a thin layer of growth factor-reduced Matrigel. Similar to our previous results on bare transwells, SDF-1 induced the migration of 20% of the MKs added to the upper chamber through Matrigel-coated transwells. The MMPi 5-phenyl-1,10-phenanthrolene (but not a serine protease inhibitor, phenylmethylsulfonyl fluoride) completely blocked SDF-1-induced migration (Figure 5), suggesting that MKs require MMP activity to migrate through a reconstituted basement membrane. Further, immunoneutralizing antibodies to MMP-9, but not to MMP-2, blocked SDF-1-induced MK migration through Matrigel by 70% (n = 4; P < .005). The MMP-9 mAb used in these studies has been previously shown to specifically block MMP-9 activity.42 Furthermore, TIMP-1 also blocked MK migration through Matrigel-coated transwells, confirming the involvement of MMP-9 in this process. Importantly, MK migration through bare transwells was not inhibited by treatment with the mAb to MMP-9, TIMP-1, or the MMPi 5-phenyl-1,10-phenanthrolene (n = 4; P > .05). These results suggest that the induction of active MMP-9 by SDF-1 may have a role in regulating MK extravasation from the bone marrow, through the endothelial basement membrane, into the sinusoidal space.
Synthetic MMP inhibitor blocks platelet formation by MKs in vitro Prolonged (21-day) incubation of MKs with TPO leads to the spontaneous formation of platelet-like particles that have been shown to retain some features of circulating platelets.16 Incubation of MKs with the MMPi 5-phenyl-1,10-phenanthrolene for the last 7 days of culture significantly inhibited platelet release (Figure 6). Incubation of MKs proliferating in the presence of TPO, with the MMPi, blocked spontaneous MK fragmentation. On the other hand, after 7 days, wells with TPO alone had few viable intact MKs and an abundance of platelet-like particles. MK incubated with TPO alone resulted in a 4-fold increase in the number of platelet-like particles, compared to those treated with the MMPi (n = 4; P < .001). Incubation of MK with recombinant TIMP-1 had only a minor effect on platelet production, suggesting that the process of platelet formation may not be mediated solely by MMP-9 (data not shown). These results show that MMPs are required for the formation of platelets by MKs in vitro.
Administration of a synthetic MMP inhibitor to Balb/c mice blocks AdSDF-1-increased platelet levels The results described above suggest that MMPs (and specifically MMP-9) may play a critical role in facilitating MK migration out of the bone marrow microenvironment into the peripheral circulation and in promoting platelet formation. Therefore, to examine the role of MMPs in regulating platelet production in vivo, AdSDF-1 and the MMPi (CGS-27 023A) were administered to Balb/c mice, and the number of platelets was determined over the course of the experiment.After 3 days, mice treated with AdSDF-1 alone achieved significantly
elevated platelet counts (P < .05), which peaked at days 7 to 10 (Figure 7) and returned to normal
by day 28 (Figure 7). However, the administration of MMPi in
conjunction with AdSDF-1 (Figure 7) reduced this effect at days 3 to 5 and completely blocked it by day 7 (P < .05).
