|
|
 Previous Article | Table of Contents | Next Article 
Blood, 15 December 2000, Vol. 96, No. 13, pp. 4160-4168
HEMATOPOIESIS
During ontogeny primitive (CD34+CD38 )
hematopoietic cells show altered expression of a subset of genes
associated with early cytokine and differentiation responses of
their adult counterparts
Il-Hoan Oh,
Aster Lau, and
Connie J. Eaves
From the Terry Fox Laboratory, British Columbia Cancer
Agency and Department of Medical Genetics, University of British
Columbia, Vancouver, BC, Canada.
 |
Abstract |
Comparison of gene expression profiles in closely related
subpopulations of primitive hematopoietic cells offers a powerful first
step to elucidating the molecular basis of their different biologic
properties. Here we present the results of a comparative quantitative
analysis of transcript levels for various growth factor receptors,
ligands, and transcription factor genes in
CD34+CD38 and
CD34+CD38+ cells purified from first trimester
human fetal liver, cord blood, and adult bone marrow (BM). In addition,
adult BM CD34+CD38 cells were examined after
short-term exposure to various growth factors in vitro. Transcripts for
19 of the 24 genes analyzed were detected in unmanipulated adult BM
CD34+CD38 cells. Moreover, the levels of
transforming growth factor beta (TGF- ), gp130, c-fos,
and c-jun transcripts in these cells were consistently and
significantly different (higher) than in all other populations
analyzed, including phenotypically similar but biologically different
cells from fetal or neonatal sources, as well as adult BM
CD34+ cells still in G0 after 2 days of growth
factor stimulation. We have thus identified a subset of early response
genes whose expression in primitive human hematopoietic cells is
differently regulated during ontogeny and in a fashion that is
recapitulated in growth factor-stimulated adult BM
CD34+CD38 cells, before their cell cycle
progression and independent of their subsequent differentiation
response. These findings suggest a progressive alteration in the
physiology of primitive hematopoietic cells during development such
that these cells initially display a partially "activated" state,
which is not maximally repressed until after birth.
(Blood. 2000;96:4160-4168)
© 2000 by The American Society of Hematology.
| |
Introduction |
Analyses of mature blood cell differentiation from
multipotent human hematopoietic progenitors at the population level has led to the widely held view that this process involves a series of
ordered biologic changes that typically span many cell generations. These changes include modulation of the cell surface phenotype, nuclear
transcription factor activity, growth factor responsiveness, proliferative activity, proliferative potential, and lineage
restriction. Nevertheless, deviations from a single coordinated process
are well documented from studies of both bulk 1-4 and
clonal populations 5-8 derived from otherwise
indistinguishable primitive hematopoietic progenitors. In addition,
comparisons of functionally similar populations obtained from different
stages of ontogeny have shown these cells to exhibit differences in
their cell cycle transit times,9,10 in their biologic
responses to various cytokines,11-18 in their in vivo
turnover rates, 9,19-21 and in some of the lineage-specific genes they express.22-24 Previous studies have indicated
that the majority of CD34+CD38 cells analyzed
directly after their isolation from the bone marrow (BM) of healthy
adults are deeply quiescent.25-27 Nevertheless, most of
these cells, including those identified functionally as long-term
culture-initiating cells (LTC-ICs) on the basis of their ability to
generate colony-forming cell (CFC) progeny for at least 6 weeks on
stromal feeder layers,6 will enter mitosis within 7 days
of exposure in vitro to high concentrations of flt3-ligand (FL), Steel
factor (SF), interleukin-3 (IL-3), IL-6, and granulocyte colony-stimulating factor (G-CSF), although a first division may not be
seen before the third day.25,27-30 In contrast, the same cytokines will stimulate human cord blood
CD34+CD38 cells to begin to divide one day
earlier and most, including the LTC-ICs, will complete at least one
mitosis within 5 days.10,31 Analogous experiments with
human fetal liver CD34+CD38 cells suggest
they can be recruited into cycle even faster.10,32 Because
most phenotypic differences between cells will ultimately be dictated
by their particular recent gene expression profiles, we hypothesized
that ontogenically earlier populations of
CD34+CD38 human hematopoietic cells might
show quantitative differences in certain gene transcripts when compared
with their counterparts in normal adult BM. Further, we anticipated
that the expression of at least some of these genes would be affected
by growth factor stimulation of adult BM
CD34+CD38 cells.
To address this question required a semiquantitative procedure for
measuring transcripts for multiple genes that would be applicable to
the small numbers (less than 104) of highly purified cells
obtainable. Previous studies had shown that these requirements could be
met using a reverse transcriptase-polymerase chain reaction (RT-PCR)
method originally developed by Brady et al,33 which,
however, is limited to the detection of transcripts with unique 3'
terminal sequences. From the information available at the time this
study was initiated, this constraint could be met for 6 growth factor
genes, 7 growth factor receptor genes, and several transcription factor
genes, all known to be relevant to hematopoiesis,7,34-36
as well as for a number of less hematopoietic-specific, "early
response" genes. A total of 24 genes were thus selected as an initial
test group to determine which were expressed in adult BM
CD34+CD38 cells and how their expression
would be altered by growth factor stimulation, both in vivo (as
indicated by analysis of the CD34+CD38+ subset
of adult human BM cells) and in vitro. The results of such analyses
have revealed a number of consistent and rapid changes in gene
expression that occur in growth factor-stimulated adult BM
CD34+CD38 cells even before their exit from
G0. As predicted, similar differences in expression of many
of the same genes were found to distinguish adult from neonatal or
fetal sources of CD34+CD38 cells as well as
adult BM CD34+CD38+ and
CD34+CD38 cells.
| |
Materials and methods |
Cells
First trimester fetal liver tissue from scheduled abortions,
umbilical cord blood from full-term deliveries obtained by cesarean section, and healthy adult BM obtained from cadaveric or allogeneic transplant donors were prepared as low-density (less than 1.077 gm/cm3) single-cell suspensions and cryopreserved in DMSO
as previously described.37 Informed consent was obtained
for all material according to institutional guidelines.
