|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMATOPOIESIS
From the National Human Genome Research Institute,
National Institutes of Health, Bethesda, MD; Howard Hughes Medical
Institute, Children's Hospital, Boston, MA; and National Institute of
Child Health and Human Development, National Institutes of Health,
Bethesda, MD.
Mammalian CBFB encodes a transcription factor (CBF Hematopoiesis is a complex and tightly regulated
process with concordant expression of genes involved in
differentiation, proliferation, and apoptosis.1-4 Recent
studies have indicated the importance of a series of transcription
factors during hematopoiesis. These transcription factors regulate
expression of lineage-specific genes, and many of them are
indispensable for embryonic and adult hematopoiesis.5
Moreover, some of these transcription factors, when mutated through
chromosomal translocations, contribute to the pathogenesis of
hematologic malignancies.6
CBFB (also called PEBP2B) encodes a
transcription factor (CBF Two CBFB homologs, called Brother (Bro) and
Big brother (Bgb), exist in
Drosophila.17 Similar to mammalian CBF GATA-1 and SCL are 2 other transcription factors that play important
roles in hematopoiesis. The zinc finger protein GATA-1 has been shown
to be a central regulator of erythroid differentiation.19 The cognate binding sequence (A/T)GATA(A/G) is present in the regulatory sequences of many erythroid-specific genes, and murine knockout experiments demonstrated that GATA-1 is specifically required
for the maturation of proerythroblasts of both primitive and definitive
hematopoiesis.20 On the other hand, SCL is a transcription
factor with a basic helix-loop-helix motif and is expressed in stem
cells or early progenitors as well as in erythroid cells, mast cells,
and megakaryocytes.21 In murine knockout models, removal
of Scl results in blockage of all lineages in both embryonic
(primitive and definitive) and adult hematopoiesis.22 In
vitro differentiation with embryonic stem cells confirmed that Scl is required for hematopoietic differentiation at the
multipotent stem cell level.23 In addition, recent studies
in zebrafish suggest that scl is expressed in the
so-called "hemangioblasts," which are capable of both hematopoietic
and vascular differentiation.24
Animal model studies reported so far suggest that SCL is probably the
earliest transcriptional regulator of hematopoiesis, whereas GATA-1 is
a late transcription factor that determines specific lineages. CBF Zebrafish is a vertebrate model organism that has attracted significant
attention in recent years because of its many advantageous features for
genetic and developmental studies.25,26 Zebrafish is
particularly useful for studies of embryonic hematopoiesis because of
the easy access and analysis of transparent external developing
embryos. Moreover, the availability of many hematopoietic mutant fish
lines,27,28 and the potential of generating additional mutants through random mutagenesis, makes it possible to dissect hematopoietic pathways with unprecedented depth and detail.
Here we report the cloning of a zebrafish cbfb gene. The
zebrafish cbfb gene is more similar to mammalian
CBFB/Cbfb genes than to Drosophila
Bro/Bgb genes at both DNA and protein levels. The
encoded zebrafish cbf Zebrafish strains and maintenance
Cloning and sequencing of zebrafish cbfb cDNA
and promoter
Linkage group assignment The T51 radiation-reduced zebrafish/hamster hybrid panel (Research Genetics, Huntsville, AL) was used to map cbfb by polymerase chain reaction (PCR).34 PCR was performed with an annealing temperature of 60°C and 31 cycles of amplification using the forward primer ATAAGAATGCGGCCGCTAACTATGGGAAGTGGGAACATATCCAACC and the reverse primer GGACTAGTCCAGAAGAGTGAAGCGTTGCCTTG. The PCR results were sent to Robert Geisler at MPI fuer Entwicklungsbiologie, Tuebingen, Germany, for linkage group assignment.In situ hybridization Zebrafish embryos were dechorionated with protease (P8811, Sigma, St Louis, MO) prior to fixation. The probe for hybridization was generated by digestion of the cbfb cDNA with EcoRI and incorporation of digoxigenin-UTP by in vitro transcription with T7 polymerase using DIG RNA Labeling Mix (Boehringer Mannheim, Indianapolis, IN). In situ hybridization was performed according to standard procedure29 at 55°C with the following modifications: Block solution was 2% blocking reagent (Boehringer Mannheim) with 5% lamb serum (Life Technologies, Rockville, MD) in 