|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 96 No. 2 (July 15), 2000:
pp. 459-466
GENE THERAPY
NFAT-controlled expression of GFP permits visualization and
isolation of antigen-stimulated primary human T cells
Erik Hooijberg,
Arjen Q. Bakker,
Janneke J. Ruizendaal, and
Hergen Spits
From the Department of Immunology, The Netherlands Cancer
Institute/Antoni van Leeuwenhoek Hospital, Amsterdam, The Netherlands.
 |
Abstract |
We have developed a new method that allows detection and isolation
of viable, antigen-specific, human T cells from a heterogeneous pool of
T cells. We have engineered a self-inactivating retroviral vector
containing multiple (3 or 6) nuclear factor of activated T-cell
(NFAT)-binding sites, followed by the minimal IL2 promoter and the
reporter gene GFP. Jurkat cells, primary
T-cell blasts, and T-cell clones were transduced with high
efficiency (20%-40%). Stimulation of the transduced cells with
phorbol myristate acetate (PMA) and ionomycin resulted in
a high level expression of GFP that was maximal after 12 to 14 hours
and remained stable for another 12 hours. Activation of T cells
carrying the construct containing 6 NFAT-binding sites resulted in the
highest mean fluorescence intensity. Cyclosporin-A and FK506 were able
to block the activation-dependent GFP expression. Activation of
transduced T-cell blasts with the superantigen staphylococcal
enterotoxin B or of transduced antigen-specific T-cell clones with
cognate antigen resulted in GFP expression. After an overnight
stimulation of a heterogeneous T-cell bulk culture with an HLA
mismatched stimulator cell (JY), the GFP expressing cells were cloned.
As expected, the cloning frequency of the antigen-specific GFP+ cells was considerably higher than that of the total
T-cell population. Most of the T-cell clones were either cytolytic, or
proliferative toward JY stimulator cells. Interestingly, we also
isolated T-cell clones that were noncytolytic and nonproliferative
toward JY cells, but specifically up-regulated GFP after an overnight
stimulation with JY.
(Blood. 2000;96:459-466)
© 2000 by The American Society of Hematology.
| |
Introduction |
Triggering of the T-cell receptor (TCR) leads to signal
transduction cascades and subsequent activation of gene transcription. Members of the nuclear factor of activated T cells (NFAT) family of
transcription factors play a key role in activation of gene transcription in T cells. NFAT family members and the phosphatase calcineurin, which is found upstream of NFAT transcription factors in
the signal transduction pathway, have been implicated in the regulation
of expression of a number of cytokine genes, among which are IL-2,
IFN- , and TNF- (reviewed in Rau et al1).
Expression vector constructs have been used in the past containing
multiple NFAT-binding sites and the bacterial reporter gene
 -galactosidase (LacZ).2-4 It has been shown that T-cell lines transfected with such constructs express LacZ on activation through the TCR. In principle, one should be able to isolate
antigen-specific T cells from a primary polyclonal T-cell population by
sorting the cells that express the reporter gene product after
stimulation with antigen. This approach would obviate the
time-consuming in vitro stimulation and restimulations that are
required to sufficiently enrich antigen-specific T cells before cloning
these cells.5 Also, this approach would allow direct
isolation of antigen-specific T cells from a polyclonal pool of T cells
without prior knowledge of the antigen or the restriction element that
is required for isolation of T cells with HLA/peptide tetramers. The
methods that have been used to express LacZ in Jurkat cells are,
however, of limited use for primary T cells. The transfection
efficiencies of primary T cells using classical methods, like
electroporation, are very low. Moreover, the staining procedures used,
by using X-gal or FDG as substrates for the enzyme -galactosidase,
are suboptimal because the T cells have to be fixed or undergo an osmotic shock.
Here we describe the construction of a number of self-inactivating
(SIN) retroviral constructs carrying multiple (3 or 6) NFAT-binding
sites, followed by the minimal IL2 promoter and the reporter gene,
green fluorescent protein (GFP). Because the 3' LTR of
the retroviral vector carries a deletion in the U3 region, the promoter
activity of this LTR is abrogated on integration into the genome of the
transduced cell and the expression of GFP has then become dependent on
binding of NFAT and AP-1 transcription factors to the multiple
NFAT-binding sites. Here we show the potentiality of this system to
visualize viable activated T cells. Furthermore, we document the
application of this system to isolate antigen-specific T-cell clones
from a heterogeneous T-cell population.
| |
Materials and methods |
Cell lines
Phoenix cells, melanoma cells, and EBV-B cell lines, including JY
cells, were grown in complete medium consisting of Iscove's (Life
Technologies BV, Breda, The Netherlands) supplemented with 5% to 10%
fetal calf serum (BioWhittaker, Verviers, Belgium), penicillin, and streptomycin (Boehringer Mannheim, Mannheim, Germany).