Cell purification
As required, cell aliquots were thawed and
CD34+CD38 and
CD34+CD38+ subsets isolated by FACS after
removal of cells expressing CD2, CD3, CD14, CD16, CD19, CD24, CD56,
CD66b, and glycophorin A using an immunomagnetic affinity column
(StemSep, StemCell Technologies Inc, Vancouver, BC,
Canada).38 Viable (propidium iodide [PI, Sigma Chemicals,
St Louis, MO]-negative) CD34+ cells with low to medium
forward light-scattering characteristics were subdivided into
CD38+ and CD38 subpopulations using a gate
that excluded more than 99% of cells stained with a similarly labeled
isotype control antibody and collected into separate tubes containing
Iscove medium (IMDM, StemCell), supplemented with a serum substitute
(BIT, StemCell). For the cell cycle tracking experiments, lineage
marker-negative (lin) adult BM cells were first incubated
for 45 minutes at 37°C in 10 µM Hoechst 33342 (Hst, Molecular
Probes, Eugene, OR) to which 5 µg/mL Pyronin Y (Py, Sigma) was then
added, and the incubation continued at 37°C for another 45 minutes.
The cells were then labeled with anti-CD34-FITC for an additional 20 minutes, washed in the continuing presence of 10 µM Hst and 2.5 µg/mL Py plus 1 µg/mL PI, resuspended in the same solution without
PI, and kept on ice in the dark until being sorted. Separate aliquots
of cells stained with PI only, with PI and anti-CD34-FITC, and with
PI, anti-CD34-FITC and Py were used to set the compensation. The
PI CD34+ cells expressing low levels of Hst
and Py (HstloPylo) and considered to be in
G0 (referred to as the initial G0
[G0i] cells) were then collected as described in detail
previously.39 To isolate G0 cells from 40-hour
cultures initiated with these CD34+ G0i cells,
the cells harvested from the culture were restained with Hst, Py, and
PI, and then the PI HstloPylo
(G0') cells were sorted. The remaining
(G1/S/G2/M) PI cells in the
cultures (designated as non-G0 or NG0' cells)
were also collected and analyzed in parallel using the same protocol as
for the cells used to initiate the cultures.
Liquid suspension cultures
CD34+CD38 or CD34+
G0i cells were suspended in Iscove's medium supplemented
with BIT, 40 µg/mL low-density lipoproteins (Sigma), 104 M 2-mercaptoethanol (Sigma) at 4 × 103
cells/mL, and cultured at 37°C in 3 to 6 mL volumes with one of 5 different combinations of purified human recombinant growth factors (A,
B, C, D, and thrombopoietin [TPO] only), as indicated. Combination A
consisted of FL (Immunex Corporation, Seattle, WA) at 300 ng/mL, SF
(Amgen, Thousand Oaks, CA) at 300 ng/mL, IL-3 (Novartis, Basel,
Switzerland) at 60 ng/mL, IL-6 (Cangene, Mississauga, Ontario) at 60 ng/mL, and G-CSF (StemCell) at 60 ng/mL. Combination B contained the
same growth factors but each at a 30-fold lower final concentration.
Combination C consisted of FL, SF, and IL-3 only, each at the same
concentration as in combination A. Combination D also consisted of
these 3 growth factors, the IL-3 at the same concentration (60 ng/mL)
but both the FL and SF reduced 30-fold to 10 ng/mL each. TPO
(Genentech, CA) was added at 50 ng/mL. For single-cell cultures,
individual cells were deposited by the single-cell deposition unit of
the FACS directly into the round-bottomed wells of a 96-well microtiter
plate, each of which had been preloaded with 100 µL of the complete
serum-free medium described above plus growth factor combination A or
50 ng/mL TPO, as indicated. The wells were examined immediately after
sorting to confirm the presence of a single cell in each well and then
daily thereafter.