0.1 mol/L maleic acid and 150 mmol/L NaCl, pH 7.5, and signal was detected with BM Purple AP Substrate (Boehringer Mannheim). Zebrafish gata-1 and scl probes have been described.24,35For hematopoietic mutants, embryos produced by crosses between heterozygous males and females were used for in situ hybridization. At least 20 embryos were scored in each hybridization, and the results were consistent with approximately 25% of the embryos being homozygous mutants. Gel electrophoretic mobility shift assay The 18-bp fragment containing the high-affinity (HA) core site33 was prepared by annealing 2 oligonucleotides (5'-GGATATTTGCGGTTAGCA-3' and 5'-TGCTAACCGCAAATAT-3') such that 2 Gs were left protruding at the 5' end of the sense strand in the double helix. The HA-containing oligo was 32P-labeled by filling in the ends in the presence of [ -32P] dCTP and Klenow enzyme. The labeled DNA was
purified with the G25 spin column (5Prime  3Prime, Inc, Boulder,
CO) and used for gel shift analysis. Proteins used in the
assays were in vitro-translated in the absence of any radioisotope
using the Promega in vitro translation kit. The DNA binding reaction
typically consisted of approximately 5 ng (10 000 cpm) of radiolabeled
DNA fragment, 0.5 to 1 µg of poly dI-dC, and 5 to 10 µL of in
vitro-translated proteins in 1 × binding buffer.16,36
The binding reaction was incubated for 30 minutes at room temperature
and then electrophoresed in a 6% polyacrylamide gel. The gel was
subsequently dried and autoradiographed.
Immunoprecipitation CK933 and cbfb plasmids were translated in vitro with 35S-labeled methionine using the Promega in vitro translation kit (Promega, Madison, WI); pCbfa216 was translated in vitro without radioactive methionine. Immunoprecipitation was carried out as described previously.16 Briefly, protein A Sepharose-plus (Pierce, Rockford, IL) was washed with phosphate-buffered saline (PBS) and then blocked with 2% bovine serum albumin in phosphate-buffered saline. A total of 30 µL of the blocked protein A was incubated with antibody3043 for 2 hours at 4°C on a
rotator and then washed twice with Triton buffer. The protein A beads
were incubated overnight at 4°C with 35S-labeled human
CBF and zebrafish cbf in the presence or absence of unlabeled in
vitro-translated CBF2. The Sepharose beads were collected by
centrifugation and washed with Triton buffer 4 times. The beads were
resuspended and boiled for 5 minutes in 25 µL of 2 × sodium dodecyl
sulfate buffer. A total of 10 µL of this buffer containing the eluted
proteins was analyzed by denaturing polyacrylamide gel electrophoresis
and autoradiography.
Immunochemical staining of fish embryos Antibody staining was performed as described37 subsequent to in situ hybridization. Briefly, after in situ hybridization, embryos were washed several times and incubated for more than 1 hour in blocking solution (5% goat serum in PBT [PBS with 0.1% Tween-20]). Embryos were then incubated with a mouse anti-HNK-1 antibody (anti-HNK-1/N-CAM; Sigma) overnight at 4°C. Washes with PBT were performed at room temperature for 3 times at 5 minutes each and 3 times at 30 minutes each. Secondary antibody staining was carried out using biotinylated antimouse IgM and the Vectastain avidin/biotin/horseradish peroxidase ABC Elite System (Vector Laboratories, Burlingame, CA). Embryos stained with antibody were kept in 70% glycerol.
Isolation of zebrafish cbfb cDNA A random-primed zebrafish kidney cDNA library24 was screened by filter hybridization with a human CBFB cDNA probe CK9 under low-stringency conditions. One positive clone was identified from the library, which contains a 2.7-kb insert that was fully sequenced. Sequence analysis revealed an open-reading frame encoding a protein of 187 amino acids, the same size as that encoded by the longest alternatively spliced transcript of human CBFB. Sequence comparison analysis indicates that the deduced protein sequence is very similar to those of the human and mouse CBF
proteins (87% identity) and, to a lesser degree, the
Drosophila Brother and Big Brother proteins (around 47%
identity) (Figure 1). Therefore, this
cDNA contains a zebrafish cbfb gene.
cDNA sequence analysis Of the total 187 amino acid positions of the cbf protein
sequence, 163 are identical to those of the longest splicing variant of
the human and the mouse CBF proteins. Among the 24 amino acids that
are different between human and zebrafish, 10 are conserved changes.