Although TPO has been shown to promote MK proliferation and maturation, the exact mechanisms and sites of platelet formation are not well defined. Studies have shown that MKs transmigrate through BMECs and release platelets within the sinusoidal space or lung capillaries. Others and we have shown that SDF-1 induces the transendothelial migration of MKs.16-18 Because locomotion of large polyploid MKs within the bone marrow microenvironment and subsequent migration requires remodeling of the perivascular extracellular matrix, we hypothesized that mature polyploid MKs may express MMPs, facilitating their exit into the bone marrow extravascular space. In this report, we demonstrate that SDF-1 induces MMP-9 expression by MKs and an adeno-CXCR4-infected megakaryocytic cell line. SDF-1 induces the migration of MKs through Matrigel-coated transwells in an MMP-9-, but not an MMP-2-, dependent manner. In vivo platelet production could be blocked by synthetic inhibitors of MMPs, suggesting these enzymes are required for the process of MK migration and suggesting their subsequent fragmentation into platelets. The process of platelet formation is complex, requiring sequential expression of the SDF-1 receptor CXCR4 by mature MKs, followed by the secretion of MMP-9, which allows for MK migration out of the bone marrow. SDF-1 orchestrates this process by inducing MMP-9 and providing directional cues for MK migration. The collective interaction of MKs with BMECs during the process of transmigration initiates cellular signals, resulting in MK fragmentation and platelet release within the lung capillaries. MMP-9 has been shown to be primarily produced by cytokine-stimulated
endothelial29 and smooth muscle cells,43,44
and it plays a key role in the regulation of angiogenesis and the remodeling of connective tissue45 and in disease states
associated with acute and chronic inflammation or tumor
angiogenesis.29-31 However, recent studies have suggested
that MMP-9 not only regulates tissue remodeling but may also play a
seminal role in facilitating the migration of hematopoietic cells.
MMP-9 is produced by hematopoietic cells, such as
eosinophils,46 B-cells,47
monocytes,48 and CD34+ cells.49
Cytokine activation of CD34+ cells results in the
up-regulation of MMPs, including MMP-9. Up-regulation of MMP-9 by
various cytokines, including IL-6 and IL-3, facilitates the migration
of CD34+ cells through reconstituted basement membranes
(Matrigel).49 Moreover, cytokine activation of
Epstein-Barr virus B-infected lymphocytes results in increased MMP-9
expression and enhancement of B-cell migration capacity. Furthermore,
interferon- In the current work, we demonstrated that SDF-1 induced MKs to express and secrete MMP-9. Combined SDF-1-induced chemotactic activity and MMP-9 activation results in the promotion of MK migration through vascular basement membrane. So far, among the known chemocytokines, SDF-1 has been shown to be the only chemokine mediating MK migration and activation of MMP-9. Furthermore, SDF-1 also induced MMP-3 release by MKs (data not shown), suggesting that the induction of this proteinase may be the mechanism by which SDF-1 stimulates the production of active MMP-9 by MKs. This mechanism of MMP-9 activation by MMP-3 has been recently shown for other cell types.52 Besides their necessity for MK migration, we demonstrate that MMPs are also involved in the process of platelet production by MKs in vitro, in response to TPO. The MK membrane has unique features distinct from those of platelets. Based on the results obtained by zymography and immunohistochemical staining, it is apparent that MMP-9 is not only secreted by MKs but is localized to the MK membrane. MMP-9 was also localized, though to a much smaller extent, within the MKs, mainly concentrated in demarcation membrane systems. MMP inhibition results in the blockage of platelet production in vitro, suggesting that the localization and activation of MMP-9, and possibly other as yet unrecognized proteinases, may play a key role in facilitating platelet release during MK fragmentation into platelets. It is intriguing that platelets themselves have been shown to contain naturally occurring MMPi such as TIMP-1 and TIMP-2,25 possibly to inhibit further fragmentation once the platelets are released into the peripheral circulation. These observations, in addition to previously published work showing that MMPs are required for platelet aggregation in vitro,53 suggests that the inhibitors of these enzymes may be of use for the treatment of thrombophilic disorders. In support of our in vitro observations, the administration of a synthetic MMPi with high affinity for MMP-9 to normal mice blocked AdSDF-1-induced increases in platelet levels. This MMP inhibitor was chosen over rhTIMP-1 because of the nonspecificity of TIMP-1 and the greater bio-availability of the synthetic MMPi. This MMPi may thus be highly effective at blocking platelet production and MK migration out of the bone marrow and could be useful in the treatment of thrombotic and thrombophilic disorders. Although the