RNA extraction and reverse transcriptase-polymerase chain
reaction analyses
For each sample, a minimum of 2 × 103 cells of
each population to be analyzed were obtained and lysed in 50 µL of
GIT buffer (5 M guanidine isothiocyanate, 20 mM 1,4-dithiothreitol
[DTT], 25 mM sodium citrate [pH = 7.0], 0.5% sarcosyl), and the
nucleic acids in the lysate were then precipitated in ethanol using 4 mg of glycogen as a carrier. For reverse transcription, the procedure of Brady et al40 as modified by Sauvageau et
al41 and Jiang et al42 was used. Briefly, RNA
was redissolved in 5.8 µL of RNase-free water plus 0.2 µL of oligo
(dT) primer (1 µg/mL) (60 mer:
5'CATGTCGTCCAGGCCGCTCTGGACAAAATATGAATTCT24) and heated to 70°C for 10 minutes, quenched on ice, and mixed with 2 µL of 5X RT
buffer (GIBCO/BRL, Grand Island, NY). One microliter of 0.1 M DTT, 0.2 µL of 25 mM (deoxynucleotide triphosphate) dNTPs (GIBCO/BRL), 0.5 µL of placental RNase inhibitor (GIBCO/BRL), 0.5 µg nuclease-free bovine serum albumin (BSA) (Boehringer Mannheim, Laval, Quebec), and
0.5 µL of Superscript II (GIBCO/BRL). The reaction mixtures were
incubated at 42°C for 1 hour and heat inactivated at 70°C for 10 minutes. After ethanol precipitation, the pellet was resuspended in 5.5 µL of tailing solution (1 µL of 5X tailing buffer [GIBCO/BRL]), 0.5 µL of 100 mM dATP, 3.5 µL of water, and 0.5 µL of terminal deoxynucleotidyl transferase (15 U/mL, GIBCO/BRL) for 15 minutes at
37°C and heated to 70°C for 10 minutes. Aliquots of this solution were subjected to a PCR in a solution of 50 mM KCl, 5 mM
MgCl2, 0.5 µg/mL BSA, 1 mM dNTPs, 1 µL of gene 32 (Pharmacia), and 5 units of Taq polymerase (GIBCO/BRL). The
complementary DNAs (cDNAs) were initially amplified for 25 cycles, each
consisting of 1 minute at 94°C, 2 minutes at 55°C, and 10 minutes
at 72°C, except for the first cycle, in which the annealing
temperature was 37°C instead of 55°C. An additional 5 units of Taq
polymerase was then added and a further 25 cycles carried out. This
procedure produces a semiquantitative amplification of the reverse
transcribed total messenger RNAs (mRNAs) present in the original
extract40,41 and has been used previously to discriminate
different transcript levels in various cell populations in which the
small numbers of cells available for analysis preclude the use of
alternative methodologies of mRNA
quantitation.8,40,41,43,44
Southern analysis
The amplified cDNAs were electrophoresed in 1% agarose gels and
transferred to nylon membrane (Hybond-N, Amersham) for hybridization with specific cDNA probes as follows. A full-length cDNA for human FL
was obtained from Immunex. The cDNAs for human IL-1, SF, and TGF-
were provided by Dr K. Humphries (Terry Fox Laboratory, Vancouver, BC,
Canada). The 3' region of human c-kit cDNA corresponding to
4043-base pair (bp) to 4775-bp was cloned from human fetal liver by
RT-PCR, using 5' CAG TAT CTA TAT ATG TGT ATG TAC C 3' as the forward
primer and 5' CTG AAG TAC CTA GAC ATC TAT AAC 3' as the reverse primer.
A 750-bp PCR product was then cloned into a PCR cloning kit
(In-Vitrogen) using the EcoRI site created at the end of
each primer, and the sequence confirmed by automatic DNA sequencing
before being used as a probe. A full-length human flt-3 cDNA was a gift
from Dr D. Birnbaum (Institut Paoli-Calmettes Marseille, France), and
the EcoRI/PstI fragment was used as a probe. The
cDNA for gp130 (pRMHA-3) was obtained from Dr M. Hall (University of
Birmingham, Birmingham, UK) and the EcoRI/BamHI fragment was used as a probe. The cDNAs for the murine G-CSFR, c-myc, Id-1, c-fos, and c-jun were
obtained from Dr P. Reddy (Fels Institute, Philadelphia, PA). For
c-fos and c-jun, cDNAs corresponding to the
nonhomologous regions N-terminal to the basic helix-loop-helix regions
were PCR-amplified using 5' ATG ACT GCA AAG ATG GA 3' and 5' TCA AAA
TGT TTG CAA CT 3' primers for c-jun and 5' GAG ACA GAC CAA
CTA GA 3' and TCA CAG GGC CAG CAG CG 3' primers for c-fos.
The cDNAs for AML-1 and PU.1 were obtained from Dr S. Hiebert
(Vanderbilt University, Nashville, TN) and Dr D. Tenen (Harvard Medical
School, Boston, MA), respectively. The probe for SCL/tal-1 was prepared
by RT-PCR using Tal-F2 (5' ATA GAA TTC CTA AGC CCA TGG GAC AAA TTG C
3') as the forward primer and Tal-R2 (5' AAT GAA TTC ATA CTG TGG CTG
CTT CTC ATT CC 3') as the reverse primer for PCR amplification of the
region between 2654-bp and 3180-bp, followed by DNA sequencing to
verify the probe obtained. For each PCR-amplified probe used, the 3'
coding region was chosen to minimize nonspecific hybridization to
repetitive genomic sequences as determined by hybridization to the
products of control reactions to which no reverse transcriptase was
added. The cDNA for murine c-myb was also obtained from Dr
P. Reddy and the 3' half of the nonhomologous region, excluding the
N-terminal DNA binding domain, was prepared by
SmaI/BamHI digestion. The cDNAs for ets-1 and ets-2 (also from Dr P. Reddy) were digested with EcoRI to
obtain the fragments used as probes. The cDNA for Ki-67 (Kon-21) was obtained from Dr T. Scholzen (Borstel Research Institute, Borstel, Germany) and digested with BamHI/NotI to isolate
the probe used. The cDNA for IL-3R was obtained from Dr T. Kitamura
(University of Tokyo, Tokyo, Japan) and was digested with
XhoI. The cDNA for IL-3 receptor beta chain
(IL-3Rc) was obtained from Dr A. Mui (University of
British Columbia, Vancouver, BC, Canada) and was digested with
BglII/XbaI. The cDNA for IL-6R was obtained from Immunex and was digested with SalI. The glyceraldehyde-3
phosphate dehydrogenase (GAPDH) probe was obtained from Dr G. Krystal
(Terry Fox Laboratory) and prepared by PstI digestion.
