|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMATOPOIESIS
From the Terry Fox Laboratory, British Columbia Cancer
Agency and Department of Medical Genetics, University of British
Columbia, Vancouver, British Columbia, Canada.
An understanding of mechanisms regulating hematopoietic stem
cell engraftment is of pivotal importance to the clinical use of
cultured and genetically modified transplants. Human cord blood (CB) cells with lymphomyeloid repopulating activity in NOD/SCID mice
were recently shown to undergo multiple self-renewal divisions within 6 days in serum-free cultures containing Flt3-ligand, Steel factor,
interleukin 3 (IL-3), IL-6, and granulocyte colony-stimulating factor. The present study shows that, on the fifth day, the
transplantable stem cell activity is restricted to the G1
fraction, even though both colony-forming cells (CFCs) and long-term
culture-initiating cells (LTC-ICs) in the same cultures are
approximately equally distributed between G0/G1
and S/G2/M. Interestingly, the G0 cells defined
by their low levels of Hoechst 33342 and Pyronin Y staining, and
reduced Ki67 and cyclin D expression (representing 21% of the cultured
CB population) include some mature erythroid CFCs but very few
primitive CFCs, LTC-ICs, or repopulating cells. Although these findings
suggest a cell cycle-associated change in in vivo stem cell homing,
the cultured G0/G1 and S/G2/M
CD34+ CB cells exhibited no differences in levels of
expression of VLA-4, VLA-5, or CXCR-4. Moreover, further incubation of
these cells for 1 day in the presence of a concentration of
transforming growth factor Transplants of hematopoietic cells have assumed an
important role in the treatment of many malignancies. They also hold
much promise for future clinical applications involving hematopoietic stem cell-based gene therapy, tolerance induction to facilitate allogeneic or xenogeneic organ transplants, and other situations in
which hematopoietic stem cell purification and/or expansion before
transplantation would be desirable. Recently, considerable progress has
been made in the characterization of human hematopoietic cells with
long-term multilineage engraftment activity in various xenogeneic
models using either irradiated immunodeficient mice1-4 or
fetal sheep5 as hosts. In addition, a number of specific molecules, including VLA-4,6-9 VLA-5,10 and
CXCR4,11 have been implicated in the mechanism by which
hematopoietic stem cells exit from the blood into the extravascular
compartment of the marrow, both in syngeneic and xenogeneic hosts.
Conditions that support the proliferation of primitive human
hematopoietic cells in vitro readily support very large (more than
100-fold) amplifications of many progenitor cell types.12 These may be accompanied by self-renewal divisions of the
transplantable hematopoietic stem cells initially present in such
cultures, as shown by their ability to be retrovirally
transduced13-16 (which requires passage of cells through
mitosis17,18), and the results of high-resolution dye
tracking analyses.19,20 However, to date, only modest net
expansions of transplantable stem cells in vitro have been
demonstrable.21-23 In cultures of both
murine24-26 and human stem cells,27 an initial
dramatic loss of repopulating activity has been found to precede
execution of a first division. At later times in cultures of murine
cells, sequential oscillations of repopulating activity have been
observed that correlated in time with the synchronous cell cycle
passage of an initially highly purified stem cell
population.28 In addition, similarly enriched populations
of murine fetal liver stem cells have shown a disproportionate association of activity in the G0/G1
subset.29 These findings have suggested that proliferating
hematopoietic stem cells in the S/G2/M phases of the cell
cycle may have a reduced ability to engraft. The present studies were
designed to directly examine the validity of this hypothesis for
transplantable human stem cells stimulated to proliferate in vitro. For
this, we used 5-day expansion cultures of CD34+ human cord
blood (CB) cells maintained under conditions that do not stimulate a
first division of CD34+CD38 Cells
Healthy bone marrow cells, used for preparing adherent stromal cell
layers,33 were obtained as leftover material from
allogeneic marrow harvests at our center, or were from healthy
cadaveric donors (Northwest Tissue Center, Seattle, WA). All human
material was acquired with informed consent and used according to
approved institutional protocols.
Short-term suspension cultures
Isolation and analysis of cultured hematopoietic cells in different cell cycle phases Staining of cells with Hoechst 33342 (Hst, Molecular Probes, Eugene, OR) with or without Pyronin Y (Py, Sigma) was performed as previously described.34 Briefly, cultured CB cells were washed once in Hanks solution plus 2% FCS (HF), incubated in HF containing 10 µmol/L Hst at 37°C for 45 minutes, and Py was then added to give a final concentration of 2.5 µg/mL, followed by an additional 45 minutes incubation at 37°C with FITC-conjugated anti-CD34 antibody added for the last 20 minutes. The cells were then washed twice with HF containing 1 µg/mL PI, 10 µmol/L Hst, and 2.5 µg/mL Py, resuspended in HF with 10 µmol/L Hst and 2.5 µg/mL Py, and all cells (both CD34+ and CD34 ) sorted
using gates previously established to distinguish adult marrow
G0, G1, and S/G2/M cells on the
basis of their Ki-67 and cyclin D expression, and DNA content assessed
by 7AAD staining.34 In the present experiments,
distinction of G0/G1 and S/G2/M
cells isolated using these same gates was confirmed by PI
staining.35 The purity of the separately isolated
G0 and G1 populations was determined by
reanalysis of the initially sorted populations in 5 experiments.
Because of the considerable loss of Hst and Py staining intensity that
occurred during the first sort, the gates for this reanalysis had to be
adjusted accordingly. This was performed using an aliquot of the same
original cells that had been stained and passed through the FACS to
collect PI cells without further subdivision. The gates
established with these cells to give an equivalent proportion of
G0 and G1 cells as had been obtained originally
were then used to determine the purity of the sorted G0 and
G1 cells.