T-cell blasts and T-cell clones
T-cell blasts were prepared by incubation of
5 × 105 peripheral blood mononuclear cells (PBMCs)
per milliliter in Yssels medium6 supplemented with 1%
normal human serum (NHS) and 2 µg/mL phytohaemagglutinin (PHA). The resulting blasts were phenotyped after 1 week
and were shown to contain T cells only, as all cells expressed CD3 in
combination with CD4 or CD8 (data not shown). To maintain T-cell blasts
and antigen-specific T-cell clones, the T cells
(3 × 105 cells per well) were stimulated weekly
with a feeder cell mixture of 10 × 105 irradiated
(50 Gy) allogeneic PBMCs per milliliter and 1 × 105 irradiated EBV-B cells (JY), supplemented with 100 ng/mL PHA and 10 IU/mL IL-2 (Chiron, Amsterdam, The Netherlands) in Yssels medium. Cell cultures were kept in incubators at 37°C in humidified air containing 5% CO2.
Isolation and cloning of antigen-specific T cells
T cells transduced with the reporter construct
SIN-(NFAT)6-GFPs were isolated on the basis of GFP
expression. After an overnight incubation with stimulator cells, GFP
positive cells were sorted using a FACStar plus (Becton Dickinson, San
Jose, CA) and cloned by single cell deposition in 96-wells plates
containing 100 µL feeder cell mixture per well. The isolated T cells
were grown for 2 to 3 weeks in these plates, weekly adding
IL-2-containing medium, after which the clones were transferred to
24-well plates containing 1 mL of feeder cell mixture, as described
above. Isolated clones were subsequently phenotyped and analyzed for
antigen specificity and function.
Construction of retroviral vectors
We have made 2 SIN retroviral constructs carrying multiple (3 or 6)
NFAT-binding sites, followed by the minimal IL2 promoter (IL-2Pmin) and the reporter gene, encoding the enhanced
green fluorescent protein (GFP from Clontech Laboratories, Palo Alto, CA). We have constructed the SIN-(NFAT)x-GFP constructs as
follows: the two 5' phosphorylated primers NFAT I
(AATTAGGAGGAAAAACTGTTTCATACAGAAGGCGTCAA- TTGTC) and NFAT II
(CCGGGACCAATTGACGCCTTCTGTATGAAA- CAGTTTTTCCTCCT) (Perkin Elmer,
Nieuwerkerk a/d Yssel, The Netherlands) were mixed in equimolar
amounts, melted, reannealed, and subsequently ligated into pBluescript
KS+ (Stratagene, La Jolla, CA) cut with EcoRI and
XmaI to yield pBS-NFAT#1 (all restriction enzymes were obtained
from Roche Diagnostics Nederland BV, Almere, The Netherlands). This
plasmid was cut with MunI and XmaI to ligate the next
NFAT-binding site generating pBS-NFAT#2. This last step was repeated
once more to obtain pBS-NFAT#3. To double the number of NFAT-binding
sites, pBS-NFAT#3 was cut with XhoI and EcoRV and in
here the XhoI-SmaI fragment from pBS-NFAT#3 was
ligated, resulting in pBS-NFAT#6.
The IL2 minimal promoter (pos. 60 to 6) was amplified by
means of polymerase chain reaction (PCR) with primers
IL2P-5' (GAGCCCGGGACATTTTGACACCCCCATAAT) and
IL2P-3'
(CGCGGATCCAACCCATGGAATTCAGGAGTTGAGGTTACTGTGAGTAG) from plasmid
NFATZ,2 hereby also directly optimizing the translation initiation site for Kozak consensus.7 This amplicon was cut with XmaI and BamHI, ligated into pBS-NFAT#3, and
pBS-NFAT#6 cut with the same enzymes obtaining
pBS-NFAT#3-IL2Pmin and
pBS-NFAT#6-IL2Pmin. Between the NcoI
and BamHI sites of these vectors, the GFP was ligated
generating pBS-NFAT#3(#6)-IL2Pmin-GFP.