Most of these 24 amino acids are clustered in 3 regions of the protein:
8 between amino acids 72 and 92, 3 between amino acids 163 and 166, and
5 between amino acids 178 and 187. Interestingly, amino acids 72 to 92 encompass a loop between -sheets 3 and 4,38 where there
is virtually no sequence homology among different species (Figure 1).
Amino acids 163 to 166 and 178 to 187 are in the C-terminal region of
the protein that is not required for binding with CBF
proteins.10,39 Therefore, these amino acid differences are
not expected to affect the ability of the zebrafish cbf protein to
bind with CBF. The overall sequence similarities between the
zebrafish protein and the Drosophila Brother and Big brother
proteins are much reduced. The amino acid sequence similarities between
the Drosophila proteins and those of the vertebrates are mostly clustered in amino acids 1 to 68 and 87 to 140 (Figure 1),
suggesting that those regions of the protein are crucial for its function.
At the DNA level, cbfb is also highly similar to the human CBFB gene (76% identical) and to the mouse Cbfb gene (78% identical) in the coding region. The isolated cDNA clone also contains about 330 bp 5'- and 1.8 kb 3'-untranslated region (UTR) sequences. The 5'- and 3'-UTR sequences do not contain obvious homology to the human 5'- and 3'-UTR sequences, although both human and zebrafish 3'-UTRs are very long and AT-rich (67% AT for the human gene and 63% for the zebrafish gene). Additional 5' upstream sequence of the cbfb gene was
obtained by sequencing a PAC clone that was isolated by screening a
zebrafish PAC library with the cbfb cDNA probe. The PAC
clone (PAC 197) was sequenced for over 1 kb by primer-walking starting
from exon 1. In total, 836 bp 5' from the beginning of the cDNA was
obtained by sequencing this PAC (data not shown). A cluster of
tetranucleotide repeats, including (CCAT)12,
(CTAT)8, (CTAT)17, and (CTGT)18, was discovered between Chromosome mapping The T51 zebrafish hybrid mapping panel34 was typed by PCR designed to amplify the 5'-UTR of cbfb. Analysis of the PCR data indicates that cbfb is located between 34.2 and 38 cM from the top of linkage group 18, with a significant LOD score of 15.23 (a LOD score > 6 indicates significant linkage). LOD scores and relative positions of genes in the region are shown in Figure 2. The flanking genes for cbfb are wnt2 and mef2a (12 and 5 cR from cbfb, respectively). The human CBFB gene is located on chromosome 16,14 whereas the human homologs of wnt2 and mef2a are located on chromosomes 740 and 15,41 respectively. Therefore, no apparent synteny exists between this region of the zebrafish genome and a corresponding region of the human genome.
Zebrafish cbf and Drosophila Bro and Bgb proteins
are able to bind mammalian CBF proteins and enhance their DNA
binding affinity.9,10,17 To test if the zebrafish cbf
protein has a similar function, we produced zebrafish cbf protein by
in vitro translation from the cbfb cDNA clone and used it in
immunoprecipitation and electrophoretic mobility shift assays. In these
assays cbf was able to associate with CBF2 and enhance its DNA
binding affinity as efficiently as the human CBF protein (Figure
3). Therefore, zebrafish cbf protein
functions similarly to human CBF with respect to association
with CBF.
Expression pattern in wild-type fish embryos Expression of cbfb during zebrafish embryogenesis was analyzed by Northern blot hybridization and RNA in situ hybridization. By Northern blot hybridization, cbfb expression was observed starting at the 3-somite stage, continued through at least 2 days postfertilization, and was also detected in adults (Figure 4A). The size of the detected transcript is 5 kb, indicating that our cDNA is not complete and suggesting that cbfb contains additional 5' or 3' flanking sequences, similar to the human CBFB gene14 (Karla Henning and P.P.L., unpublished results, 2000).
By in situ hybridization, cbfb expression was observed in embryos of 10 hours postfertilization (hpf), as 2 stripes along the lateral plate mesoderm in both the anterior and posterior ends of the embryo body (Figure 4B, red arrowhead). By the 10-somite stage, 2 pairs of symmetrically distributed cbfb expression stripes were observed along the anterior-posterior axis of the embryo (Figure 4C-D). The inside pair of expression stripes is in the Rohon-Beard cells (black arrow; see below for more discussion), whereas the outside pair of expression stripes is in the lateral plate mesoderm (red arrowhead). This expression of cbfb in the lateral plate mesoderm is
very similar to the expression pattern of scl at these early
stages of development, and these mesoderm stripes have been suggested to contain precursors of hematopoietic cells24 (Figure
5A,B,E,F, red arrowheads).