For the studies of adhesion molecule expression, cultured cells were stained with Hst only and either anti-CD34-FITC and anti-CXCR4-PE (Pharmingen, Mississauga, ON, Canada), or anti-CD34-PE (Becton Dickinson) and anti-VLA-4-FITC (Immunotech, Marseille, France) or anti-VLA-5-FITC (Immunotech), or appropriate isotype control antibodies. For analysis of intracellular expression of the D cyclins, cultured cells were first sorted into G0 and G1 populations as described above, and these cells were then fixed and stained with FITC-conjugated antibodies against cyclins D1, D2, and D3 (Pharmingen) according to the manufacturer's directions. Reverse transcriptase-polymerase chain reaction analysis of cyclin D3 and Ki67 transcripts Transcript levels in G0 and G1 populations were compared using a semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR) procedure described in detail previously.36,37 Briefly, 104 cells from each population were lysed in 50 µL of GIT buffer (5 mol/L guanidine isothiocyanate, 20 mmol/L 1,4-dithiothreitol [DTT], 25 mmol/L sodium citrate [pH = 7.0], 0.5% sarcosyl) and nucleic acids precipitated using ethanol. The RNA was then redissolved in 5.8 µL of RNase-free water plus 0.2 µL of oligo (dT) primer (1 µg/mL) (60 mer: 5'CATGTCGTCCAGGCCGCTCTGGACAAAATATGAATTCT24), heated to 70°C for 10 minutes, quenched on ice, and mixed with 2 µL of 5X RT buffer (GIBCO/BRL, Grand Island, NY), 1 µL of 0.1 mol/L DTT, 0.2 µL of 25 mmol/L (deoxynucleotide triphosphate) dNTPs (GIBCO/BRL), 0.5 µL of placental RNase inhibitor (10 U/µL), 0.5 µg nuclease-free bovine serum albumin (BSA) (Boehringer Mannheim, Laval, QC, Canada), and 0.5 µL of Superscript II (GIBCO/BRL). The mixture was incubated at 42°C for 1 hour and heat-inactivated at 70°C for 10 minutes. After ethanol precipitation, the pellet was resuspended in 5.5 µL of tailing solution (1 µL of 5X tailing buffer [GIBCO/BRL], 0.5 µL of 100 mmol/L dATP, 3.5 µL of water, and 0.5 µL of 15 U/mL terminal deoxynucleotidyl transferase [GIBCO/BRL] for 15 minutes at 37°C, and then heated to 70°C for 10 minutes. Aliquots of this solution were subjected to a PCR in 50 mmol/L KCl; 5 mmol/L MgCl2, 0.5 µg/mL BSA, 1 mmol/L dNTPs, 1 µL of gene 32 (Pharmacia), and 5 units of Taq polymerase (GIBCO/BRL). The cDNA was then amplified for the first 25 cycles (1 minute at 94°C, 2 minutes at 55°C, and 10 minutes at 72°C, except for the first cycle, in which the annealing temperature was 37°C instead of 55°C). To maintain the linearity of the PCR, one tenth of the volume of the reaction mixtures from the initial PCRs was then mixed with an additional 5 units of Taq polymerase before starting the second 25 cycles. After electrophoresis in 1% agarose gel, the cDNAs were transferred to nylon membranes (Hybond-N, Amersham, Buckinghamshire, United Kingdom) and hybridized with specific cDNA probes as follows. The cDNA for human Ki-67 (Kon-21 as) was obtained from Dr T. Scholzen (Borstel Research Institute, Borstel, Germany) and digested with BamH1/Not1. The cDNA for human cyclin D3 was obtained from Dr A. Arnold (University of Connecticut, Farmington, CT) and was digested with EcoR1. For Southern analyses, each filter was hybridized with probes labeled with 32P using a random primer kit (GIBCO/BRL) and hybridized for 12 to16 hours at 45°C in a solution of 40% formamide, 50 mmol/L NaPO4, 0.5% SDS, 5X SSPE, 5X Denhardt's solution, 0.25 mg/mL denatured salmon sperm DNA, and 100 mg/mL sodium dextran. The hybridized filters were then washed at room temperature in 2X SSC plus 0.1% SDS, followed by consecutive washes in 0.2X SSC plus 0.1% SDS, first at 50°C and then at 55°C. Specific signals were quantitated using a phosphoimager (Storm 860, Molecular Dynamics, Sunnyvale, CA) with MD APPS software. Each measurement was corrected for the signal level obtained in the RT control that was hybridized to the same filter
under the same conditions.
In vitro progenitor assays Colony-forming cell (CFC) and 6-week long-term culture-initiating cell (LTC-IC) frequencies were determined on cells harvested from the various types of cultures or in the various fractions of cells isolated by FACS using standard procedures, as described previously.38In vivo repopulation studies NOD/LtSz-scid/scid (NOD/SCID) mice, originally obtained from Dr L. Schultz (The Jackson Laboratory, Bar Harbor, ME), were bred and maintained in the animal facility of the British Columbia Cancer Research Center (Vancouver, BC, Canada) under sterile conditions in microisolator cages and were provided exclusively with autoclaved food and water. Mice were irradiated with 350 cGy of total body 137Cs -rays at 6 to12 weeks of age and then started on
acidified drinking water supplemented with 100 mg/L ciprofloxacine
(Bayer AG, Leverkusen, Germany) for the duration of the experiments. Test cells were injected intravenously into the irradiated mice, together with 106 irradiated (1500 cGy) human bone marrow
cells as carrier cells. Mice were killed 6 to 8 weeks after transplant,
and the cells from both tibiae and femurs of each mouse collected in
HF. The cells were then incubated with 5% human serum and 2.4G2 (an
antimouse Fc receptor antibody39) to decrease nonspecific
antibody binding. Separate aliquots of cells were then stained for 30 minutes at 4°C, either with antihuman CD34 (8G12)-FITC plus
antihuman CD19-PE and antihuman CD20-PE antibodies (Becton Dickinson)
to detect human (CD34CD19/20+) pre-B cells or
with antihuman CD15-FITC (Becton Dickinson) and antihuman CD66b-FITC
(Pharmacia Biotech, Baie d-Urfe, PQ) plus antihuman CD45-PE
(Becton Dickinson) and antihuman CD71-PE antibodies (OKT9 from Dr P. Lansdorp) for the detection of mature human
(CD45/71+CD15/66b+) myeloid cells. A detection
limit of more than or equal to 5 human lymphoid cells
(CD34CD19/20+) and/or more than or equal to 5 human myeloid cells (CD45/71+ CD15/66b+) per
20 000 PI cells analyzed was used to identify positively
engrafted mice using gates set to exclude more than 99.99% of
nonspecifically stained PI cells incubated with
irrelevant isotype-matched control antibodies labeled with the
corresponding fluorochromes, as previously described.40 Mice were then categorized as those containing either no human cells or
human lymphoid cells only, those containing both human lymphoid and
myeloid cells (L + M), and those containing any human cells, ie,
mice containing only human lymphoid cells with or without human myeloid
cells (L ± M) as no mice were found to contain only human myeloid
cells. Frequencies of injected lymphomyeloid stem cells (referred to as
competitive repopulating units or CRUs21,40) were
calculated from the proportions of mice in a given experiment, or set
of identical experiments, that did not contain both human lymphoid and
human myeloid cells (ie, the first category) using Poisson statistics
and the method of maximum likelihood with the assistance of the L-calc
software (StemCell).
Statistical analyses The results are shown as mean values ± SEM from independent experiments. Differences between groups were assessed using the Student t test.
Cell cycle distribution of CD34+ cells and progenitors in 5-day cord blood expansion cultures Cultures of CD34+ CB cells were incubated in serum-free medium with TPO only for the first day and then with FL + SF + IL-3 + IL-6 + G-CSF for the next 4 days to mimic the protocol used previously to demonstrate the execution of at least 3 self-renewal divisions of the input CRUs after a total of 6 days of culture under these conditions.19 Comparison of the numbers of CFCs and LTC-ICs at the end of the 5 days of culture in the present experiments with corresponding input values showed that these progenitor populations had increased 40 ± 6-fold and 9 ± 6-fold, respectively (n = 12). Using the gates illustrated in Figure 1, 21% ± 3% of the 5-day cultured CB cells were classified as in G0 (HstloPylo), 36% ± 4% as in G1 (HstloPyhi) and 43% ± 3% as in S/G2/M (Hsthi) (n = 6, Figure 2). The purities of the combined G0/G1 and the remaining S/G2/M populations, as determined by PI staining, were 94% ± 1% for the G0/G1 cells and 95% ± 1% for the S/G2/M cells (n = 9, Figure 1C,D). The purities of the G0 versus G1 populations, as assessed by resorting, were 96% ± 2% and 90% ± 3%, respectively (n = 3). The validity of the gates used to distinguish G0 and G1 cells was confirmed both by FACS analysis of their differential intracellular expression of D cyclins (49% ± 7% of the G0 cells did not contain detectable levels of any of the D cyclins, whereas only 8% ± 1% of the G1 cells were D cyclin negative, n = 5, Figure 3A) and by semiquantitative RT-PCR detection of reduced Ki-67 and cyclin D3 transcript levels in the G0 population (n = 3, Figure 3B).