The sequences of all subsequent steps were confirmed by fluorescent
sequencing using Dye-terminator chemistry and 373A sequencer (Perkin
Elmer). These NFAT#3/#6-GFP cassettes were shuttled to the SIN
retroviral construct RetroTet8 using the unique
XhoI and BamHI sites. These constructs were further
modified by introducing the EBNA/OriP and Puromycin selection cassette
from the LZRSpBMN vector,9 making use of the RcaI
sites in both retroviral vectors. These final episomal retroviral
self-inactivating vectors are designated SIN-(NFAT)3-GFP
and SIN-(NFAT)6-GFP, respectively. As a positive control
for transduction efficiencies, we have also used the LZRSpBMN
retroviral vector9 (a kind gift from Dr G. Nolan, Stanford
University, Stanford, CA), which we modified to contain the GFP
gene.10
Production of retroviral supernatants
The constructs were transfected into a helper-virus free amphotropic
producer cell line Phoenix-A, a derivative of the human embryonic
kidney cell line 293 (a kind gift of Dr G. Nolan) using either calcium
phosphate (Life Technologies BV, Breda, The Netherlands) or Fugene-6
(Roche Diagnostics), according to manufacturers protocols. Two days later, selection of transfected cells started by the addition
of 2 µg/mL puromycin (Clontech Laboratories). Ten to 14 days after
transfection, 6 × 106 cells were plated per 10-cm petri dishes (Becton Dickinson) in 10 mL complete medium without puromycin. The next day the medium was refreshed and, on the following day, retroviral supernatant was harvested, centrifuged, and frozen in
cell-free aliquots at 70°C. This approach affords a
reproducible rapid, large scale, and high titer retroviral production
of over 3 × 106 infectious virus particles per milliliter.
Transduction method
The recombinant human fibronectin fragments CH-296 transduction
procedure (RetroNectin; Takara, Otsu, Japan) was based on a method
developed by Hanenberg et al.11 Nontissue culture-treated Falcon petri dishes (3 cm diameter) (Becton Dickinson) were coated with
2 mL of 30 µg/mL recombinant human fibronectin fragment CH-296 at
room temperature for 2 hours or overnight at 4°C. The CH-296 solution was removed, followed by incubation of the petri dishes with
2% human serum albumin in phosphate-buffered saline (PBS) for 30 minutes at room termperature. Before use, the petri dishes were washed
twice with PBS. T cells were prestimulated with PHA12 or
with a feeder cell mixture containing PHA and IL-2 for 32 to 48 hours
before transduction to get them into cycle. Subsequently, the target
cells were plated on RetroNectin-coated dishes (maximum 5 × 106 cells per petri dish) in 0.5 mL of complete
medium mixed with 1 mL of thawed retroviral supernatant. Cells were
cultured at 37°C for 6 hours or overnight, washed, and transferred
to 24-well culture plates (Falcon plastics, Becton Dickinson).
T-cell stimulations with PMA and ionomycin, staphylococcal
enterotoxin B, EBV-B cells, or melanoma cells
The percentage GFP positive cells, as determined by flow cytometric
analysis 3 to 4 days after transduction, was used as a measure of
transduction efficiency with the standard LZRS-GFP construct. The
efficiency of transduction of T cells with SIN-(NFAT)x-GFP constructs was determined by measuring the GFP expression after overnight stimulation of the cells with PMA (final concentration 10 ng/mL) in combination with ionomycin (final concentration 2.2 µmol/L), assuming that this stimulation protocol stimulates all transduced cells. To block induction of GFP, we used CsA (Sigma Chemical, St Louis, MO) or FK506 (Tacrolimus, Fujisawa Ireland Ltd,
Kerry, Ireland) in the final concentrations mentioned in the figure legend.
T-cell stimulations with the superantigen SEB (Sigma) were performed as
previously described.13 In brief, T cells
(10 × 104) were incubated overnight (14-18 hours)
in the presence or absence of autologous EBV-B cells
(1 × 104) in round-bottom wells in a total volume
of 200 µL Yssel's medium, in the presence or absence of the
indicated concentrations of SEB.