For Southern analyses, each filter was hybridized with probes labeled
with 32P using a random primer kit (GIBCO/BRL) and
hybridized for 12 to 16 hours at 45°C in a solution of 40%
formamide, 50 mM NaPO4, 0.5% SDS, 5X SSPE, 5X Denhardt's
solution, 0.25 mg/mL denatured salmon sperm DNA, and 100 mg/mL sodium
dextran. The hybridized filters were then washed at room
temperature in 2X SSC plus 0.1% SDS, followed by consecutive washes in
0.2X SSC plus 0.1% SDS first at 50°C and then at 55°C.
To quantitate each gene-specific signal, the washed filters were
exposed to a phosphoimager screen (Molecular Dynamics, Sunnyvale, CA)
for 2 to 4 hours, scanned in the phosphoimager (Storm 860, Molecular
Dynamics), or autoradiographed for 1 to 2 days, and the signal
quantitated using Molecular Dynamics APPS software. Each
measurement was corrected for the signal level obtained in the
RT control that was hybridized to the same filter under
the same conditions. Filters were then stripped and rehybridized to the GAPDH probe to normalize for the amount of cDNA loaded onto each gel.
For comparisons of transcript levels between fresh and/or cultured
cells from the same tissue sample, each normalized transcript signal
was expressed as a ratio relative to the normalized transcript signal
measured in the reference population (either the corresponding freshly
isolated CD34+CD38 cells or the
CD34+ G0i cells in the cell cycle experiments
with adult BM), which was obtained from the same gel and filter. The
resultant ratios were then averaged, and the standard error of the mean
(SEM) for each data set was calculated. For comparisons of transcript
levels in populations obtained from different tissues (eg,
CD34+CD38 cells from adult BM vs cord blood
vs fetal liver samples), at least one sample of each of the populations
being compared were run on the same gel to control for variations in
the Southern blotting procedure. Normalized transcript signal values
were then expressed as a ratio relative to the average normalized value for the same type of transcript in the adult BM
CD34+CD38 populations assessed. The
Student t test was then used to determine which transcript
signals were significantly different from the reference population with
a P < .05.
| |
Results |
Differences in gene expression in the CD38 and
CD38+ subsets of adult bone marrow
CD34+ cells
To obtain a reference pattern of gene expression in adult BM
CD34+CD38 cells and to test the ability of
the comparative procedure described in the "Materials and methods"
to detect quantitative differences in transcript levels between closely
related, but phenotypically or biologically distinct populations, we
first compared the results obtained from paired CD38 and
CD38+ subsets of CD34+ cells isolated from
several different healthy adult BM samples. This comparison included a
survey of transcripts for various growth factor receptors, ligands and
transcription factors known or anticipated from previous studies to be
involved in the regulation of CD34+ hematopoietic cell
proliferation and differentiation.7,34-36 Transcripts for
TGF-, FL, IL-1, G-CSFR, gp130, IL-3R, IL-6R, flt-3,
c-kit, c-fos, c-jun, Id, AML-1,
SCL/tal-1, PU.1, c-myb, and ets-2 were readily detected,
albeit at variable levels, in all CD34+CD38
adult BM cell isolates examined (n = 5). In contrast, extracts of
these same cells contained very low levels of IL-3Rc and
c-myc transcripts. Figure 1
shows the hybridization results for a representative experiment.
Transcripts for IL-3, IL-6, SF, and ets-1 were not detectable in either
CD34+ subset (data not shown). Comparison of the transcript
levels between the matched pairs of CD34+CD38+
and CD34+CD38 adult BM cells for 19 other
genes analyzed showed a number of consistent differences. As can be
seen in Figure 2, on average, transcripts for TGF-, G-CSFR, gp130, c-fos, and
c-jun appeared approximately 2-fold lower in the
CD34+CD38+ cells, and for IL-3Rc
and c-myc were approximately 3- to 4-fold higher. Expression
of Id in the CD34+CD38+ population also
appeared slightly reduced, although this difference was not
statistically significant (P > .05). Levels of
transcripts for the other 16 genes surveyed appeared to be similar in
both subsets of adult BM CD34+ cells.
View larger version (91K):
[in this window]
[in a new window]
| Figure 1.
Representative analysis of transcripts found in
different populations of primitive adult BM cells.
RNA extracts from purified CD34+CD38
(34+38) and
CD34+CD38+ (34+38+)
adult BM cells and their progeny obtained after 5 days of stimulation
by 2 growth factor combinations (A and B, described in "Materials and
methods") were subjected to semiquantitative RT-PCR, followed by
Southern blot analysis using gene-specific cDNA probes. Each filter was
then stripped and reprobed with a GAPDH probe (not shown) to allow
normalization for cDNA loading.
|
|
View larger version (51K):
[in this window]
[in a new window]
| Figure 2.
Comparative analysis of gene expression
in CD34+ subpopulations from adult BM, cord blood (CB), and
fetal liver (FL).