Cultured G0/G1 and S/G2/M cells were additionally stained for CD34 expression and aliquots also assayed for CFCs and LTC-ICs. As shown in Figure 2A, the proportions of CD34+ cells in these 2 fractions were approximately equal (which was significantly different from the distribution of the total cells, P < .03). In contrast, the distribution of CFCs and LTC-ICs between the G0/G1 and S/G2/M populations more closely mirrored the total cell distribution (P > .1). Separate comparison of the proportions of CFCs in G0 versus G1 showed these also to mirror the total cell distribution (P = .8). However, the types of CFCs found in the G0 and G1 fractions were different with primitive CFCs being found almost exclusively in the G1 fraction. Most (more than 95%) of the LTC-ICs were also found to be present in the G1 fraction, which was significantly different from the total cell distribution between the G0 and G1 fractions (P < .03). Taken together, these findings suggest a preferential ability of more mature cell types to enter G0 under the conditions prevalent in these cultures after 5 days of incubation. Competitive repopulating units in 5-day cord blood expansion cultures are detected exclusively in the G1 population In 3 of the experiments described in Figure 2A, the remaining cells in the separately isolated G0/G1 and S/G2/M fractions of the day 5 cultured CB cells (more than 90% of each) were injected into irradiated NOD/SCID mice to examine their content of human cells with in vivo lymphoid and/or myeloid repopulating activity. As shown in Table 1, engraftment after 6 to 8 weeks with both myeloid and lymphoid human cells was seen only in mice transplanted with G0/G1 cells in all 3 experiments, and in only 4 of 17 mice was any engraftment (lymphoid only) by the cultured human S/G2/M cells obtained. Because not all mice injected with G0/G1 cells were found to contain human myeloid and lymphoid cells, the data could be used to estimate the frequency of CRUs in the G0/G1 fraction of the cultured CB cells. The value obtained was 1 CRU/106 G0/G1 cells (with a range defined by ± SEM of 1 per 8 × 105 to 1.6 × 106 cells). A similar calculation for the S/G2/M population (assuming less than one mouse was positive) gave a value of less than 1 CRU/107 S/G2/M cells. This suggests a difference of at least 10-fold in the number of CRU detectable in the 2 fractions.
In the 3 experiments in which G0 and G1 cells
were isolated as separate populations from 5-day cultures (Figure 2B),
the majority of the cells were again injected into NOD/SCID mice to
assess their repopulating activity. As shown in Table
2, only mice injected with G1
cells showed any engraftment with human cells. Calculation of the CRU
frequency in the G1 fraction gave a value of 1 per 7 × 105 G1 cells (with a range defined
by ± SEM of 1 per 105 to 9 × 105
cells). Based on the detection limit of CRUs in the G0
fraction (where none were seen), and the different sizes of the 2 fractions in terms of total cells, the G1 fraction was
estimated to have contained at least 85% of the detectable CRUs
present in the cultures.
Expression of VLA-4, VLA-5, CD44, and CXCR-4 does not differ between cultured cord blood cells in G0/G1 and S/G2/M We next asked whether any differences in the level of expression of VLA-4, VLA-5, CXCR-4, or CD44 could be seen on G0/G1 and S/G2/M cells isolated from the same type of 5-day expansion cultures of CD34+ CB cells. Figure 4 shows FACS profiles for the first 3 of these adhesion molecules on the CD34+ subset of cells from both populations in representative experiments. All 3 adhesion molecules were consistently found to be highly expressed on the CD34+ cells examined with no differences seen between the G0/G1 and S/G2/M populations (VLA-4, n = 5; VLA-5, n = 3; CXCR4, n = 6). Similar results were obtained when the total cells were analyzed for CD44 expression (n = 3, data not shown). Because of the intense staining of CD44, it was not possible to perform this analysis on an additionally stained CD34+ subset.
Exposure of previously cultured cord blood cells to
TGF-  1 could be used to enhance
the detection of transplantable stem cells by forcing their arrest and
hence their accumulation in G0/G1. Accordingly,
CD34+ CB cells were first cultured for 5 days under the
same conditions as previously stated, and then all their progeny were
transferred without further separation to different types of secondary
cultures for an additional 24 hours (± TGF-1 in the
presence or absence of stroma). The cells were then harvested, and cell
cycle analyses using PI staining were performed. In addition, CFCs,
LTC-ICs, and repopulating activity in NOD/SCID mice were measured. As
shown in Figure 5, exposure of the cells
to this concentration of TGF-1 increased the size of the
G0/G1 population to the greatest extent in the
presence of bone marrow stroma (76% ± 3%
G0/G1 cells with TGF-1 vs
67% ± 1% without, P < .03), although an increase was also seen when the cells were incubated with FL + SF + IL-3 + IL-6 + G-CSF (5GF) plus TGF-1 in the
absence of stroma (67% ± 1% with TGF-1 vs
58% ± 3% without, P < .01, n = 3). However, when
both stroma and the 5GF were present, there was no increase in
G0/G1 cells above the levels seen with 5GF
alone (P > .05). In another 3 experiments, the effect of
TGF-1 exposure on the proportion of cells entering
G0 was analyzed. Exposure to TGF-1 in the
presence of stroma increased the ratio of G1 to
G0 cells from 1.1 ± 0.1 to 3.8 ± 0.7. In the absence
of stroma but in the presence of the 5GF, the increase in this ratio
was more modest (from 1.7 ± 0.3 to 4.2 ± 0.7,
P < .03). In the suspension cultures, the proportion of
total cells defined as apoptotic (because they contained less than 2n
DNA content) was also increased after exposure to TGF-1
(21% ± 6% with TGF-1 vs 8% ± 4% without,
P = .07). However, in the presence of stroma, the
proportion of apoptotic cells was the same, whether or not
TGF-1 was added (13% ± 5% with TGF-1
vs 12% ± 7% without). The total cell number and the number of CFCs
were slightly, but not significantly (P > .05), decreased
when TGF-1 was present. LTC-IC values were more variable but, on average, showed no differences between the different groups (P > .05). Similar results were obtained when cells from
these cultures were assayed in NOD/SCID mice. As shown in Table
3, there was no difference
(P > .05) in the percentage of mice repopulated with
lymphoid and myeloid cells (or the average level of engraftment, data
not shown) after transplantation of cells cultured in the presence or
absence of TGF-1.