By 21 to 24 hours, cbfb expression was detected in the intermediate cell mass (ICM), a structure formed when the lateral plate mesoderm from each side of the embryo converges to the midline, where hematopoiesis takes place during this period of embryo development42 (Figure 4E-G, red arrowheads). Expression of cbfb was stronger in the posterior region of the ICM and was detected in a subset of large, round cells that also expressed scl (Figure 5C,D,G,H). The morphology of the cells suggests that they are hematopoietic. From 10-somite stage to 24 hpf, nervous system expression of cbfb
was observed in the retina (Figure 4F, blue arrow), 3 pairs of
cranial nerve ganglia (Figure 4C,E,F, blue arrowheads), and a subset of
cells within bilateral stripes of the neural tube, extending from the
hindbrain to the tail (Figure 4C-H, black arrows). These bilateral
stripes were shown to be Rohon-Beard sensory neurons by immunostaining
for HNK-1, a neuronal marker, and examining the morphology of the
stained cells (Figure 6A). The cbfb
is expressed at higher levels in some Rohon-Beard sensory neurons
than others (Figure 6A). Expression of cbfb in the
Rohon-Beard cells was decreased in narrowminded (Figure
6B,C), a mutant with reduced number of early neural crest cells and
Rohon-Beard cells.43 In addition, cbfb
expression was observed in the pectoral fin buds by 24 hours (Figure
4G,H, black arrowheads).
By 2 days postfertilization (Figure 4I), the expression of cbfb in the Rohon-Beard cells has disappeared, and neuronal expression can be observed in the retina, forebrain, and hindbrain. The cbfb is also expressed in branchial arches and the jaw at this time of development. Expression pattern in hematopoietic mutants To verify the expression of cbfb during zebrafish hematopoiesis, the expression pattern of cbfb in several blood mutants was analyzed by in situ hybridization using embryos at 24 hpf.Three mutants were used in the study: cloche (m378), vampire (m62), and m683. Cloche is a recessive lethal mutation with defects in both hematopoiesis and vasculogenesis.31 Vampire and m683 are recessive lethal mutations that result in no or very few blood cells during embryo development, whereas blood vessels and other tissues formed normally27 (B.M.W., unpublished results, 1998). Recent studies suggest that the cloche mutation results in an early blockage at the hemangioblast level.24,44 Even though there have been no published in-depth studies on mutants vampire and m683, their early bloodless phenotype suggests defects at the stem/progenitor cell level. Expression of both scl and gata-1 was lost in the
ICM of the vampire mutant embryos except for a few cells in
the posterior ICM (Figure 7D,F). In the
m683 mutant embryos, scl expression was retained
whereas gata-1 expression was lost (Figure 7G,I). We also
confirmed the previously published findings in the cloche mutant that expression of both scl and gata-1 is
absent from the anterior and trunk ICM, whereas a few scattered cells
persist in the posterior ICM (Figure 7J and data not shown).
Similar to scl, expression of cbfb was significantly decreased in the ICM of the cloche and vampire mutant embryos, except for a few scattered cells in the posterior ICM (Figure 7E,K), but was unaffected in m683 (Figure 7H). Expression of cbfb in other tissues was not affected in the cloche mutant embryos (Figure 7K). On the other hand, cbfb expression in the trunk Rohon-Beard cells was lost in the vampire mutant embryos (Figure 7E). To determine if this loss of cbfb expression is due to change in transcriptional regulation or loss of Rohon-Beard cells, vampire embryos were stained with the neuronal marker HNK-1. As shown in Figure 6D-E, the number of Rohon-Beard cells was decreased in the trunk region of the vampire mutant embryo, whereas their number remained the same in the caudal region. This pattern is consistent with that of cbfb expression in this mutant, suggesting that trunk Rohon-Beard cells are selectively lost in this mutant.