Panel A shows a representative Southern blot analysis of cDNAs for 7 genes expressed in the matching CD34+CD38 and
CD34+CD38+ subpopulations isolated from 2 different samples of each tissue. Panel B shows the results of a
quantitative comparison of the different levels of transcripts in the
CD38 and CD38+ subsets of CD34+
cells obtained from a total of 3 samples of each different tissue. In
each case the value shown is the mean ± SEM of the normalized
gene-specific transcript levels in the
CD34+CD38+ subset expressed as a fraction of
the levels measured in the matching
CD34+CD38population (set = 1.0) as
described in the "Materials and methods." Panel C shows a
quantitative analysis of the relative levels of expression of the same
genes as shown in panel B but, in this case, comparing the results for
the CD34+CD38 subset in CB and FL with the
CD34+CD38 data from adult BM examined on the
same filter. The result for the CD34+CD38
cells from each sample (panel B) was thus first normalized and then
expressed as a proportion of the average value obtained for all adult
BM CD34+CD38 samples analyzed using the same
probe (average value set = 1.0, n = 5). In panels B and C,
significant differences between the test and the reference population
(P < .05) are indicated by an asterisk (*).
|
|
Differences in gene expression in
CD34+CD38 and
CD34+CD38+ cells as a function of their
ontogenic state
We next examined the RT-PCR products obtained from paired
CD34+CD38 and
CD34+CD38+ cell subpopulations isolated
independently by FACS from several different fetal liver and cord blood
samples. A representative set of filters for 8 of the genes examined is
shown in Figure 2A. Figure 2B shows the differences in transcript
levels observed when the CD38+ and CD38
subsets for both of these tissues were compared using the matched CD38 subset as the reference population in each case.
Cord blood and fetal liver CD34+CD38+ cells
both showed lower levels of transcripts for TGF-, G-CSFR, gp130,
c-fos, and c-jun, and even lower levels of Id
transcripts, but higher levels of IL-3Rc and
c-myc transcripts, relative to the
CD34+CD38 cells in the same sample. These
differences are similar to those seen when
CD34+CD38 and
CD34+CD38+ cells from adult BM are compared.
Levels of transcripts that appeared to be similar in adult BM
CD34+CD38 and
CD34+CD38+ cells (ie, for FL, IL-1,
IL-3R, IL-6R, flt-3, c-kit, AML-1, SCL/tal-1, PU.1,
c-myb, and ets-2) also appeared similar in the corresponding
subsets of CD34+ fetal liver and cord blood cells (data
not shown).
Given the known differences in the biologic properties of
CD34+CD38 cells from fetal liver, cord blood,
and adult BM, it was of interest to also compare the transcript levels
in these phenotypically similar populations. To minimize variability,
RT-PCR products were analyzed on the same filters (eg, Figure 2A) and
transcript levels first normalized to matched GAPDH transcript levels.
A value of 1.0 was then assigned to the average value obtained from the
adult BM CD34+CD38 cell data set and all
other values expressed as a ratio of that value. Figure 2C shows the
individual data points obtained from this analysis. Despite the
considerable intersample variation still observed, significant
differences between the levels of some transcripts in fetal or neonatal
versus adult sources of CD34+CD38 cells could
be discerned. For example, relative to
CD34+CD38 adult BM cells, there were fewer
TGF- transcripts in CD34+CD38 fetal liver
cells, fewer gp130 transcripts in CD34+CD38
cord blood cells, and fewer c-fos and c-jun
transcripts in both. Similarly, transcripts for IL-3Rc
and c-myc appeared to be present at increasingly higher
levels in CD34+CD38 cells from cord blood and
fetal liver, although these latter differences were not statistically
significant. In addition, the 16 genes whose expression had not been
found to be different between the CD38 and
CD38+ subsets of CD34 cells from any particular stage of
development also showed no difference in transcript levels when the
CD34+CD38 subsets from fetal, neonatal, and
adult hematopoietic tissues were compared. The one exception to this
was the increased level of G-CSFR transcripts typical of
CD34+CD38 cord blood and fetal liver cells
relative to their counterparts in adult BM.
Changes in gene expression induced in adult BM
CD34+CD38 cells after growth factor
stimulation
We next asked whether the same genes whose expression was
different between ontogenically distinct sources of
CD34+CD38 cells would also be affected by in
vitro growth factor stimulation of adult BM
CD34+CD38 cells. Accordingly, aliquots of
CD34+CD38 cells from 3 of the same BM samples
used for the ontogenic analyses were cultured in serum-free medium
containing FL, SF, IL-3, IL-6, and G-CSF at 2 different concentrations.