In this study, we have shown that human CB cells transiting the S/G2/M phases of the cell cycle after 5 days of growth factor stimulation, first by TPO (1 day) and then by IL-3, IL-6, G-CSF, SF, and FL (4 days), do not repopulate the bone marrow of irradiated NOD/SCID mice. Several lines of evidence indicate that this is due to a reversible silencing of the engraftment potential of stem cells present in these populations. First, the frequencies of CD34+ cells, CFCs, and LTC-ICs were approximately equally distributed between the S/G2/M and G0/G1 fractions, indicating that all these cell types were dividing asynchronously. The proportionate representation in both fractions of LTC-ICs, a cell type considered to be closely related to CRUs,13 further suggests that cells with the developmental potential of CRUs would be similarly distributed between Go/G1 and S/G2/M. Second, we have previously shown that after one more day under the same culture conditions as used in the present studies, the majority of all the cells, including the lymphomyeloid repopulating cells, have already completed at least 3 divisions,19 even though very few are likely to have completed a first division before the third day,30 suggesting an average cell cycle time of less than 24 hours. Moreover, separate assessment of the functional activities of the G0 and G1 cells isolated from the same 5-day cultures showed no evidence of any repopulating cell (or LTC-IC) re-entry into G0 once their proliferation had been initiated. This contrasts with the situation found for the mature erythroid CFCs being produced, many of which could be found in the G0 fraction. The LTC-IC results also appear to differ from those reported by Gothot et al.41 However, their methods differed from those used here in 2 important ways. First, they did not include FL in the cytokine cocktail in which the cells were cultured, which we42,43 and others44 have found to be critical for optimal recruitment into division of the most primitive human cells. Second, they measured CFC progenitors in a 2-week stroma-free culture, whereas we measured CFC progenitors using a stroma-containing culture system and a 6-week read-out. Although these 2 assays may measure similar frequencies of progenitors in some cell suspensions,45 we believe they do not detect the same progenitor because significant differences in progenitor frequency can be revealed under a number of circumstances (eg, in mobilized blood populations, even when the duration of the stroma-containing LTC-IC assay cultures is prolonged beyond 5 weeks).46,47 Thus, it seems likely that the majority of the proliferating CB cells detectable after 6 days in our cultures as transplantable stem cells19 would have been transiting S/G2/M the previous day, ie, when the present analyses were performed. These findings prompted us to look for cell cycle-associated changes
in levels of expression of several molecules that have been implicated
in homing mechanisms used by primitive hematopoietic cells. Although
these are still not well defined, a variety of in vivo studies have
suggested a role of As a first attempt to explore the possibility of improving engraftment
by a TGF- The observed engraftment defect of proliferating human hematopoietic
stem cells during their passage through the S/G2/M phases of the cell cycle and the failure of these cells to enter
G0, at least before the end of 5 days of culture in the
presence of FL, SF, IL-3, IL-6, and G-CSF, may have a considerable
negative impact on the clinical utility of current ex vivo expansion or retroviral marking protocols that depend on maximal induction of stem
cell cycling. Indeed, continuous improvement in the proportion of
transduced stem cells obtained is well known to be associated with
significant losses in stem cell yields relative to the number initially
present.30 The average duration of the cell cycle of
Rhodaminelo/Hstlo mouse bone marrow cells,
which are highly enriched in stem cells, has been shown to decrease
from 36 to 12 hours when these cells are stimulated to proliferate in
suspension culture.61 If a relatively fixed duration of S
phase of approximately 7 to 8 hours, a G2 phase of 2 hours,
and 1 hour for M is assumed for mammalian cells in general, this would
imply a very short (1 to 2 hours) G1 phase for
proliferating murine hematopoietic stem cells. Similar data are not
available for human stem cells, although it is unlikely that the
duration of the cell cycle is longer than 18 hours, based on studies of
growth factor-stimulated LTC-IC turnover rates in vitro.35 It is therefore reasonable to anticipate that
strategies able to reversibly arrest human stem cells might
significantly enhance the activity of proliferating stem cells, even
though our preliminary efforts using short-term exposure to
TGF- Finally, the present findings may also have important relevance to leukemic stem cell populations where engraftment may be limited to, or preferentially associated with, a quiescent compartment.34,62,63 This raises the possibility that proliferating leukemic stem cells may share the same engraftment defect as their healthy counterparts. If supported, this would imply that the removal of leukemic cells from autologous transplants might be less essential than currently believed, because the leukemic stem cells appear to comprise very small subpopulations within the leukemic clone,64-66 and the majority of these may be proliferating.34,67,68 On the other hand, transplantability may also impose a functional requirement on the detection of malignant stem cells that underestimates the number of such cells present that may have been able to sustain or even regenerate disease in situ.
We thank Maya Sinclaire and Ken Lee for assistance with the animal work; Gayle Thornbury, Giovanna Cameron, and Rick Zapf for assistance in cell sorting; the staff of the Stem Cell Assay Service for initial hematopoietic cell processing; and Yvonne Yang for manuscript preparation.
Submitted April 5, 2000; accepted August 24, 2000.
Supported by grants from the National Cancer Institute of Canada (NCIC) with funds from the Terry Fox Run and from the NIH (P01 HL 55435). H.G. received a grant from the Dr Mildred Scheel Stiftung für Krebsforschung, Bonn, Germany. I.O. held an NCIC Postdoctoral Fellowship. C.J.E. was a Terry Fox Cancer Research Scientist of the NCIC.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Connie J. Eaves, Terry Fox Laboratory, 601 W 10th Ave, Vancouver, BC V5Z 1L3, Canada; e-mail: ceaves{at}bccancer.bc.ca.
1.
Kamel-Reid S, Dick JE.
Engraftment of immune-deficient mice with human hematopoietic stem cells.
Science.
1988;242:1706-1709
2.
Nolta JA, Hanley MB, Kohn DB.
Sustained human hematopoiesis in immunodeficient mice by cotransplantation of marrow stroma expressing human interleukin-3: analysis of gene transduction of long-lived progenitors.
Blood.
1994;83:3041-3051 3. Larochelle A, Vormoor J, Hanenberg H, et al. Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: implications for gene therapy. Nat Med. 1996;2:1329-1337[Medline] [Order article via Infotrieve].
4.
Cashman JD, Lapidot T, Wang JCY, et al.
Kinetic evidence of the regeneration of multilineage hematopoiesis from primitive cells in normal human bone marrow transplanted into immunodeficient mice.
Blood.
1997;89:4307-4316 5. Zanjani ED, Flake AW, Rice H, Hedrick M, Tavassoli M. Long-term repopulating ability of xenogeneic transplanted human fetal liver hematopoietic stem cells in sheep. J Clin Invest. 1994;93:1051-1055. 6. Williams DA, Rios M, Stephens C, Patel VP. Fibronectin and VLA-4 in haematopoietic stem cell- microenvironment interactions. Nature. 1991;352:438-441[Medline] [Order article via Infotrieve].
7.
Papayannopoulou T, Craddock C, Nakamoto B, Priestley GV, Wolf NS.
The VLA4/VCAM-1 adhesion pathway defines contrasting mechanisms of lodgement of transplanted murine hemopoietic progenitors between bone marrow and spleen.
Proc Natl Acad Sci U S A.
1995;92:9647-9651
8.