T-cell stimulations with JY cells, autologous EBV-B cells, or melanoma
cells were performed overnight (14-18 hours) in round-bottom wells in a
total volume of 200 µL Yssel's medium. T cells
(10 × 104) were incubated with target cells
(10 × 104) in the presence or absence of saturating
concentrations of blocking antibodies. The antibodies used were
specific for HLA class I (hybridoma supernatant from clone W6/32, ATCC,
Rockville, MD), HLA-DR (diluted ascitesfluid from clone R3E2; a kind
gift from Dr RAW van Lier, CLB, Amsterdam, The Netherlands), or HLA-DQ
(hybridoma supernatant from clone SPV-L3, isolated in our laboratory).
Flow cytometric analysis
Antibodies against the human molecules CD3, CD4, CD8, CD20, and
HLA-DR (all from Becton Dickinson), directly labeled with phycoerythrin, were used for flow cytometric analysis. Stained cells
were analyzed using a FACScan (Becton Dickinson) and FACS data were
processed with Cell Quest computer software (Becton Dickinson).
Chromium release assays
Cytotoxicity of T-cell clones was determined using a standard
chromium release assay described previously.14 All assays were performed in the presence of a 50-fold excess of unlabeled K562
cells to block nonspecific lysis of the target cells. The spontaneous
release varied between 10% to 40% of the maximum. Standard deviation
of triplicate determinations never exceeded 10% of the means. A clone
was considered to be cytotoxic when the percentage specific chromium
release on JY target cells was 30% or higher at an effector-to-target
ratio of 30:1. A clone was considered to be noncytotoxic when the lysis
was less than 15% at an effector-to-target ratio of 90:1.
Proliferation assays
T cells (105) were incubated in the absence or presence
of target cells (104) in round-bottom plates in a total
volume of 200 µL. As a control, T cells and target cells were
incubated in separate wells. Cells were allowed to proliferate for 3 to
4 days, after which 3H-thymidine was added for an
additional incubation period of 8 to 16 hours. The assay was harvested
using the Packard Filtermate system and the radioactivities were
measured on a TopCount (Packard Instruments, Meriden,
CT). Clones were considered to be proliferative toward
stimulator cells when the incorporated cells per minute in the presence of stimulator cells was at least 2 times as high as the
sum of cells per minute of T cells alone plus stimulator cells alone.
Clones were considered to be nonproliferative toward the stimulator
cells when the counts per minute in the presence of stimulators did not
exceed the counts per minute of either T cells alone or stimulators alone.
Cytokine production assays
The production of cytokines was measured after a 48-hour incubation
of 1 million T cells in a total volume of 1 mL of complete medium in
the absence or presence of PMA and ionomycin or equal numbers of EBV-B
cells. Cell-free supernatants were collected and used in appropriate
dilutions in sandwich enzyme-linked immunosorbent assays (ELISAs).
Pelikine Compact ELISA kits were used for IL-4, IL-10, and IFN,
according to manufacturer's protocols (CLB, Amsterdam, The
Netherlands). The cytokine production experiments were performed 3 times, all determinations were performed in duplicate. Data from
representative experiments are shown in the figures as production in
picogram per million cells per 24 hours.
| |
Results |
T cells transduced with SIN-(NFAT)x-GFP are triggered,
by PMA and ionomycin, to express the reporter gene GFP
We have constructed a number of self-inhibiting retroviral vectors
containing 3 or 6 NFAT-binding sites, followed by the minimal IL-2
promoter and the reporter gene GFP (Figure
1). To test the functionality of the
constructs, we transduced Jurkat cells and T-cell blasts derived from
PBMC of healthy donors. As a control for the transduction efficiency,
we also transduced part of the cells with a control virus containing
GFP under transcriptional control of the intact viral
LTR.10 The efficiency of transduction with SIN-(NFAT)x-GFP
containing retroviruses was estimated from the GFP expression after
overnight stimulation with PMA and ionomycin and varied between 20%
and 40%, which is comparable to the results obtained with the control
virus LZRS-GFP (data not shown). In Figure
2A, we show the kinetics of induction of
GFP expression in transduced Jurkat cells and bulk T-cell blasts from a
healthy donor after stimulation with PMA and ionomycin. The results are expressed relative to the maximal level of GFP expression that was
reached after 12 to 14 hours and remained stable for another 12 hours
in all cases. The percentages of GFP positive cells that were induced
from cells carrying either the 3 or the 6 NFAT-binding site constructs
were similar. However, large differences between the 2 different NFAT
constructs were observed in the mean fluorescence intensity (MFI). In
Jurkat cells (Figure 2B), the MFI ratio of SIN-(NFAT)6-GFP
over SIN-(NFAT)3-GFP is around 4 and in T-cell blasts (HSP)
(Figure 2C), the ratio is 2 at any time point after stimulation.