After 5 days, cells were harvested and RNA was extracted. The 5-day
period of culture was chosen anticipating that this might be sufficient
to allow a biologically relevant pattern of altered gene expression to
be established before extensive cell division. The 2 growth factor
combinations used (A and B, as described in "Materials and
methods") had been shown previously to have equivalent mitogenic
activity on adult BM CD34+CD38 cells while
differing by more than 50-fold in their ability to preserve LTC-IC
activity among the progeny generated after 10 days.3
Assessment of transcript levels in the cells that had been cultured
under these conditions for 5 days (Figure 1) revealed similar
quantitative changes in expression of many of the same genes whose
transcript levels had been found to differ between freshly isolated and
CD34+CD38 hematopoietic cells from adult
versus fetal and neonatal sources (Figure 2C), as well as between
internally compared CD34+CD38 and
CD34+CD38+ cells from each of these tissues
(Figure 2B). Specific changes seen included even greater decreases in
TGF-, gp130, c-fos, c-jun, and Id transcripts
and greater increases in c-myc transcripts (Figure
3). In most cases, these differences were
statistically significant (P < .05). In the cultured
cells, IL-3Rc transcripts were also increased but
transcript levels for FL, IL-1, AML-1, SCL/tal-1, and PU.1 were
unchanged. Exposure of adult BM CD34+CD38
cells to the lower concentration of FL, SF, IL-3, IL-6, and G-CSF elicited a number of other changes not seen when freshly isolated CD34+CD38+ and
CD34+CD38 cells were compared. These included
detectable increases in IL-3R, IL-6R, flt-3, and c-kit
transcripts and more pronounced increases in c-myb and ets-2
transcripts.
View larger version (34K):
[in this window]
[in a new window]
| Figure 3.
Quantitative analysis of gene-specific transcript levels
in differently stimulated populations of primitive adult BM cells.
Values were calculated as described in the "Materials and methods"
using adult BM CD34+CD38 cells as the
reference population ( = 1.0). Shown are the mean of analyses of at
least 3 independent BM samples ± SEM. Values that are
significantly different from 1.0 (P < .05) are indicated
by an asterisk (*).
|
|
To assess whether the similarity in gene expression profiles of growth
factor-stimulated CD34+CD38 cells and freshly
isolated CD34+CD38+ cells from adult BM might
lie in the differences in the proliferative activity of these 2 populations by comparison to freshly isolated CD34+CD38 adult BM cells,25,27 a
time course experiment was performed. Two samples of adult BM
CD34+CD38 cells were therefore cultured with
the same growth factor combinations (ie, A and B), and the cells then
harvested for growth transcript analysis after 1, 3, and 5 days of
incubation. In addition, aliquots of the same original cells were
cultured with 2 other growth factor combinations (C and D, described in
the "Materials and methods") and similarly followed. Growth factor
combinations C and D are, like A and B, similarly mitogenic for adult
BM CD34+CD38 cells but optimize and minimize,
respectively, the retention of LTC-IC activity by the stimulated
cells.3 As a further comparison, a time course experiment
was simultaneously performed on adult BM
CD34+CD38 cells cultured in serum-free medium
for up to 5 days in the presence of TPO only. In contrast to the other
4 growth factor cocktails, TPO alone was confirmed by direct visual
analyses of single cell cultures to be poorly mitogenic for adult BM
CD34+CD38 cells over at least 5 days (data
not shown), although during this period, TPO alone is quite efficient
at preserving the viability45 and LTC-IC activity of these
cells.39
Figure 4 shows the results only for the
transcripts whose levels relative to adult BM
CD34+CD38 cells were found to be modulated
during ontogeny (Figure 2) and/or after growth factor stimulation
(Figures 1 and 3). In both of the time course experiments performed,
decreases in G-CSFR, gp130, c-fos, and c-jun
transcripts were already apparent and (except for gp130) were maximal
within 1 day, independent of the growth factor stimulus applied. Most
changes were complete within 3 days; however, the timing of the
decrease in TGF- and Id transcripts and the increase in
c-myc expression appeared more variable and in some
instances delayed. Because very few adult BM
CD34+CD38 cells enter mitosis before the
third day of exposure to any of the growth factors used in these
studies25,27-30 (and data not shown), these results
suggested that the changes in gene expression seen could occur before
cell division.
View larger version (65K):
[in this window]
[in a new window]
| Figure 4.
Time course of changes in gene expression in variously
growth factor-stimulated primitive adult BM cells.
Panel A shows the Southern blot analyses of transcript cDNAs detected
in 2 independent experiments in which FACS-sorted
CD34+CD38 cells were stimulated with one of 5 different growth factor conditions (as shown) and the cells harvested
for RT-PCR analysis at the times indicated. Panel B shows the same data
normalized as described in the "Materials and methods" using the
corresponding starting CD34+CD38 BM cells as
the reference population in each case (values set = 1.0). Each symbol
identifies the results obtained for a different growth factor condition
( , TPO;  , Comb. A;  , Comb. B;  , Comb. C;  ,
Comb. D).
|
|
A next experiment was therefore undertaken to determine whether the
changes in gene expression observed within 1 to 2 days of growth
factor-stimulation of adult BM CD34+CD38
cells could be formally shown to occur even before these cells entered
G1. For this, the method of dual Hst/Py labeling was used to allow the selective isolation by FACS of CD34+ cells in
G0 both before (G0i) and after
(G0') they had been in culture with growth
factor combination A for 40 hours (Figure
5). In these experiments, staining for
CD38 was omitted because isolation of G0
(HstloPylo) cells from within the
PI CD34+CD38 population would
have required a 2-step staining and sorting procedure. The 40-hour
culture interval was chosen to increase the selectivity of the analysis
for CD34+CD38 cells persisting in
G0. Gene expression profiles for the G0
populations isolated before and after culture were then compared.
View larger version (34K):
[in this window]
[in a new window]
| Figure 5.
Hst/Py staining of adult BM CD34+ cells
before and after culture with growth factor combination A.