In this study we isolated the zebrafish cbfb gene and
analyzed its expression pattern during embryogenesis, both in wild-type and in several hematopoietic mutants. Sequence analysis revealed a very
high level of sequence identity between cbf Embryonic expression of the mammalian CBFB/Cbfb genes has not been studied in detail. In the only reported study of Cbfb expression during mouse embryonic development, Cbfb was found to be expressed in the telencephalon, cranial nerve ganglia, and the dorsal root ganglia in 11.5 days postcoitum embryos.11 In addition, faint expression in the fetal liver was observed at 11.5 days postcoitum. Expression of Cbfb during other stages of embryonic development was not analyzed. In this study we examined the expression of cbfb during zebrafish embryonic development at several stages. We found that cbfb is expressed in the organs of zebrafish that are anatomically or developmentally similar to the murine organs that express Cbfb. These include the brain, cranial nerve ganglia, and the Rohon-Beard cells (which are related to neural crest cells that gave rise to both dorsal root and cranial nerve ganglia). Expression of cbfb was also found in the fin buds, retina, branchial arches, and the jaw, suggesting potential roles of cbfb in the development of those tissues. More importantly, expression of cbfb in hematopoietic tissues was observed clearly, starting in the lateral plate mesoderm, where hematopoietic precursors are formed, to the ICM, where embryonic hematopoiesis takes place. The observation that such cbfb expression in ICM was lost or decreased in known hematopoietic mutants confirmed that cbfb was expressed in the hematopoietic cells. In addition, cbfb might be expressed in endothelial cells in the ICM region, based on the distribution of cbfb-expressing cells in ICM. The expression of cbfb in Rohon-Beard cells is very
prominent in embryos at 24 hpf. Rohon-Beard cells are sensory neurons that are present only during embryogenesis and young adult life. Not
present in mammalian species, Rohon-Beard cells are closely related
developmentally to neural crest cells in higher
vertebrates.43 In this regard, it is interesting that
xaml, a Xenopus homolog of the human
CBFA2 gene, is also expressed in the Rohon-Beard cells.45,46 This would suggest that CBF genes play some
role in the development of Rohon-Beard cells. Dorsal root and cranial nerve ganglia (both neural crest cell derivatives) are also sites of
murine Cbfb expression and sites of frequent hemorrhage in Cbfb An interesting finding in this study is the concordant loss of cbfb expression in ICM and Rohon-Beard cells in the hematopoietic mutant vampire. The loss of cbfb expression in Rohon-Beard cells in mutant vampire is surprising because Rohon-Beard cells were not known to play any role during hematopoiesis. One explanation for our observation is that the vampire gene controls cbfb expression in both ICM and the Rohon-Beard cells. Another explanation is that the vampire gene controls development and growth/survival of both cell types. Our data showing that trunk Rohon-Beard cells are lost in the vampire mutant support the second explanation. Studying gene expression in zebrafish hematopoietic mutants can potentially subdivide those mutants even though they share the same bloodless phenotype. The mutations in cloche and vampire likely affect genes required at early stages of hematopoiesis, because expression of all 3 genes studied here are abolished or decreased. On the other hand, the mutation in m683 likely affects a lineage-specific gene because scl and cbfb expression is unaffected in this mutant, whereas gata-1 expression is missing. Based on the findings in this paper, we can propose that
cbf genes are involved in the early stages of hematopoiesis,
at a similar level as that for scl (Figure
8). Studying additional hematopoietic
mutants may help separate scl and cbfb. The
expression of cbfb in the lateral plate mesoderm in early
fish embryos and the expression pattern of cbfb in the ICM
also suggest that cbfb might be expressed in hemangioblasts
and endothelial cells as well. This needs to be further explored
by studying cbfb expression in angiogenesis mutants.
In conclusion, we have identified the zebrafish cbfb gene that shares very high sequence identity with the mammalian CBFB/Cbfb genes. The zebrafish cbfb gene is expressed in hematopoietic tissues during zebrafish embryonic development as well as in Rohon-Beard cells and several other tissues. The results of gene expression patterns in hematopoietic mutants help to dissect the mechanisms of embryonic hematopoiesis further and reveal unexpected connections between hematopoiesis and neuronal development.
We thank Karla Henning for the sequence of the human CBFB promoter region; Susan Lyons, Bixiong Xu, and other lab members for helpful discussions and technical assistance; Pachiappan Manickam for the zebrafish RNA blot; and Alan Davidson for helpful discussions and for sharing scl expression data. We thank David Bodine for critical reading of the manuscript and Robert Geisler for radiation hybrid mapping data analysis.
Submitted June 16, 2000; accepted August 23, 2000.