Vermeulen M, Le Pesteur F, Gagnerault M-C, Mary J-Y, Sainteny F, Lepault F.
Role of adhesion molecules in the homing and mobilization of murine hematopoietic stem and progenitor cells.
Blood.
1998;92:894-900 9. Prosper F, Stroncek D, McCarthy JB, Verfaillie CM. Mobilization and homing of peripheral blood progenitors is related to reversible downregulation of alpha4 beta1 integrin expression and function. J Clin Invest. 1998;101:2456-2467[Medline] [Order article via Infotrieve]. 10. van der Loo JC, Xiao X, McMillin D, Hashino K, Kato I, Williams DA. VLA-5 is expressed by mouse and human long-term repopulating hematopoietic cells and mediates adhesion to extracellular matrix protein fibronectin. J Clin Invest. 1998;102:1051-1061[Medline] [Order article via Infotrieve].
11.
Peled A, Petit I, Kollet O, et al.
Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4.
Science.
1999;283:845-848 12. Scheding S, Kratz-Albers K, Meister B, Brugger W, Kanz L. Ex vivo expansion of hematopoietic progenitor cells for clinical use. Semin Hematol. 1998;35:232-240[Medline] [Order article via Infotrieve].
13.
Conneally E, Eaves CJ, Humphries RK.
Efficient retroviral-mediated gene transfer to human cord blood stem cells with in vivo repopulating potential.
Blood.
1998;91:3487-3493
14.
Schilz AJ, Brouns G, Knöss H, et al.
High efficiency gene transfer to human hematopoietic SCID-repopulating cells under serum-free conditions.
Blood.
1998;92:3163-3171
15.
van Hennik PB, Verstegen MMA, Bierhuizen MFA, et al.
Highly efficient transduction of the green fluorescent protein gene in human umbilical cord blood stem cells capable of cobblestone formation in long-term cultures and multilineage engraftment of immunodeficient mice.
Blood.
1998;92:4013-4022
16.
Dao MA, Shah AJ, Crooks GM, Nolta JA.
Engraftment and retroviral marking of CD34+ and CD34+CD38
17.
Miller DG, Adam MA, Miller AD.
Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection.
Mol Cell Biol.
1990;10:4239-4242 18. Roe TY, Reynolds TC, Yu G, Brown P. Integration of murine leukemia virus DNA depends on mitosis. EMBO J. 1993;12:2099-2108[Medline] [Order article via Infotrieve].
19.
Glimm H, Eaves CJ.
Direct evidence for multiple self-renewal divisions of human in vivo repopulating hematopoietic cells in short-term culture.
Blood.
1999;94:2161-2168 20. Young JC, Lin K, Hansteen G, et al. CD34+ cells from mobilized peripheral blood retain fetal bone marrow repopulating capacity within the Thy-1+ subset following cell division ex vivo. Exp Hematol. 1999;27:994-1003[Medline] [Order article via Infotrieve].
21.
Conneally E, Cashman J, Petzer A, Eaves C.
Expansion in vitro of transplantable human cord blood stem cells demonstrated using a quantitative assay of their lympho-myeloid repopulating activity in nonobese diabetic-scid/scid mice.
Proc Natl Acad Sci U S A.
1997;94:9836-9841
22.
Bhatia M, Bonnet D, Kapp U, Wang JCY, Murdoch B, Dick JE.
Quantitative analysis reveals expansion of human hematopoietic repopulating cells after short-term ex vivo culture.
J Exp Med.
1997;186:619-624
23.
Piacibello W, Sanavio F, Severino A, et al.
Engraftment in nonobese diabetic severe combined immunodeficient mice of human CD34+ cord blood cells after ex vivo expansion: evidence for the amplification and self-renewal of repopulating stem cells.
Blood.
1999;93:3736-3749
24.
Peters SO, Kittler ELW, Ramshaw HS, Quesenberry PJ.
Ex vivo expansion of murine marrow cells with interleukin-3 (IL-3), IL-6, IL-11, and stem cell factor leads to impaired engraftment in irradiated hosts.
Blood.
1996;87:30-37
25.
Wiesmann A, Kim M, Georgelas A, et al.
Modulation of hematopoietic stem/progenitor cell engraftment by transforming growth factor
26.
Oostendorp RAJ, Audet J, Eaves CJ.
High-resolution tracking of cell division suggests similar cell cycle kinetics of hematopoietic stem cells stimulated in vitro and in vivo.
Blood.
2000;95:855-862
27.
Gothot A, Van der Loo JCM, Clapp W, Srour EF.
Cell cycle-related changes in repopulating capacity of human mobilized peripheral blood CD34+ cells in non-obese diabetic/severe combined immune-deficient mice.
Blood.
1998;92:2641-2649
28.
Habibian HK, Peters SO, Hsieh CC, et al.
The fluctuating phenotype of the lymphohematopoietic stem cell with cell cycle transit.
J Exp Med.
1998;188:393-398
29.
Fleming WH, Alpern EJ, Uchida N, Ikuta K, Spangrude GJ, Weissman IL.
Functional heterogeneity is associated with the cell cycle status of murine hematopoietic stem cells.
J Cell Biol.
1993;122:897-902 30. Hennemann B, Conneally E, Pawliuk R, et al. Optimization of retroviral-mediated gene transfer to human NOD/SCID mouse repopulating cord blood cells through a systematic analysis of protocol variables. Exp Hematol. 1999;27:817-825[Medline] [Order article via Infotrieve].
31.
Brummendorf TH, Dragowska W, Zijlmans JMJM, Thornbury G, Lansdorp PM.
Asymmetric cell divisions sustain long-term hematopoiesis from single-sorted human fetal liver cells.
J Exp Med.
1998;188:1117-1124
32.
Hungs S, Law P, Francis K, Palsson BO, Ho AD.
Symmetry of initial cell divisions among primitive hematopoietic progenitors is independent of ontogenic age and regulatory molecules.
Blood.
1999;94:2595-2604
33.
Sutherland HJ, Lansdorp PM, Henkelman DH, Eaves AC, Eaves CJ.
Functional characterization of individual human hematopoietic stem cells cultured at limiting dilution on supportive marrow stromal layers.
Proc Natl Acad Sci U S A.
1990;87:3584-3588
34.
Holyoake T, Jiang X, Eaves C, Eaves A.
Isolation of a highly quiescent subpopulation of primitive leukemic cells in chronic myeloid leukemia.
Blood.
1999;94:2056-2064
35.
Ponchio L, Conneally E, Eaves C.
Quantitation of the quiescent fraction of long-term culture-initiating cells (LTC-IC) in normal human blood and marrow and the kinetics of their growth factor-stimulated entry into S-phase in vitro.
Blood.
1995;86:3314-3321
36. Oh I-H, Lau A, Eaves CJ. During ontogeny primitive (CD34+CD38
37.
Sauvageau G, Lansdorp PM, Eaves CJ, et al.
Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells.
Proc Natl Acad Sci U S A.
1994;91:12223-12227
38.
Hogge DE, Lansdorp PM, Reid D, Gerhard B, Eaves CJ.
Enhanced detection, maintenance and differentiation of primitive human hematopoietic cells in cultures containing murine fibroblasts engineered to produce human Steel factor, interleukin-3 and granulocyte colony-stimulating factor.