Lin adult BM cells were labeled with CD34-FITC, Hst and
Py as described in the "Materials and methods," and then the gates
shown were used to isolate the G0
(HstloPylo) fraction (middle panel) from within
the PI CD34+ population (left panel). These
G0i cells were then cultured in serum-free medium
containing FL, SF, IL-3, IL-6, and G-CSF (Comb. A) for 40 hours. The
cells were then restained as before to allow the isolation of the
persisting G0 cells (G0') by FACS separate from
the remaining G1/S/G2/M
(NG0') cells.
|
|
The blots obtained from a representative experiment of this design are
shown in Figure 6A. Relative levels of
all genes surveyed in these studies (using the initial
CD34+ G0 cells as the reference population) are
shown in Figure 6B. Low expression of Ki67 in both populations defined
as G0cells on the basis of Hst/Py staining and increased
expression of Ki67 (on average 4-fold, P < .05) in the
cultured NG0' fraction confirmed the validity of the FACS
gates used to isolate both G0 populations. Interestingly,
TGF-, G-CSFR, gp130, c-myc, c-fos,
c-jun, and Id transcript levels were all significantly
(P < .05) reduced, albeit to variable degrees, in the
persisting G0' cells. Reductions in G-CSFR, gp130,
c-fos, c-jun, and Id transcripts were also seen in the simultaneously harvested, cultured NG0' cells. The
lack of evidence of a similar response with respect to the expression of TGF- and c-myc in the cultured NG0' and
G0' cells is, however, difficult to interpret because of
the wide intersample variation seen in the responses of these 2 particular genes in the NG0' cells. Nevertheless, overall,
many of the changes in gene expression that occur in growth
factor-stimulated CD34+ adult BM cells could be seen to be
induced independently of the timing of their exit from G0.
View larger version (51K):
[in this window]
[in a new window]
| Figure 6.
Analysis of changes in gene expression in growth
factor-stimulated adult BM CD34+ cells remaining quiescent
for 40 hours.
Panel A shows representative blots comparing transcript cDNAs for 9 genes expressed in freshly isolated CD34+ G0
(G0i) cells, cells found to be still in G0
after 40 hours in culture (G0' cells), and the remaining
(NG0') cells. Cells were cultured and isolated as described
in Figure 5 and then RNA extracts were prepared and subjected to
semiquantitative RT-PCR analysis as described in the "Materials and
methods." Panel B shows the same data quantitated and normalized as
in Figure 2, but using the G0i cells as the reference
population in this case (value for each transcript = 1.0 for the
G0i cells). Shown are the mean ± SEM of data from 3 independent experiments in each of which BM cells from a different
individual were used. Values found to be significantly different from
1.0 (P < .05) are indicated by an asterisk
(*).
|
|
| |
Discussion |
It is generally accepted that many features of differentiation and
development will eventually be understood by more complete descriptions
of the changing patterns of gene expression that occur when these
processes take place. Indeed, such studies have already led to the
identification of a number of relevant genes for transcription factors,
as well as genes that encode receptors for ligands that stimulate the
transition of specific cell types from one state to another. In the
hematopoietic system, examples of the former include genes like the
HOX genes that appear to be stage- but not
tissue-specific,46 as well as others like the GATA family,
SCL-/tal-1, AML-1, and PU.1 that are more unique to the
hematopoietic system.35,36 Nevertheless, the mechanisms by
which the products of such genes interact to allow lineage determining
events to occur, and the dynamics of these processes are still
poorly understood.
Progress in the development of technologies for detecting transcript
levels in rare populations33,40,47-49 has begun to make possible the analysis of gene expression patterns in purified subsets
of human hematopoietic cells that are highly enriched in cells with
stem cell activity. In a study reported by Bello-Fernández et
al,50 transcripts for GM-CSFR and
GM-CSFR ( = IL-3Rc), c-kit,
G-CSFR, flt-3, myeloperoxidase, and TNFRI and TNFRII were all
consistently detected in freshly isolated
CD34+Thy-1+ and
CD34+Thy-1 subsets of cord blood cells.
However, differences in levels of these transcripts between the 2 populations were not resolved. Evidence of GM-CSFR ( and ),
c-kit, G-CSFR, and flt-3 on G-CSF mobilized adult
CD34+CD38 cells and of c-kit,
flt-3, and IL-1R expression by freshly isolated adult BM
CD34+CD38 cells has also been obtained from
ligand-binding studies.51,52 Scadden and
colleagues43,53 surveyed the changes in the expression profiles of many of these as well as a number of other genes associated with hematopoietic cell differentiation. However, their initially isolated CD34+CD38 cells had been exposed to
various growth factors for at least 2 days before the first analysis.
Nevertheless, their studies were able to document the additional
presence of transcripts for GM-CSFR, c-kit,
gp130, IL-6R, IL-1R, G-CSFR, SCL, GATA-1 and GATA-2, NF-E2, PU.1,
AML1, and C/EBP, but not IL-3Rc ( = GM-CSFR),
erythropoietin receptor (EPOR), or c-MPL. In a recent report, we showed
that neither freshly isolated adult BM
CD34+CD45RA CD71cells nor the
CD34+CD45+ and/or CD71+ cells
contain detectable transcripts for IL-3, IL-6, SF, GM-CSF, G-CSF, or
TPO.42 Thus, there is a growing body of information about
which genes may (or may not) be expressed in primitive human hematopoietic cells from different sources and enriched to varying degrees in their stem cell content. Nevertheless, a systematic quantitative comparison of transcript levels in such samples has been lacking.