The cDNA and the 5' flanking sequences of the zebrafish cbfb gene reported in this manuscript have been deposited in the GenBank (accession numbers AF278758 and AF278759, respectively).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Pu Paul Liu, NHGRI, NIH, 49 Convent Dr, Rm 3A18, Bethesda, MD 20892; e-mail: pliu{at}nhgri.nih.gov.
1. Orkin SH. Development of the hematopoietic system. Curr Opin Genet Dev. 1996;6:597-602[Medline] [Order article via Infotrieve]. 2. Alexander WS. Cytokines in hematopoiesis. Int Rev Immunol. 1998;16:651-682[Medline] [Order article via Infotrieve]. 3. Metcalf D. The molecular control of hematopoiesis: progress and problems with gene manipulation. Stem Cells. 1998;16:314-321[Medline] [Order article via Infotrieve].
4.
Wickremasinghe RG, Hoffbrand AV.
Biochemical and genetic control of apoptosis: relevance to normal hematopoiesis and hematological malignancies.
Blood.
1999;93:3587-3600
5.
Shivdasani RA, Orkin SH.
The transcriptional control of hematopoiesis.
Blood.
1996;87:4025-4039
6.
Look AT.
Oncogenic transcription factors in the human acute leukemias.
Science.
1997;278:1059-1064
7.
Liu PP, Hajra A, Wijmenga C, Collins FS.
Molecular pathogenesis of the chromosome 16 inversion in the M4Eo subtype of acute myeloid leukemia.
Blood.
1995;85:2289-2302 8. Speck NA, Stacy T, Wang Q, et al. Core-binding factor: a central player in hematopoiesis and leukemia. Cancer Res. 1999;59:1789s-1793s.
9.
Wang S, Wang Q, Crute BE, Melnikova IN, Keller SR, Speck NA.
Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor.
Mol Cell Biol.
1993;13:3324-3339 10. Ogawa E, Inuzuka M, Maruyama M, et al. Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha. Virology. 1993;194:314-331[Medline] [Order article via Infotrieve]. 11. Wang Q, Stacy T, Miller JD, et al. The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo. Cell. 1996;87:697-708[Medline] [Order article via Infotrieve].
12.
Sasaki K, Yagi H, Bronson RT, et al.
Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor beta.
Proc Natl Acad Sci U S A.
1996;93:12359-12363
13.
Niki M, Okada H, Takano H, et al.
Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer binding protein 2/core binding factor.
Proc Natl Acad Sci U S A.
1997;94:5697-5702
14.
Liu P, Tarle SA, Hajra A, et al.
Fusion between transcription factor CBF beta/PEBP2 beta and a myosin heavy chain in acute myeloid leukemia.
Science.
1993;261:1041-1044 15. Castilla LH, Wijmenga C, Wang Q, et al. Failure of embryonic hematopoiesis and lethal hemorrhages in mouse embryos heterozygous for a knocked-in leukemia gene CBFB-MYH11. Cell. 1996;87:687-696[Medline] [Order article via Infotrieve].
16.
Adya N, Stacy T, Speck NA, Liu PP.
The leukemic protein core binding factor beta (CBFbeta)-smooth-muscle myosin heavy chain sequesters CBFalpha2 into cytoskeletal filaments and aggregates.
Mol Cell Biol.
1998;18:7432-7443 17. Golling G, Li L, Pepling M, Stebbins M, Gergen JP. Drosophila homologs of the proto-oncogene product PEBP2/CBF beta regulate the DNA-binding properties of Runt. Mol Cell Biol. 1996;16:932-942[Abstract]. 18. Li LH, Gergen JP. Differential interactions between Brother proteins and Runt domain proteins in the Drosophila embryo and eye. Development. 1999;126:3313-3322[Abstract]. 19. Simon MC. Transcription factor GATA-1 and erythroid development. Proc Soc Exp Biol Med. 1993;202:115-121[Medline] [Order article via Infotrieve]. 20. Pevny L, Simon MC, Robertson E, et al. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature. 1991;349:257-260[Medline] [Order article via Infotrieve].
21.
Begley CG, Green AR.
The SCL gene: from case report to critical hematopoietic regulator.
Blood.
1999;93:2760-2770 22. Shivdasani RA, Mayer EL, Orkin SH. Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL. Nature. 1995;373:432-434[Medline] [Order article via Infotrieve]. 23. Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell. 1996;86:47-57[Medline] [Order article via Infotrieve].