MMPi used in these studies has a broad range MMP blocking activity, it blocks preferentially MMP-2, MMP-3, and MMP-9, with IC50 values of 11 nmol/L, 8 nmol/L, and 13 nmol/L, respectively (as determined by Novartis Pharm AG). Of the MMPs investigated, MKs produce MMP-3 and MMP-9 but, unlike other hematopoietic cells, do not appear to produce MMP-2. It would be of the utmost importance to investigate whether a similar effect on MK migration and platelet production is observed after the administration of other available MMP inhibitors. Given that MMP-9, which is essential for MK migration, is also produced by other hematopoietic cells, including monocytes, eosinophils, and lymphocytes, in situations of increased platelet counts, higher levels of MMPi may be necessary to completely block the activity of MMP-9 and to reduce circulating platelet levels. Additionally, it is possible that the synthetic MMP inhibitor might affect ploidy or cytokine release. It is not surprising that factors that inhibit MMP-9 activity, such as interferons,48,50,54-56 have also been shown to decrease platelet production. Unfortunately, unlike MMP inhibitors, such as the one used in the current studies, the administration of interferons is invariably associated with systemic toxicity. MKs and platelets have the capacity to store and secrete numerous cytokines and angiogenic factors. We have shown that MKs have the capacity to constitutively synthesize and store vascular endothelial growth factor (VEGF), which is the principal specific endothelial mitogenic and survival factor.57 Although MKs and platelets constitutively secrete small quantities of VEGF, activation with thrombin results in the release of large quantities of VEGF.57 In this report, we demonstrate that MMP-9 is not only constitutively secreted by MKs, it is also stored and released on thrombin stimulation. Given that MMP-9 has been shown to promote neo-angiogenesis, we suspect that the release of MMP-9, along with the release of VEGF and numerous other angiogenic regulators, results in locoregional induction of angiogenesis at the site of vascular injury. In the current report we demonstrate that MMP-9 is required for MK migration out of the bone marrow and for subsequent platelet production in response to a specific chemoattractant stimulus, such as SDF-1. However, to date there have been no reports indicating whether MMP-9-deficient mice have low platelet counts or increased MK bone marrow content.45 However, the degree of redundancy between different members of the MMP family, as demonstrated by their overlapping substrate specificities, suggests that the absence of one proteinase may be compensated by the overexpression or overactivation of another closely related MMP. Another possible explanation is that platelet levels and bone marrow cellularity have simply not been quantified in these mice. The bone marrow microenvironment has been shown to undergo continual remodeling. There is a balance between extracellular matrix laid down and destroyed. However, in myelofibrosis there is an accumulation of extracellular matrix that may result from defective MMP production by MKs or monocytes. Therefore, it is conceivable that the pathogenesis of myelofibrosis may be due to MK dysfunction, monocyte dysfunction, or both. We have provided data supporting a new paradigm in hematopoietic cell biology whereby the locomotion of hematopoietic cells may require MMP activity. Therefore, the activation of MMPs may play a key role in the trafficking of hematopoietic cells such as MKs. Production of MMP-9 by MKs is one of the mechanisms by which mature MKs free themselves from the bone marrow matrix and travel to the lungs, where they ultimately release their load of platelets. The mechanisms by which MMP-9 or other as yet unknown MMPs regulate platelet release is the subject of ongoing studies.
Submitted March 30, 2000; accepted July 13, 2000.
Supported by National Heart, Lung, and Blood Institute (NHLBI) grants R01 HL-58707, R01 HL-61849, and Pilot Project P01 HL-59312; the Dorothy Rodbell Foundation for Sarcoma Research; and the Rich Foundation to S.R.; and NHLB grant R01 HL-61401 and the Gar Reichman Fund of the Cancer Research Institute to M.A.S.M.
W.J.L. and S.D. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Shahin Rafii, Hematology-Oncology Division, Weill Medical College of Cornell University, Rm C-606, 1300 York Ave, New York, NY 10021; e-mail:srafii{at}mail.med.cornell.edu.
1. Kaushansky K, Lok S, Holly RD, et al. Promotion of megakaryocyte progenitor expansion and differentiation by the c-Mpl ligand thrombopoietin. Nature. 1994;369:568-571[Medline] [Order article via Infotrieve]. 2. Lok S, Kaushansky K, Holly RD, et al. Cloning and expression of murine thrombopoietin cDNA and stimulation of platelet production in vivo. Nature. 1994;369:565-568[Medline] [Order article via Infotrieve]. 3. de Sauvage FJ, Hass PE, Spencer SD, et al. Stimulation of megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand. Nature. 1994;369:533-538[Medline] [Order article via Infotrieve].