Similar results were obtained with T cells from 2 other donors (data
not shown). Importantly, not only Jurkat cells and total T-cell blasts
can be triggered to express GFP after stimulation with PMA plus
ionomycin, but also sorted CD4+ and CD8+ T
cells (Figure 2D and data not shown). Activation and subsequent GFP
expression can be blocked by CsA and by FK506 (Figure 2D). Note that
FK506 is a much more potent inhibitor of GFP expression than CsA. Only
10 nmol/L of FK506 is sufficient to block GFP expression completely,
whereas 300 nmol/L of CsA is needed for the same effect. GFP expression
is blocked completely in transduced Jurkat cells at 100 nmol/L CsA and
10 nmol/L FK506 (data not shown).
View larger version (17K):
[in this window]
[in a new window]
| Fig 1.
The SIN-(NFAT)x-GFP retroviral
construct.
The SIN-(NFAT)x-GFP-retroviral vector contains a puromycin
resistance gene for selection purposes, and EBNA sequences to maintain
high copy numbers of the transfected construct in the amphotropic
producer line Phoenix, enabling the production of high titer viral
supernatants. Transduction of target T cells with the retrovirus,
containing the 5'LTR-(NFAT)x-GFP-3'LTR only,
ensures that expression of the reporter gene is dependent on binding of
transcription factors to the multiple NFAT-binding sites, because an
introduced deletion in the U3 region of the 3'LTR (which, on
integration, will function as the upstream LTR) prevents promoter
activity of this LTR. Thus only activation of the T cell will lead to
expression of GFP. eGFP, enhanced EFP.
|
|
View larger version (104K):
[in this window]
[in a new window]
| Fig 2.
Time course of induction of GFP in
SIN-(NFAT)x-GFP transduced Jurkat cells and primary
T-cell bulk cultures.
(A-C) Unsorted, SIN-(NFAT)3-GFP- (open
symbols and bars) or SIN-(NFAT)6-GFP- (filled symbols and
bars) transduced, Jurkat T cells (panel B; panel A, squares) and bulk T
cells from a healthy donor (H.S.P.) (panel C; panel A, circles) were
stimulated with PMA in combination with ionomycin. The percentage of
GFP expressing cells, relative to the maximal level, which varied
between 20% to 40%, and the MFI of GFP positive cells are plotted
against the time in hours after initial stimulation. Shown are
representative data from 3 independent experiments. (D) GFP expression
in SIN-(NFAT)6-GFP-transduced cells is blocked by CsA and
by FK506. T cells transduced with the SIN-(NFAT)6-GFP
construct were incubated overnight in medium containing PMA and
ionomycin. The percentage of GFP positive cells reached was set to
100%. Next, CsA or FK506 (final concentrations are shown), which are
inhibitors of calcineurin and thus of expression of GFP, were added 30 minutes before the addition of PMA and ionomycin. Indicated is the
percentage of GFP positive cells. Bars represent the following: bulk
T-cell blasts (black), sorted CD4+ T cells (hatched), and
sorted CD8+ T cells (dotted) all derived from donor K.W.E.,
and bulk T-cell blasts from donor H.S.P. (striped). Shown are
representative data from 3 independent experiments.
|
|
Stimulation with the combination of PMA and ionomycin to estimate the
transduction efficiencies results in a slight underestimation thereof.
Around 10% of cells properly transduced with either of the retroviral
constructs remain unresponsive to such a stimulus (data not shown). The
observed bimodal expression pattern is consistent with the data of
others, using either a different NFAT-based reporter system2 or the mouse IL2 promoter region linked to the LacZ reporter gene.15
Expression of GFP after triggering of the TCR with SEB in bulk
T-cell blasts transduced with SIN-(NFAT)6-GFP
Having demonstrated that the constructs are functional with the
combination of PMA and ionomycin as stimulus for the transduced cells,
we examined the consequences of triggering of the TCR by superantigens.
We have used the superantigen SEB, which binds to MHC class II on
antigen-presenting cells (eg, EBV-B cells) and to relevant V regions
of the TCR.16,17
T-cell blasts derived from a healthy donor were transduced with
SIN-(NFAT)6-GFP. In preliminary experiments, we
observed that a small proportion (0.5%-2%) of the transduced cells
expressed GFP constitutively. This is presumably due to insertion
of the GFP gene in a transcriptionally active region.