Blood.
1996;88:3765-3773
39.
Unkeless JC.
Characterization of a monoclonal antibody directed against mouse macrophage and lymphocyte Fc receptors.
J Exp Med.
1979;150:580-596 40. Holyoake TL, Nicolini FE, Eaves CJ. Functional differences between transplantable human hematopoietic stem cells from fetal liver, cord blood, and adult marrow. Exp Hematol. 1999;27:1418-1427[Medline] [Order article via Infotrieve].
41.
Gothot A, Pyatt R, McMahel J, Rice S, Srour EF.
Functional heterogeneity of human CD34+ cells isolated in subcompartments of the G0/G1 phase of the cell cycle.
Blood.
1997;90:4384-4393
42.
Nordon RE, Ginsberg SS, Eaves CJ.
High resolution cell division tracking demonstrates the Flt3-ligand-dependence of human marrow CD34+CD38 43. Zandstra PW, Conneally E, Piret JM, Eaves CJ. Ontogeny-associated changes in the cytokine responses of primitive human haemopoietic cells. Br J Haematol. 1998;101:770-778[Medline] [Order article via Infotrieve].
44.
Shah AJ, Smogorzewska EM, Hannum C, Crooks GM.
Flt3 ligand induces proliferation of quiescent human bone marrow CD34+CD38
45.
Traycoff CM, Kosak ST, Grigsby S, Srour EF.
Evaluation of ex vivo expansion potential of cord blood and bone marrow hematopoietic progenitor cells using cell tracking and limiting dilution analysis.
Blood.
1995;85:2059-2068 46. Ponchio L, Eaves C, Hogge D, et al. Both cycling and noncycling primitive progenitors continue to be mobilized into the circulation during the leukapheresis of patients pretreated with chemotherapy and G-CSF. Br J Haematol. 1997;99:394-402[Medline] [Order article via Infotrieve].
47.
Prosper F, Stroncek D, Verfaillie CM.
Phenotypic and functional characterization of long-term culture-initiating cells present in peripheral blood progenitor collections of normal donors treated with granulocyte colony-stimulating factor.
Blood.
1996;88:2033-2042 48. Ghaffari S, Smadja-Joffe F, Oostendorp R, et al. CD44 isoforms in normal and leukemic hematopoiesis. Exp Hematol. 1999;27:978-993[Medline] [Order article via Infotrieve].
49.
Yamaguchi M, Ikebuchi K, Hirayama F, et al.
Different adhesive characteristics and VLA-4 expression of CD34+ progenitors in G0/G1 versus S+G2/M phases of the cell cycle.
Blood.
1998;92:842-848 50. Kodama H, Nose M, Niida S, Nishikawa S, Nishikawa SI. Involvement of the c-kit receptor in the adhesion of hematopoietic stem cells to stromal cells. Exp Hematol. 1994;22:979-984[Medline] [Order article via Infotrieve].
51.
Levesque JP, Leavesley DI, Niutta S, Vadas M, Simmons PJ.
Cytokines increase human hemopoietic cell adhesiveness by activation of very late antigen (VLA)-4 and VLA-5 integrins.
J Exp Med.
1995;181:1805-1815
52.
Kovach NL, Lin N, Yednock T, Harlan JM, Broudy VC.
Stem cell factor modulates avidity of
53.
Cashman JD, Eaves AC, Raines EW, Ross R, Eaves CJ.
Mechanisms that regulate the cell cycle status of very primitive hematopoietic cells in long-term human marrow cultures: I. Stimulatory role of a variety of mesenchymal cell activators and inhibitory role of TGF-
54.
Cashman JD, Clark-Lewis I, Eaves AC, Eaves CJ.
Differentiation stage-specific regulation of primitive human hematopoietic progenitor cycling by exogenous and endogenous inhibitors in an in vivo model.
Blood.
1999;94:3722-3729
55.
Sing GK, Keller JR, Ellingsworth LR, Ruscetti FW.
Transforming growth factor
56.
Hatzfeld J, Li ML, Brown EL, et al.
Release of early human hematopoietic progenitors from quiescence by antisense transforming growth factor 57. Lu L, Xiao M, Grigsby S, et al. Comparative effects of suppressive cytokines on isolated single CD34+++ stem/progenitor cells from human bone marrow and umbilical cord blood plated with and without serum. Exp Hematol. 1993;21:1442-1446[Medline] [Order article via Infotrieve].
58.
Dao MA, Taylor N, Nolta JA.
Reduction in levels of the cyclin-dependent kinase inhibitor p27kip-1 coupled with transforming growth factor 59. Garbe A, Spyridonidis A, Mobest D, Schmoor C, Mertelsmann R, Henschler R. Transforming growth factor-beta 1 delays formation of granulocyte-macrophage colony-forming cells, but spares more primitive progenitors during ex vivo expansion of CD34+ haemopoietic progenitor cells. Br J Haematol. 1997;99:951-958[Medline] [Order article via Infotrieve].
60.
Cashman J, Clark-Lewis I, Eaves C.
SDF-1 and TGF-
61.
Reddy GP, Tiarks CY, Pang L, Wuu J, Hsieh CC, Quesenberry PJ.
Cell cycle analysis and synchronization of pluripotent hematopoietic progenitor stem cells.
Blood.
1997;90:2293-2299
62.
Terpstra W, Ploemacher RE, Prins A, et al.
Fluorouacil selectively spares acute myeloid leukemia cells with long-term growth abilities in immunodeficient mice and in culture.
Blood.
1996;88:1944-1950 63. Ailles LE, Humphries RK, Thomas TE, Hogge DE. Retroviral marking of acute myelogenous leukemia progenitors that initiate long-term culture and growth in immunodeficient mice. Exp Hematol. 1999;27:1609-1620[Medline] [Order article via Infotrieve]. 64. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med. 1997;3:730-736[Medline] [Order article via Infotrieve].
65.
Blair A, Hogge DE, Ailles LE, Lansdorp PM, Sutherland HJ.
Lack of expression of Thy-1 (CD90) on acute myeloid leukaemia cells with long-term proliferative ability in vitro and in vivo.
Blood.
1997;89:3104-3112
66.
Blair A, Hogge DE, Sutherland HJ.
Most acute myeloid leukaemia progenitor cells with long-term proliferative ability in vitro and in vivo have the phenotype CD34+/CD71 67. Eaves AC, Barnett MJ, Ponchio L, Cashman JD, Petzer A, Eaves CJ. Differences between normal and CML stem cells: potential targets for clinical exploitation. Stem Cells. 1998;16 (Suppl 1):77-83. 68. Guan Y, Hogge D. Characterization of the proliferative status of malignant progenitors from patients with acute myelogenous leukemia (AML) [abstract]. Exp Hematol. 1998;26:810.