4.
Kaushansky K, Broudy VC, Lin N, et al.
Thrombopoietin, the Mp1 ligand, is essential for full megakaryocyte development.
Proc Natl Acad Sci U S A.
1995;92:3234-3238
5.
Zucker-Franklin D, Kaushansky K.
Effect of thrombopoietin on the development of megakaryocytes and platelets: an ultrastructural analysis.
Blood.
1996;88:1632-1638 6. Murone M, Carpenter DA, de Sauvage FJ. Hematopoietic deficiencies in c-mpl and TPO knockout mice. Stem Cells. 1998;16:1-6[Medline] [Order article via Infotrieve].
7.
Bunting S, Widmer R, Lipari T, et al.
Normal platelets and megakaryocytes are produced in vivo in the absence of thrombopoietin.
Blood.
1997;90:3423-3429 8. Zucker-Franklin D, Stahl C, Hyde P. Megakaryocyte ultrastructure: its relationship to normal and pathologic thrombocytopoiesis. Ann N Y Acad Sci. 1987;509:25-33[Medline] [Order article via Infotrieve]. 9. Tavassoli M, Aoki M. Localization of megakaryocytes in the bone marrow. Blood Cells. 1989;15:3-14[Medline] [Order article via Infotrieve]. 10. Weiss L. The hematopoietic microenvironment of the bone marrow: an ultrastructural study of the stroma in rats. Anat Rec. 1976;186:161-184[Medline] [Order article via Infotrieve]. 11. Lichtman MA, Chamberlain JK, Simon W, Santillo PA. Parasinusoidal location of megakaryocytes in marrow: a determinant of platelet release. Am J Hematol. 1978;4:303-312[Medline] [Order article via Infotrieve]. 12. Tavassoli M, Aoki M. Migration of entire megakaryocytes through the marrow-blood barrier. Br J Haematol. 1981;48:25-29[Medline] [Order article via Infotrieve]. 13. Levine RF, Eldor A, Shoff PK, Kirwin S, Tenza D, Cramer EM. Circulating megakaryocytes: delivery of large numbers of intact, mature megakaryocytes to the lungs. Eur J Haematol. 1993;51:233-246[Medline] [Order article via Infotrieve]. 14. Levine RF, Shoff P, Han ZC, Eldor A. Circulating megakaryocytes and platelet production in the lungs. Prog Clin Biol Res. 1990;356:41-52[Medline] [Order article via Infotrieve]. 15. Woods MJ, Greaves M, Smith GH, Trowbridge EA. The fate of circulating megakaryocytes during cardiopulmonary bypass. J Thorac Cardiovasc Surg. 1993;106:658-663[Abstract].
16.
Hamada T, Mohle R, Hesselgesser J, et al.
Transendothelial migration of megakaryocytes in response to stromal cell-derived factor 1 (SDF-1) enhances platelet formation.
J Exp Med.
1998;188:539-548
17.
Wang JF, Liu ZY, Groopman JE.
The alpha-chemokine receptor CXCR4 is expressed on the megakaryocytic lineage from progenitor to platelets and modulates migration and adhesion.
Blood.
1998;92:756-764
18.
Riviere C, Subra F, Cohen-Solal K, et al.
Phenotypic and functional evidence for the expression of CXCR4 receptor during megakaryocytopoiesis.
Blood.