Therefore, the transduced T cells were first sorted to remove cells
expressing GFP constitutively. Subsequently, these cells were
incubated overnight with autologous EBV-B cells in the presence of
increasing concentrations of SEB. Incubation of the T cells in medium
alone or in the presence of autologous EBV-B cells did not lead to the
expression of GFP. Stimulation of T cells with EBV-B cells and
increasing concentrations of SEB gave rise to increasing numbers of
T cells expressing GFP (Figure
3). At the highest
concentrations of SEB used, 4% of the cells expressed GFP, which
equals around 20% of the cells carrying the
SIN-(NFAT)6-GFP construct (as the maximum percentage of GFP positive cells after PMA and ionomycin stimulation was 19%). Although the percentage of SEB reactive T cells varies among individual donors,
our findings are in good agreement with the expected percentage of SEB reactive T cells from an average donor, which ranges
from 10% to 30% of total T cells.17 More
important than the quantitative aspect of these findings is the notion
that physiologic triggering of the TCR of SEB reactive T cells induces
the expression of GFP.
View larger version (17K):
[in this window]
[in a new window]
| Fig 3.
SEB concentration-dependent induction of
GFP in SIN-(NFAT)6-GFP-transduced unfractionated T-cell
cultures.
SIN-(NFAT)6-GFP-transduced T cells were stimulated
overnight in the presence of different concentrations of SEB presented
by autologous EBV-B cells. As negative controls, T cells were incubated
in medium alone or with the autologous EBV-B cells alone. As a
positive control, we incubated cells with PMA in combination with
ionomycin. Indicated in the figure is the percentage of GFP positive
cells. Shown are representative data from 2 independent experiments.
|
|
Antigen-specific triggering of the TCR leads to expression of GFP in
an alloreactive CD4+ T-cell clone and in a melanoma
specific CD8+ T-cell clone.
Triggering of the TCR by its cognate antigenic peptide bound
to the appropriate MHC molecule should lead to GFP expression in T-cell
clones transduced with the reporter construct
SIN-(NFAT)6-GFP. To test this, we used a well-characterized
T-cell clone, JS136, which is an HLA-DR6 restricted, CD4+
T-cell clone able to lyse the B-cell line JY in vitro.18,19 Incubation of SIN-(NFAT)6-GFP-transduced JS136 T cells
with JY cells induced expression of GFP in the T cells (Figure
4A). The expression of GFP could be blocked
by antibodies directed against HLA-DR, but not by HLA-class I or by
HLA-DQ antibodies. The same results were obtained in a chromium release
assay using JS136 as effectors and JY cells as targets (results not
shown). Not only SIN-(NFAT)6-GFP-transduced
CD4+ T-cell clones can be triggered to express GFP after
stimulation with the appropriate target cells, but also
CD8+ T-cell clones. To demonstrate this point, we have used
a melanoma-specific T-cell clone that is HLA-A2 restricted and specific
for the Mart-1/MelanA27-35 epitope (Figure 4B and data not
shown). These experiments show that T cells can be induced to express
GFP after specific triggering of the TCR. As is the case in classical
cytotoxicity assays, this specific activation of the T-cell clone via
the TCR can be blocked with appropriate antibodies directed against the
presenting MHC molecule.
View larger version (51K):
[in this window]
[in a new window]
| Fig 4.
Expression of GFP in JS136 and melanoma-specific T cell
clone.
(A) Induction of GFP expression in T-cell clone JS136
transduced with SIN-(NFAT)6-GFP by its specific target JY
is inhibited by anti-HLA-DR antibodies. JS136 T cells transduced with
the reporter construct SIN-(NFAT)6-GFP were incubated with
JY target cells in the presence or absence of anticlass I (W6/32) or
class II (anti-HLA-DQ or -DR) antibodies. Indicated is the percentage
of GFP positive T cells after an overnight incubation with JY target
cells. Non-JY EBV-B targets were used as negative controls and did not
induce GFP expression (data not shown). Stimulation of cells with PMA
and ionomycin served as a positive control. Shown are representative
data from 3 independent experiments. (B) Melanoma cells induce
expression of GFP in a Mart1/MelanA specific CD8+ T-cell
clone. Melanoma specific T cells transduced with the reporter construct
SIN-(NFAT)6-GFP were incubated with autologous melanoma
cells or EBV-B cells. Indicated is the percentage of GFP positive
cells. Stimulation of cells with PMA and ionomycin served as a positive
control. Shown are representative data from 2 independent
experiments.
|
|
Isolation of viable allo-specific T-cell clones from a heterogeneous
T-cell pool
Next we wanted to test whether alloreactive T cells can be isolated
from a heterogeneous T-cell pool using the NFAT-GFP reporter system.