24.
Liao EC, Paw BH, Oates AC, Pratt SJ, Postlethwait JH, Zon LI.
SCL/Tal-1 transcription factor acts downstream of cloche to specify hematopoietic and vascular progenitors in zebrafish.
Genes Dev.
1998;12:621-626 25. Driever W, Stemple D, Schier A, Solnica-Krezel L. Zebrafish: genetic tools for studying vertebrate development. Trends Genet. 1994;10:152-159[Medline] [Order article via Infotrieve]. 26. Eisen JS. Zebrafish make a big splash. Cell. 1996;87:969-977[Medline] [Order article via Infotrieve]. 27. Weinstein BM, Schier AF, Abdelilah S, et al. Hematopoietic mutations in the zebrafish. Development. 1996;123:303-309[Abstract]. 28. Ransom DG, Haffter P, Odenthal J, et al. Characterization of zebrafish mutants with defects in embryonic hematopoiesis. Development. 1996;123:311-319[Abstract]. 29. Westerfield M. The Zebrafish Book. 3rd ed. Eugene, OR: University of Oregon Press; 1995.
30.
Riley BB, Grunwald DJ.
Efficient induction of point mutations allowing recovery of specific locus mutations in zebrafish.
Proc Natl Acad Sci U S A.
1995;92:5997-6001 31. Stainier DY, Weinstein BM, Detrich HW III, Zon LI, Fishman MC. Cloche, an early acting zebrafish gene, is required by both the endothelial and hematopoietic lineages. Development. 1995;121:3141-3150[Abstract]. 32. Driever W, Solnica-Krezel L, Schier AF, et al. A genetic screen for mutations affecting embryogenesis in zebrafish. Development. 1996;123:37-46[Abstract].
33.
Liu P, Seidel N, Bodine D, Speck N, Tarle S, Collins FS.
Acute myeloid leukemia with Inv (16) produces a chimeric transcription factor with a myosin heavy chain tail.
Cold Spring Harb Symp Quant Biol.
1994;59:547-553 34. Geisler R, Rauch GJ, Baier H, et al. A radiation hybrid map of the zebrafish genome. Nat Genet. 1999;23:86-89[Medline] [Order article via Infotrieve].
35.
Detrich HW III, Kieran MW, Chan FY, et al.
Intraembryonic hematopoietic cell migration during vertebrate development.
Proc Natl Acad Sci U S A.
1995;92:10713-10717
36.
Adya N, Zhao LJ, Huang W, Boros I, Giam CZ.
Expansion of CREB's DNA recognition specificity by Tax results from interaction with Ala-Ala-Arg at positions 282-284 near the conserved DNA-binding domain of CREB.
Proc Natl Acad Sci U S A.
1994;91:5642-5646
37.
Solnica-Krezel L, Driever W.
Microtubule arrays of the zebrafish yolk cell: organization and function during epiboly.
Development.
1994;120:2443-2455 38. Huang X, Peng JW, Speck NA, Bushweller JH. Solution structure of core binding factor beta and map of the CBF alpha binding site. Nat Struct Biol. 1999;6:624-627[Medline] [Order article via Infotrieve].
39.
Kagoshima H, Akamatsu Y, Ito Y, Shigesada K.
Functional dissection of the alpha and beta subunits of transcription factor PEBP2 and the redox susceptibility of its DNA binding activity.
J Biol Chem.
1996;271:33074-33082 40. Wainwright BJ, Scambler PJ, Stanier P, et al. Isolation of a human gene with protein sequence similarity to human and murine int-1 and the Drosophila segment polarity mutant wingless. EMBO J. 1988;7:1743-1748[Medline] [Order article via Infotrieve]. 41. Hobson GM, Krahe R, Garcia E, Siciliano MJ, Funanage VL. Regional chromosomal assignments for four members of the MADS domain transcription enhancer factor 2 (MEF2) gene family to human chromosomes 15q26, 19p12, 5q14, and 1q12-q23. Genomics. 1995;29:704-711[Medline] [Order article via Infotrieve].
42.
Zon LI.
Developmental biology of hematopoiesis.
Blood.