1999;93:1511-1523 19. Werb Z, Vu TH, Rinkenberger JL, Coussens LM. Matrix-degrading proteases and angiogenesis during development and tumor formation. APMIS. 1999;107:11-18[Medline] [Order article via Infotrieve]. 20. Shapiro SD. Matrix metalloproteinase degradation of extracellular matrix: biological consequences. Curr Opin Cell Biol. 1998;10:602-608[Medline] [Order article via Infotrieve]. 21. Johnson LL, Dyer R, Hupe DJ. Matrix metalloproteinases. Curr Opin Chem Biol. 1998;2:466-471[Medline] [Order article via Infotrieve]. 22. Leven RM, Yee T. Collagenase production by guinea pig megakaryocytes in vitro. Exp Hematol. 1990;18:743-747[Medline] [Order article via Infotrieve]. 23. Chesney CM, Harper E, Colman RW. Human platelet collagenase. J Clin Invest. 1974;53:1647-1654. 24. Sawicki G, Sanders EJ, Salas E, Wozniak M, Rodrigo J, Radomski MW. Localization and translocation of MMP-2 during aggregation of human platelets. Thromb Haemost. 1998;80:836-839[Medline] [Order article via Infotrieve]. 25. Murate T, Yamashita K, Isogai C, et al. The production of tissue inhibitors of metalloproteinases (TIMPs) in megakaryopoiesis: possible role of platelet- and megakaryocyte-derived TIMPs in bone marrow fibrosis. Br J Haematol. 1997;99:181-189[Medline] [Order article via Infotrieve].
26.
Cooper TW, Eisen AZ, Stricklin GP, Welgus HG.
Platelet-derived collagenase inhibitor: characterization and subcellular localization.
Proc Natl Acad Sci U S A.
1985;82:2779-2783 27. Benelli R, Adatia R, Ensoli B, Stetler-Stevenson WG, Santi L, Albini A. Inhibition of AIDS-Kaposi's sarcoma cell induced endothelial cell invasion by TIMP-2 and a synthetic peptide from the metalloproteinase propeptide: implications for an anti-angiogenic therapy. Oncol Res. 1994;6:251-257[Medline] [Order article via Infotrieve]. 28. Sang QX. Complex role of matrix metalloproteinases in angiogenesis. Cell Res. 1998;8:171-177[Medline] [Order article via Infotrieve]. 29. Cornelius LA, Nehring LC, Roby JD, Parks WC, Welgus HG. Human dermal microvascular endothelial cells produce matrix metalloproteinases in response to angiogenic factors and migration. J Invest Dermatol. 1995;105:170-176[Medline] [Order article via Infotrieve]. 30. Lochter A, Sternlicht MD, Werb Z, Bissell MJ. The significance of matrix metalloproteinases during early stages of tumor progression. Ann N Y Acad Sci. 1998;857:180-193[Medline] [Order article via Infotrieve].
31.
Westermarck J, Kahari VM.
Regulation of matrix metalloproteinase expression in tumor invasion.
FASEB J.
1999;13:781-792
32.
He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B.
A simplified system for generating recombinant adenoviruses.
Proc Natl Acad Sci U S A.
1998;95:2509-2514 33. Leber TM, Balkwill FR. Zymography: a single-step staining method for quantitation of proteolytic activity on substrate gels. Anal Biochem. 1997;249:24-28[Medline] [Order article via Infotrieve].
34.
Zucker S, Conner C, DiMassmo BI, et al.
Thrombin induces the activation of progelatinase A in vascular endothelial cells: physiologic regulation of angiogenesis.
J Biol Chem.
1995;270:23730-23738
35.
Fisher SJ, Cui TY, Zhang L, et al.
Adhesive and degradative properties of human placental cytotrophoblast cells in vitro.
J Cell Biol.
1989;109:891-902
36.
Cheung PY, Sawicki G, Wozniak M, Wang W, Radomski MW, Schulz R.
Matrix metalloproteinase-2 contributes to ischemia-reperfusion injury in the heart.
Circulation.
2000;101:1833-1839
37.
Nguyen M, Arkell J, Jackson CJ.
Activated protein C directly activates human endothelial gelatinase A.
J Biol Chem.