For this purpose, we used donor (W.B.O.)-derived T cells (HLA-A24,9 A29,19 B7,
B58,17 Cw7, DR115, DR13(w6), DR52,
DQ1, DQ3) and HLA-mismatched (partly) stimulator cells:
JY (HLA-A2, B7, DR4, DRw6). Donor T cells
transduced with SIN-(NFAT)6-GFP were incubated overnight
with JY cells. T cells expressing GFP were sorted by FACS and
subsequently cloned by single cell deposition (Figure
5). In the first experiment, we compared
the plating efficiencies and the proportion of antigen-specific clones
isolated from T cells that were cloned from unsorted or from GFP-sorted
T-cell blasts. The plating efficiencies were comparable; 29% and 31%,
respectively. Six of the 23 CD4+ clones obtained from the
unsorted population proliferated to JY but not to the autologous
EBV-transformed B-cell line. The proportion of clones proliferating to
JY is quite high, but whether all of these clones were specific for
class II MHC antigens was not further investigated. By using the
reporter system, we found a 2-fold higher proportion of
CD4+ T-cell clones (23 of 45) that specifically
proliferated on JY targets and not on the autologous EBV-B cell line.
Only 1 of 98 CD8+ clones obtained from unsorted T cells was
able to lyse JY cells and not the autologous EBV-B cells, whereas 9 of
55 clones from the GFP-sorted cells were JY specific. Taken together,
cloning from GFP-sorted cells yielded a greater than 5-fold higher
proportion of JY-specific T-cell clones (32 of 100) than cloning from
unsorted cells (7 of 121). The data from the random cloning indicate an alloreactive T-cell precursor frequency of about 6%. The transduction efficiency of the T-cell blasts used was 30%. On the basis of the data
obtained with the JS136 T-cell clone and the melanoma specific T-cell
clone, we estimate that one fourth to one third of the cells in a given
clone can be triggered to express GFP after an overnight stimulation.
Simple multiplication of these numbers
(0.06 × 0.30 × 0.25 = 0.0045) would indicate that
maximally 1 of 222 ( = 0.45%) of the T-cell blasts should
up-regulate GFP after optimal stimulation with JY target cells. This is
in good agreement with the percentage of GFP+ cells sorted
(Figure 5).
View larger version (18K):
[in this window]
[in a new window]
| Fig 5.
Isolation of viable alloantigen specific T cells from a
heterogeneous T-cell pool.
Donor (W.B.O.)-derived unfractionated T cells transduced with
SIN-(NFAT)6-GFP were incubated overnight with JY cells as
stimulators at a ratio of 1:1. T cells expressing GFP were sorted by
means of flow cytometry and subsequently cloned at a single cell per
well. As controls, we incubated T cells in medium in the presence or
absence of PMA and ionomycin. All cells within the life gate are shown.
Transduction efficiency was 30%. The percentage of GFP positive cells
in the gate used to sort was approximately 0.2% to 0.3%.