1995;86:2876-2891 43. Artinger KB, Chitnis AB, Mercola M, Driever W. Zebrafish narrowminded suggests a genetic link between formation of neural crest and primary sensory neurons. Development. 1999;126:3969-3979[Abstract]. 44. Thompson MA, Ransom DG, Pratt SJ, et al. The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev Biol. 1998;197:248-269[Medline] [Order article via Infotrieve]. 45. Tracey WD Jr, Pepling ME, Horb ME, Thomsen GH, Gergen JP. A Xenopus homologue of aml-1 reveals unexpected patterning mechanisms leading to the formation of embryonic blood. Development. 1998;125:1371-1380[Abstract].
46.
Perron M, Opdecamp K, Butler K, Harris WA, Bellefroid EJ.
X-ngnr-1 and Xath3 promote ectopic expression of sensory neuron markers in the neurula ectoderm and have distinct inducing properties in the retina.
Proc Natl Acad Sci U S A.
1999;96:14996-15001 47. Takakura N, Watanabe T, Suenobu S, et al. A role for hematopoietic stem cells in promoting angiogenesis. Cell. 2000;102:199-209[Medline] [Order article via Infotrieve].
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  H. Ma, T. Blake, A. Chitnis, P. Liu, and T. Balla Crucial role of phosphatidylinositol 4-kinase III{alpha} in development of zebrafish pectoral fin is linked to phosphoinositide 3-kinase and FGF signaling J. Cell Sci., December 1, 2009; 122(23): 4303 - 4310. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-T. Huang and L.I. Zon Regulation of Stem Cells in the Zebra Fish Hematopoietic System Cold Spring Harb Symp Quant Biol, November 6, 2008; (2008) sqb.2008.73.029v1. [Abstract] [PDF]
|
|
|
|
 |
|
 K. Hata, R. Nishimura, M. Ueda, F. Ikeda, T. Matsubara, F. Ichida, K. Hisada, T. Nokubi, A. Yamaguchi, and T. Yoneda A CCAAT/Enhancer Binding Protein {beta} Isoform, Liver-Enriched Inhibitory Protein, Regulates Commitment of Osteoblasts and Adipocytes Mol. Cell. Biol., March 1, 2005; 25(5): 1971 - 1979. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Kalev-Zylinska, J. A. Horsfield, M. V. C. Flores, J. H. Postlethwait, M. R. Vitas, A. M. Baas, P. S. Crosier, and K. E. Crosier Runx1 is required for zebrafish blood and vessel development and expression of a human RUNX1-CBF2T1 transgene advances a model for studies of leukemogenesis Development, March 6, 2003; 129(8): 2015 - 2030. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Spitsbergen and M. L. Kent The State of the Art of the Zebrafish Model for Toxicology and Toxicologic Pathology Research--Advantages and Current Limitations Toxicol Pathol, January 1, 2003; 31(1_suppl): 62 - 87. [Abstract] [PDF]
|
|
|
|
 |
|
 S. E. Lyons, N. D. Lawson, L. Lei, P. E. Bennett, B. M. Weinstein, and P. P. Liu A nonsense mutation in zebrafish gata1 causes the bloodless phenotype in vlad tepes PNAS, April 16, 2002; 99(8): 5454 - 5459. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Bennett, J. P. Kanki, J. Rhodes, T. X. Liu, B. H. Paw, M. W. Kieran, D. M. Langenau, A. Delahaye-Brown, L. I. Zon, M. D. Fleming, et al. Myelopoiesis in the zebrafish, Danio rerio Blood, August 1, 2001; 98(3): 643 - 651. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Lyons, B. C. Shue, A. C. Oates, L. I. Zon, and P. P. Liu A novel myeloid-restricted zebrafish CCAAT/enhancer-binding protein with a potent transcriptional activation domain Blood, May 1, 2001; 97(9): 2611 - 2617. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
/
about 8 kilobases (kb) apart
in tandem orientation (Bgb is upstream) on the left arm of
chromosome 3.
clone was excised
using the Stratagene Rapid Excision Kit (Stratagene, La Jolla,
CA) and sequenced. Genomic clones were obtained by hybridization of the
zebrafish cbfb cDNA clone to the zebrafish PAC filters (The
Resource Center/Primary Database of the German Human Genome Project,
Berlin, Germany). Two positive PAC clones were isolated,
BUSMP706O13197Q3 (PAC 197) and BUSMP706I09152Q3 (PAC 152). Sequence for
the 5' flanking region was obtained by sequencing PAC 197 using a
primer (5'-TCCTGAAGAACTCCTCGTTC-3') designed from exon 1 of the
zebrafish cbfb cDNA clone.
836 and 