2000;275:9095-9098 38. Uzui H, Lee JD, Shimizu H, Tsutani H, Ueda T. The role of protein-tyrosine phosphorylation and gelatinase production in the migration and proliferation of smooth muscle cells. Atherosclerosis. 2000;149:51-59[Medline] [Order article via Infotrieve]. 39. O'Byrne EM, Parker DT, Roberts ED, et al. Oral administration of a matrix metalloproteinase inhibitor, CGS 27023A, protects the cartilage proteoglycan matrix in a partial meniscectomy model of osteoarthritis in rabbits. Inflamm Res. 1995;44 (suppl 2):S117-S118. 40. MacPherson LJ, Bayburt EK, Capparelli MP, et al. Discovery of CGS 27023A, a non-peptidic, potent, and orally active stromelysin inhibitor that blocks cartilage degradation in rabbits. J Med Chem. 1997;40:2525-2532[Medline] [Order article via Infotrieve].
41.
Okada Y, Gonoji Y, Naka K, et al.
Matrix metalloproteinase 9 (92-kDa gelatinase/type IV collagenase) from HT 1080 human fibrosarcoma cells: purification and activation of the precursor and enzymic properties.
J Biol Chem.
1992;267:21712-21719 42. Ramos-DeSimone N, Moll UM, Quigley JP, French DL. Inhibition of matrix metalloproteinase 9 activation by a specific monoclonal antibody. Hybridoma. 1993;12:349-363[Medline] [Order article via Infotrieve]. 43. Kenagy RD, Clowes AW. A possible role for MMP-2 and MMP-9 in the migration of primate arterial smooth muscle cells through native matrix. Ann N Y Acad Sci. 1994;732:462-465[Medline] [Order article via Infotrieve].
44.
Wang H, Keiser JA.
Vascular endothelial growth factor upregulates the expression of matrix metalloproteinases in vascular smooth muscle cells: role of flt-1.
Circ Res.
1998;83:832-840 45. Vu TH, Shipley JM, Bergers G, et al. MMP-9/gelatinase B is a key regulator of growth plate angiogenesis and apoptosis of hypertrophic chondrocytes. Cell. 1998;93:411-422[Medline] [Order article via Infotrieve].
46.
Okada S, Kita H, George TJ, Gleich GJ, Leiferman KM.
Migration of eosinophils through basement membrane components in vitro: role of matrix metalloproteinase-9.
Am J Respir Cell Mol Biol.
1997;17:519-528
47.
Trocme C, Gaudin P, Berthier S, Barro C, Zaoui P, Morel F.
Human B lymphocytes synthesize the 92-kDa gelatinase, matrix metalloproteinase-9.
J Biol Chem.
1998;273:20677-20684 48. Stuve O, Chabot S, Jung SS, Williams G, Yong VW. Chemokine-enhanced migration of human peripheral blood mononuclear cells is antagonized by interferon beta-1b through an effect on matrix metalloproteinase-9. J Neuroimmunol. 1997;80:38-46[Medline] [Order article via Infotrieve].
49.
Janowska-Wieczorek A, Marquez LA, Nabholtz JM, et al.
Growth factors and cytokines up-regulate gelatinase expression in bone marrow CD34(+) cells and their transmigration through reconstituted basement membrane.
Blood.
1999;93:3379-3390 50. Stuve O, Dooley NP, Uhm JH, et al. Interferon beta-1b decreases the migration of T lymphocytes in vitro: effects on matrix metalloproteinase-9. Ann Neurol. 1996;40:853-863[Medline] [Order article via Infotrieve]. 51. Xia M, Leppert D, Hauser SL, et al. Stimulus specificity of matrix metalloproteinase dependence of human T cell migration through a model basement membrane. J Immunol. 1996;156:160-167[Abstract].
52.
Ramos-DeSimone N, Hahn-Dantona E, Sipley J, Nagase H, French DL, Quigley JP.
Activation of matrix metalloproteinase-9 (MMP-9) via a converging plasmin/stromelysin-1 cascade enhances tumor cell invasion.
J Biol Chem.