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  A. L. Hazen, M. J. Smith, C. Desponts, O. Winter, K. Moser, and W. G. Kerr SHIP is required for a functional hematopoietic stem cell niche Blood, March 26, 2009; 113(13): 2924 - 2933. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Foguenne, I. Di Stefano, O. Giet, Y. Beguin, and A. Gothot Ex vivo expansion of hematopoietic progenitor cells is associated with downregulation of {alpha}4 integrin- and CXCR4-mediated engraftment in NOD/SCID {beta}2-microglobulin-null mice Haematologica, February 1, 2009; 94(2): 185 - 194. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Mayack and A. J. Wagers Osteolineage niche cells initiate hematopoietic stem cell mobilization Blood, August 1, 2008; 112(3): 519 - 531. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Abdel-Azim, Y. Zhu, R. Hollis, X. Wang, S. Ge, Q.-L. Hao, G. Smbatyan, D. B. Kohn, M. Rosol, and G. M. Crooks Expansion of multipotent and lymphoid-committed human progenitors through intracellular dimerization of Mpl Blood, April 15, 2008; 111(8): 4064 - 4074. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Noda, K. Horiguchi, H. Ichikawa, and H. Miyoshi Repopulating Activity of Ex Vivo-Expanded Murine Hematopoietic Stem Cells Resides in the CD48-c-Kit+Sca-1+Lineage Marker- Cell Population Stem Cells, March 1, 2008; 26(3): 646 - 655. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Graham, J. K. Vass, T. L. Holyoake, and G. J. Graham Transcriptional Analysis of Quiescent and Proliferating CD34+ Human Hemopoietic Cells from Normal and Chronic Myeloid Leukemia Sources Stem Cells, December 1, 2007; 25(12): 3111 - 3120. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Pearl-Yafe, J. Stein, E. S. Yolcu, D. L. Farkas, H. Shirwan, I. Yaniv, and N. Askenasy Fas Transduces Dual Apoptotic and Trophic Signals in Hematopoietic Progenitors Stem Cells, December 1, 2007; 25(12): 3194 - 3203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Brenner, M. F. Ryser, N. L. Whiting-Theobald, M. Gentsch, G. F. Linton, and H. L. Malech The Late Dividing Population of {gamma}-Retroviral Vector Transduced Human Mobilized Peripheral Blood Progenitor Cells Contributes Most to Gene-Marked Cell Engraftment in Nonobese Diabetic/Severe Combined Immunodeficient Mice Stem Cells, July 1, 2007; 25(7): 1807 - 1813. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Yang, L. Wang, H. Geiger, J. A. Cancelas, J. Mo, and Y. Zheng Rho GTPase Cdc42 coordinates hematopoietic stem cell quiescence and niche interaction in the bone marrow PNAS, March 20, 2007; 104(12): 5091 - 5096. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Jaras, A. Edqvist, J. Rebetz, L. G. Salford, B. Widegren, and X. Fan Human short-term repopulating cells have enhanced telomerase reverse transcriptase expression Blood, August 1, 2006; 108(3): 1084 - 1091. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Nygren, D. Bryder, and S. E. W. Jacobsen Prolonged Cell Cycle Transit Is a Defining and Developmentally Conserved Hemopoietic Stem Cell Property J. Immunol., July 1, 2006; 177(1): 201 - 208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. R. Santoni de Sio, P. Cascio, A. Zingale, M. Gasparini, and L. Naldini Proteasome activity restricts lentiviral gene transfer into hematopoietic stem cells and is down-regulated by cytokines that enhance transduction Blood, June 1, 2006; 107(11): 4257 - 4265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Hermitte, P. Brunet de la Grange, F. Belloc, V. Praloran, and Z. Ivanovic Very Low O2 Concentration (0.1%) Favors G0 Return of Dividing CD34+ Cells Stem Cells, January 1, 2006; 24(1): 65 - 73. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Passegue, A. J. Wagers, S. Giuriato, W. C. Anderson, and I. L. Weissman Global analysis of proliferation and cell cycle gene expression in the regulation of hematopoietic stem and progenitor cell fates J. Exp. Med., December 5, 2005; 202(11): 1599 - 1611. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Verhoeyen, M. Wiznerowicz, D. Olivier, B. Izac, D. Trono, A. Dubart-Kupperschmitt, and F.-L. Cosset Novel lentiviral vectors displaying "early-acting cytokines" selectively promote survival and transduction of NOD/SCID repopulating human hematopoietic stem cells Blood, November 15, 2005; 106(10): 3386 - 3395. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Pilat, S. Carotta, B. Schiedlmeier, K. Kamino, A. Mairhofer, E. Will, U. Modlich, P. Steinlein, W. Ostertag, C. Baum, et al. HOXB4 enforces equivalent fates of ES-cell-derived and adult hematopoietic cells PNAS, August 23, 2005; 102(34): 12101 - 12106. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Moser, J. W. Upton, R. D. Allen III, C. B. Wilson, and S. H. Speck Role of B-Cell Proliferation in the Establishment of Gammaherpesvirus Latency J. Virol., August 1, 2005; 79(15): 9480 - 9491. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Leibundgut, N. M.R. Schmitz, and A. Hirt Catalytic Activities of G1 Cyclin-Dependent Kinases and Phosphorylation of Retinoblastoma Protein in Mobilized Peripheral Blood CD34+ Hematopoietic Progenitor Cells Stem Cells, August 1, 2005; 23(7): 1002 - 1011. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Li, M. M. Le Beau, S. Ciccone, F.-C. Yang, B. Freie, S. Chen, J. Yuan, P. Hong, A. Orazi, L. S. Haneline, et al. Ex vivo culture of Fancc-/- stem/progenitor cells predisposes cells to undergo apoptosis, and surviving stem/progenitor cells display cytogenetic abnormalities and an increased risk of malignancy Blood, May 1, 2005; 105(9): 3465 - 3471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Munitic, P. E. Ryan, and J. D. Ashwell T Cells in G1 Provide a Memory-Like Response to Secondary Stimulation J. Immunol., April 1, 2005; 174(7): 4010 - 4018. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. De Falco, D. Porcelli, A. R. Torella, S. Straino, M. G. Iachininoto, A. Orlandi, S. Truffa, P. Biglioli, M. Napolitano, M. C. Capogrossi, et al. SDF-1 involvement in endothelial phenotype and ischemia-induced recruitment of bone marrow progenitor cells Blood, December 1, 2004; 104(12): 3472 - 3482. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Cousins, K. J. Woodward, J. G. Gross, T. A. Partridge, and J. E. Morgan Regeneration of skeletal muscle from transplanted immortalised myoblasts is oligoclonal J. Cell Sci., July 1, 2004; 117(15): 3259 - 3269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Ahmed, S. J. Ings, A. R. Pizzey, M. P. Blundell, A. J. Thrasher, H. T. Ye, A. Fahey, D. C. Linch, and K. L. Yong Impaired bone marrow homing of cytokine-activated CD34+ cells in the NOD/SCID model Blood, March 15, 2004; 103(6): 2079 - 2087. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D.-W. Kim, Y.-J. Chung, T.-G. Kim, Y.-L. Kim, and I.-H. Oh Cotransplantation of third-party mesenchymal stromal cells can alleviate single-donor predominance and increase engraftment from double cord transplantation Blood, March 1, 2004; 103(5): 1941 - 1948. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Shibuya, J. Shirakawa, T. Kameyama, S.-i. Honda, S. Tahara-Hanaoka, A. Miyamoto, M. Onodera, T. Sumida, H. Nakauchi, H. Miyoshi, et al. CD226 (DNAM-1) Is Involved in Lymphocyte Function-associated Antigen 1 Costimulatory Signal for Naive T Cell Differentiation and Proliferation J. Exp. Med., December 15, 2003; 198(12): 1829 - 1839. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. N. Levasseur, T. M. Ryan, K. M. Pawlik, and T. M. Townes Correction of a mouse model of sickle cell disease: lentiviral/antisickling {beta}-globin gene transduction of unmobilized, purified hematopoietic stem cells Blood, December 15, 2003; 102(13): 4312 - 4319. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. Helgason, J. Antonchuk, C. Bodner, and R. K. Humphries Homeostasis and regeneration of the hematopoietic stem cell pool are altered in SHIP-deficient mice Blood, November 15, 2003; 102(10): 3541 - 3547. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Kurre, J. Morris, B. Thomasson, D. B. Kohn, and H.-P. Kiem Scaffold attachment region-containing retrovirus vectors improve long-term proviral expression after transplantation of GFP-modified CD34+ baboon repopulating cells Blood, November 1, 2003; 102(9): 3117 - 3119. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Quesenberry, G. A. Colvin, and J.-F. Lambert The chiaroscuro stem cell: a unified stem cell theory Blood, December 15, 2002; 100(13): 4266 - 4271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Roesler, S. Brenner, A. A. Bukovsky, N. Whiting-Theobald, T. Dull, M. Kelly, C. I. Civin, and H. L. Malech Third-generation, self-inactivating gp91phox lentivector corrects the oxidase defect in NOD/SCID mouse-repopulating peripheral blood-mobilized CD34+ cells from patients with X-linked chronic granulomatous disease Blood, December 15, 2002; 100(13): 4381 - 4390. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Chute, A. A. Saini, D. J. Chute, M. R. Wells, W. B. Clark, D. M. Harlan, J. Park, M. K. Stull, C. Civin, and T. A. Davis Ex vivo culture with human brain endothelial cells increases the SCID-repopulating capacity of adult human bone marrow Blood, December 15, 2002; 100(13): 4433 - 4439. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Cashman, B. Dykstra, I. Clark-Lewis, A. Eaves, and C. Eaves Changes in the Proliferative Activity of Human Hematopoietic Stem Cells in NOD/SCID Mice and Enhancement of Their Transplantability after In Vivo Treatment with Cell Cycle Inhibitors J. Exp. Med., November 4, 2002; 196(9): 1141 - 1150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Huygen, O. Giet, V. Artisien, I. Di Stefano, Y. Beguin, and A. Gothot Adhesion of synchronized human hematopoietic progenitor cells to fibronectin and vascular cell adhesion molecule-1 fluctuates reversibly during cell cycle transit in ex vivo culture Blood, September 26, 2002; 100(8): 2744 - 2752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Fukuda, R. G. Foster, S. B. Porter, and L. M. Pelus The antiapoptosis protein survivin is associated with cell cycle entry of normal cord blood CD34+ cells and modulates cell cycle and proliferation of mouse hematopoietic progenitor cells Blood, September 18, 2002; 100(7): 2463 - 2471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Lu, C. Quan, F. Li, L. Vida, and G. R. Honig Hematopoietic Progenitor Cells Derived from Embryonic Stem Cells: Analysis of Gene Expression Stem Cells, September 1, 2002; 20(5): 428 - 437. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wilpshaar, M. Bhatia, H. H. H. Kanhai, R. Breese, D. K. Heilman, C. S. Johnson, J. H. F. Falkenburg, and E. F. Srour Engraftment potential of human fetal hematopoietic cells in NOD/SCID mice is not restricted to mitotically quiescent cells Blood, June 17, 2002; 100(1): 120 - 127. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. C. Josephson, G. Vassilopoulos, G. D. Trobridge, G. V. Priestley, B. L. Wood, T. Papayannopoulou, and D. W. Russell Transduction of human NOD/SCID-repopulating cells with both lymphoid and myeloid potential by foamy virus vectors PNAS, June 11, 2002; 99(12): 8295 - 8300. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Hossle, R. A. Seger, and D. Steinhoff Gene Therapy of Hematopoietic Stem Cells: Strategies for Improvement Physiology, June 1, 2002; 17(3): 87 - 92. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Glimm, P. Tang, I. Clark-Lewis, C. von Kalle, and C. Eaves Ex vivo treatment of proliferating human cord blood stem cells with stroma-derived factor-1 enhances their ability to engraft NOD/SCID mice Blood, May 1, 2002; 99(9): 3454 - 3457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Giet, D. R. Van Bockstaele, I. Di Stefano, S. Huygen, R. Greimers, Y. Beguin, and A. Gothot Increased binding and defective migration across fibronectin of cycling hematopoietic progenitor cells Blood, March 15, 2002; 99(6): 2023 - 2031. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-J. Lataillade, D. Clay, P. Bourin, F. Herodin, C. Dupuy, C. Jasmin, and M.-C. Le Bousse-Kerdiles Stromal cell-derived factor 1 regulates primitive hematopoiesis by suppressing apoptosis and by promoting G0/G1 transition in CD34+ cells: evidence for an autocrine/paracrine mechanism Blood, February 15, 2002; 99(4): 1117 - 1129. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Dao, J. Hwa, and J. A. Nolta Molecular mechanism of transforming growth factor beta -mediated cell-cycle modulation in primary human CD34+ progenitors Blood, January 15, 2002; 99(2): 499 - 506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Mantel, P. Hendrie, and H. E. Broxmeyer Steel Factor Regulates Cell Cycle Asymmetry Stem Cells, November 1, 2001; 19(6): 483 - 491. [Abstract] [Full Text]
|
|
|
|
|
|
M. I. D. Rossi, K. L. Medina, K. Garrett, G. Kolar, P. C. Comp, L. D. Shultz, J. D. Capra, P. Wilson, A. Schipul, and P. W. Kincade Relatively Normal Human Lymphopoiesis but Rapid Turnover of Newly Formed B Cells in Transplanted Nonobese Diabetic/SCID Mice J. Immunol., September 15, 2001; 167(6): 3033 - 3042. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Drouet, F. Herodin, F. Norol, F. Mourcin, and J.F. Mayol Cell Cycle Activation of Peripheral Blood Stem and Progenitor Cells Expanded Ex Vivo with SCF, FLT-3 Ligand, TPO, and IL-3 Results in Accelerated Granulocyte Recovery in a Baboon Model of Autologous Transplantation but G0/G1 and S/G2/M Graft Cell Content Does Not Correlate with Tranplantability Stem Cells, September 1, 2001; 19(5): 436 - 442. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
) and S/G2/M (
)
determined (A). (B) Corresponding distributions of these cells (except
for those expressing CD34) between G0 (
). Cell cycle analyses were
performed by FACS after staining of fixed cells with PI. Panel B
compares the number of total cells, CFCs, and LTC-ICs in the same 3 experiments.
)
hematopoietic cells show altered expression of a subset of genes
associated with early cytokine and differentiation responses of their
adult counterparts. Blood. 2000;96.
4