In the current study, we have used a semiquantitative
procedure33 to address this question and to test the
hypothesis that primitive hematopoietic cells from fetal and neonatal
tissues might display a pattern of gene expression exhibited by their adult counterparts after a period of growth factor stimulation. Initially, we confirmed and extended previous surveys of gene expression in primitive human hematopoietic cells by demonstrating an
absence of IL-3, IL-6, and SF transcripts, and the presence of low, but
detectable levels of IL-3Rc transcripts, in addition to
readily detectable levels of transcripts for TGF-, G-CSFR, gp130,
IL-6R, flt-3, c-kit, SCL/tal-1, PU.1, and AML1 in
highly purified CD38+ and CD38 subpopulations
of CD34+ cells obtained from human fetal liver, cord blood,
and adult BM. Our current findings also provide the first documentation of detectable levels of mRNA for the transcription factors:
c-myb, c-fos, c-jun, Id, ets-2, and
the growth factors: FL and IL-1, and low to detectable levels of
c-myc in each of these primitive human hematopoietic cell
populations. Internal comparisons of the relative levels of particular
transcripts in the CD38+ and CD38 fractions
of CD34+ cells from human fetal liver, cord blood, and
adult BM revealed remarkably consistent differences between the 2 populations in each case. In fact, most of the 23 genes studied showed
little or no evidence of a change in the expression between these 2 subpopulations. However, transcripts for TGF-, G-CSFR, gp130,
c-fos, c-jun, and Id were generally lower in the
CD38+ population, and for c-myc and
IL-3Rc, were usually higher. Taken together, these
results demonstrate the presence of detectable transcripts in the most
primitive hematopoietic cells of many genes generally considered
specific to hematopoietic cell differentiation. In addition, they
underscore the likely importance of quantitative changes in the
expression of these genes in the mechanisms by which the biologic
status of primitive hematopoietic cells is altered.8,43
Consistent with this prediction was the finding that the expression of
many of the genes affected by CD34+CD38 cell
differentiation into CD34+CD38+ cells in vivo
is altered, and in a similar fashion, when adult BM
CD34+CD38 cells are mitogenically stimulated
by growth factors in vitro. Interestingly, this was found to be the
case for all 5 growth factor cocktails tested, even though these vary
markedly in their mitogenic and differentiation promoting activities on
CD34+CD38 adult BM cells, although all
support the viability of these cells.3,45 Moreover, the
common changes in transcript levels seen in these variously stimulated
CD34+CD38 adult BM cells could be detected
before most of the original cells had completed a first division (ie,
within 3 days) and were also detectable in CD34+ cells that
had been exposed to growth factors for 2 days but were not yet ready to
exit G0. Thus, genes whose level of expression in
CD34+CD38 cells is modulated during ontogeny
appear to overlap extensively with "early response" genes of growth
factor-stimulated primitive adult hematopoietic cells.
These findings provide transcriptional evidence to support the concept
that primitive fetal hematopoietic cells and, to a lesser extent, their
neonatal derivatives, show features of an activated state relative to
their CD34+CD38 counterparts in adult BM. The
extent to which this is causally related to potential differences in
the microenvironmental characteristics of fetal and adult hematopoietic
tissues is not yet clear. Alternative, although not necessarily
mutually exclusive, explanations would include the possibilities that
fetal and adult gene expression programs are, at least to some extent,
predetermined, or that the regulated expression of a
CD34+CD38 phenotype during development may
not be as tightly linked to the differentiation status of primitive
hematopoietic cells as has been assumed. Nevertheless, the current
observations do suggest that the different cytokine response behavior
of primitive adult and fetal/neonatal hematopoietic cells is unlikely
to be explained solely by differences in ligand and/or receptor
expression. An alternative possibility would be that the signaling
status of these cells, or key downstream targets such as
c-fos, c-jun, and c-myc, are
present in these cells at different levels. With the rapidly emerging
capacity to extend the type of study performed here to all genes
expressed in human hematopoietic stem cells, more extensive comparison
of the differences between fetal and adult human cells should allow
this concept to be more rigorously examined.
The nature of the current analysis unfortunately makes it difficult to
infer a specific role for any of the changes in gene expression
observed. However, in light of published evidence that endogenous
TGF- production may serve as an autocrine inhibitor of primitive
hematopoietic cell proliferation,54-56 it might be speculated that a down-regulation of TGF- transcripts could play a
necessary, although perhaps not sufficient, role in promoting the exit
of adult CD34+CD38 cells out of a
G0 state. This would be consistent with our observation that TGF- mRNA levels were highest in unmanipulated
CD34+CD38 BM cells. It is also interesting to
note that the forced expression of c-fos in primitive murine
hematopoietic cells has been found to inhibit their cell cycle
progression.57 These latter findings are consistent with
the present observation that c-fos transcripts are highest
in a subset of primitive hematopoietic cells that are relatively
resistant to growth factor activation (ie, adult BM
CD34+CD38 cells). Finally, it is interesting
to note that our studies did not reveal any changes in gene expression
that appeared to correlate with the retention/loss of the primitive
functional status of the cells analyzed, as inferred from previously
documented changes in the LTC-IC activity of adult BM
CD34+CD38 cells cultured under the same
conditions as used here.3 Accordingly, it might be argued
that changes in the expression of the genes analyzed in this study do
not represent steps in the process by which hematopoietic stem cell
differentiation decisions are determined. This would not, of course,
preclude a potentially important |
Top
Abstract
Introduction