1999;274:13066-13076 53. Sawicki G, Salas E, Murat J, Miszta-Lane H, Radomski MW. Release of gelatinase A during platelet activation mediates aggregation. Nature. 1997;386:616-619[Medline] [Order article via Infotrieve]. 54. Leppert D, Waubant E, Burk MR, Oksenberg JR, Hauser SL. Interferon beta-1b inhibits gelatinase secretion and in vitro migration of human T cells: a possible mechanism for treatment efficacy in multiple sclerosis. Ann Neurol. 1996;40:846-852[Medline] [Order article via Infotrieve]. 55. Wu AJ, Lafrenie RM, Park C, et al. Modulation of MMP-2 (gelatinase A) and MMP-9 (gelatinase B) by interferon-gamma in a human salivary gland cell line. J Cell Physiol. 1997;171:117-124[Medline] [Order article via Infotrieve]. 56. Hujanen ES, Turpeenniemi-Hujanen T. Recombinant interferon alpha and gamma modulate the invasive potential of human melanoma in vitro. Int J Cancer. 1991;47:576-581[Medline] [Order article via Infotrieve]
57.
Mohle R, Green D, Moore MA, Nachman RL, Rafii S.
Constitutive production and thrombin-induced release of vascular endothelial growth factor by human megakaryocytes and platelets.
Proc Natl Acad Sci U S A.
1997;94:663-668
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  L. Gilles, D. Bluteau, S. Boukour, Y. Chang, Y. Zhang, T. Robert, P. Dessen, N. Debili, O. A. Bernard, W. Vainchenker, et al. MAL/SRF complex is involved in platelet formation and megakaryocyte migration by regulating MYL9 (MLC2) and MMP9 Blood, November 5, 2009; 114(19): 4221 - 4232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L Menchen, I Marin-Jimenez, E G Arias-Salgado, T Fontela, P Hernandez-Sampelayo, M C G. Rodriguez, and N V Butta Matrix metalloproteinase 9 is involved in Crohn's disease-associated platelet hyperactivation through the release of soluble CD40 ligand Gut, July 1, 2009; 58(7): 920 - 928. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Nishikii, K. Eto, N. Tamura, K. Hattori, B. Heissig, T. Kanaji, A. Sawaguchi, S. Goto, J. Ware, and H. Nakauchi Metalloproteinase regulation improves in vitro generation of efficacious platelets from mouse embryonic stem cells J. Exp. Med., August 4, 2008; 205(8): 1917 - 1927. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Chen, O. Naveiras, A. Balduini, A. Mammoto, M. A. Conti, R. S. Adelstein, D. Ingber, G. Q. Daley, and R. A. Shivdasani The May-Hegglin anomaly gene MYH9 is a negative regulator of platelet biogenesis modulated by the Rho-ROCK pathway Blood, July 1, 2007; 110(1): 171 - 179. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. S. Dhanjal, C. Pendaries, E. A. Ross, M. K. Larson, M. B. Protty, C. D. Buckley, and S. P. Watson A novel role for PECAM-1 in megakaryocytokinesis and recovery of platelet counts in thrombocytopenic mice Blood, May 15, 2007; 109(10): 4237 - 4244. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. W. Rahman, F. H. Sarkar, S. Banerjee, Z. Wang, D. J. Liao, X. Hong, and N. H. Sarkar Therapeutic intervention of experimental breast cancer bone metastasis by indole-3-carbinol in SCID-human mouse model. Mol. Cancer Ther., November 1, 2006; 5(11): 2747 - 2756. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Goda, H. Inoue, H. Umehara, M. Miyaji, Y. Nagano, N. Harakawa, H. Imai, P. Lee, J. B. MaCarthy, T. Ikeo, et al. Matrix Metalloproteinase-1 Produced by Human CXCL12-Stimulated Natural Killer Cells Am. J. Pathol., August 1, 2006; 169(2): 445 - 458. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-G. Kopp, S. T. Avecilla, A. T. Hooper, S. V. Shmelkov, C. A. Ramos, F. Zhang, and S. Rafii Tie2 activation contributes to hemangiogenic regeneration after myelosuppression Blood, July 15, 2005; 106(2): 505 - 513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Xu, E. Bruno, J. Chao, S. Huang, G. Finazzi, S. M. Fruchtman, U. Popat, J. T. Prchal, G. Barosi, R. Hoffman, et al. Constitutive mobilization of CD34+ cells into the peripheral blood in idiopathic myelofibrosis may be due to the action of a number of proteases Blood, June 1, 2005; 105(11): 4508 - 4515. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Katayama, T. Ogino, N. Bandoh, S. Nonaka, and Y. Harabuchi Expression of CXCR4 and Its Down-Regulation by IFN-{gamma} in Head and Neck Squamous Cell Carcinoma Clin. Cancer Res., April 15, 2005; 11(8): 2937 - 2946. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Perissinotto, G. Cavalloni, F. Leone, V. Fonsato, S. Mitola, G. Grignani, N. Surrenti, D. Sangiolo, F. Bussolino, W. Piacibello, et al. Involvement of Chemokine Receptor 4/Stromal Cell-Derived Factor 1 System during Osteosarcoma Tumor Progression Clin. Cancer Res., January 15, 2005; 11(2): 490 - 497. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. G. Galvez, L. Genis, S. Matias-Roman, S. A. Oblander, K. Tryggvason, S. S. Apte, and A. G. Arroyo Membrane Type 1-Matrix Metalloproteinase Is Regulated by Chemokines Monocyte-Chemoattractant Protein-1/CCL2 and Interleukin-8/CXCL8 in Endothelial Cells during Angiogenesis J. Biol. Chem., January 14, 2005; 280(2): 1292 - 1298. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. S. Haque, J. T. Fallon, J. J. Pan, M. B. Taubman, and P. C. Harpel Chemokine receptor-8 (CCR8) mediates human vascular smooth muscle cell chemotaxis and metalloproteinase-2 secretion Blood, February 15, 2004; 103(4): 1296 - 1304. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Sengupta, S. Caballero, R. N. Mames, J. M. Butler, E. W. Scott, and M. B. Grant The Role of Adult Bone Marrow-Derived Stem Cells in Choroidal Neovascularization Invest. Ophthalmol. Vis. Sci., November 1, 2003; 44(11): 4908 - 4913. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. B Jones, D. C Sane, and D. M Herrington Matrix metalloproteinases: A review of their structure and role in acute coronary syndrome Cardiovasc Res, October 1, 2003; 59(4): 812 - 823. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. R. Kyriakides, P. Rojnuckarin, M. A. Reidy, K. D. Hankenson, T. Papayannopoulou, K. Kaushansky, and P. Bornstein Megakaryocytes require thrombospondin-2 for normal platelet formation and function Blood, May 15, 2003; 101(10): 3915 - 3923. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Reca, D. Mastellos, M. Majka, L. Marquez, J. Ratajczak, S. Franchini, A. Glodek, M. Honczarenko, L. A. Spruce, A. Janowska-Wieczorek, et al. Functional receptor for C3a anaphylatoxin is expressed by normal hematopoietic stem/progenitor cells, and C3a enhances their homing-related responses to SDF-1 Blood, May 15, 2003; 101(10): 3784 - 3793. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Jurasz, A. W.Y. Chung, A. Radomski, and M. W. Radomski Nonremodeling Properties of Matrix Metalloproteinases: The Platelet Connection Circ. Res., May 31, 2002; 90(10): 1041 - 1043. [Full Text] [PDF]
|
|
|
|
|
|
E. A. Sweeney, H. Lortat-Jacob, G. V. Priestley, B. Nakamoto, and T. Papayannopoulou Sulfated polysaccharides increase plasma levels of SDF-1 in monkeys and mice: involvement in mobilization of stem/progenitor cells Blood, January 1, 2002; 99(1): 44 - 51. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
, AdSDF-1; 
,
AdSDF-1 plus MMPi; 
, AdNull; 
, AdNull plus MMPi. Results shown
are representative of 3 independent experiments (n = 3;
*P < .05 compared to diluent control mice).