|
|
In the second experiment, we repeated the cloning of transduced T-cell
blasts of the same donor W.B.O. to characterize in more detail the
clones obtained from SIN-(NFAT)6-GFP-transduced T-cell
blasts stimulated with JY cells. Twenty-three of the 41 isolated T-cell
clones were specific for JY, consistent with the results of the first
experiment. Both cytotoxic CD8+ T-cell clones (9 of 23 isolated clones) and proliferative CD4+ T-cell clones (10 of 23 isolated clones) were isolated. Apart from cytolytic and
proliferative T-cell clones, we also isolated 4 clones that are not
cytolytic, or proliferative (as defined in "Materials and
methods"), toward JY cells, but specifically up-regulated GFP after
stimulation with JY cells (4 of 23 isolated clones). A representative
example of such a clone is shown in Figure
6. The expression of GFP is up-regulated in
these T cells after incubation with JY target cells but not after
incubation in medium alone or in the presence of autologous EBV-B
cells. Three of these clones could be evaluated in cytokine production assays. In parallel to the modest but significant up-regulation of GFP,
clone 84 produced IL-4 (840 pg) and IL-10 (2960 pg), but no IFN
after incubation with JY stimulator cells for 48 hours (Figure
7). This clone 84 has the typical cytokine
production profile of an antigen specific Th2 cell. Two
other clones (79 and 89) also specifically up-regulated GFP after
stimulation with JY cells (data not shown). Clone 79 produced 8 times
more IL-4 in the presence of JY (160 pg) compared with the background
levels in the presence of autologous EBV-B cells (20 pg). Clone 89 did not respond by producing any of the cytokines tested, but may produce
yet other cytokines after specific stimulation with JY. Incubation with
PMA and ionomycin showed the intrinsic capacity of these clones to
produce large amounts of IL-4 and IFN. It is important to note that
none of these clones produced IFN on stimulation with JY cells. As
expected, stimulation of T cells with PMA and ionomycin did not
stimulate IL-10 production. Cytolytic (CTL) clone 110 is lytic toward
JY and was included in these experiments as a positive control as it
specifically produces IL-4, IL-10, and IFN on stimulation with
JY cells.
View larger version (44K):
[in this window]
[in a new window]
| Fig 6.
Up-regulation of GFP in T-cell clone 84 after stimulation
with JY target cells.
T cells of W.B.O. clone 84, which is noncytolytic and nonproliferative
toward JY cells, were incubated in medium alone, or together with
autologous EBV-B cells or with JY cells. Shown is the up-regulation of
GFP after an overnight incubation. Gates were set to exclude
CD20+ B cells.
|
|
View larger version (32K):
[in this window]
[in a new window]
| Fig 7.
Cytokine production by isolated T-cell clones that are
not cytolytic, or proliferative, toward JY cells.
Cytokine production assays were performed with 3 W.B.O. T-cell
clones (79, 84, and 89), which are noncytolytic and
nonproliferative toward JY cells. CTL clone 110 was included as a
positive control. Clone 84 is CD4+, the others are
CD8+. Indicated is the production in log picogram cytokine
per million cells per 24 hours. Bars indicate the following: T cells in
medium ( ), in medium plus PMA and ionomycin ( ), T cells
incubated with JY ( ), or autologous EBV-B ( ) stimulator
cells. Note that the scale for IFN is 2 logs higher that the other
2. Neither the autologous EBV-B cells nor the JY cells produce any of
the 3 cytokines tested here.
|
|
| |
Discussion |
Here we describe a retroviral reporter system that can be used to
isolate viable, antigen-specific, cytotoxic, or helper T cells. T-cell
blasts transduced with SIN-(NFAT)n-GFP up-regulate GFP
after activation with either polyclonal stimuli or with cognate antigen. As expected, the NFAT-controlled GFP expression was blocked by
the calcineurin inhibitors CsA and FK506. We have tested 2 retroviral
constructs differing in the number of NFAT-binding sites. No
differences were observed in the percentage of GFP positive cells
between the SIN-(NFAT)3-GFP and the
SIN-(NFAT)6-GFP after triggering of the T cells with PMA
and ionomycin. However, 6 NFAT-binding sites allow for a considerably
higher expression of GFP after activation than 3 binding sites,
indicating that the level of GFP expression is dependent on the
promoter activity of complexes of transcription factors bound to the
multiple NFAT-binding sites. It is possible that the level of GFP
expression after activation of transduced T cells can be enhanced by a
further increase of the number of binding sites incorporated in the
reporter construct. We observed that a small percentage of cells
expressed GFP constitutively. Single-cell sorting of these cells
yielded clones that also expressed GFP constitutively whether they were
activated or not. The proportion of cells expressing GFP constitutively
is not significantly influenced by the number of triplets used in the
reporter construct. We conclude therefore that constitutive GFP
expression is a reflection of random integration near an active
promoter region in the genome of the targeted cells.
The SIN-(NFAT)6-GFP construct was used to test some aspects
of this reporter system in an antigen-specific CD4+ T-cell
clone (JS136), which is both cytotoxic and proliferative toward JY
cells. Incubation of this clone with its target cell JY resulted in
expression of GFP. This interaction is specific because the reactivity
can be blocked with antibodies directed against HLA-DR. Interestingly,
not all the T cells within the population of cloned cells responded to
stimulation with its target cell in an overnight incubation. We have
observed that 7% of the JS136 T cells up-regulated GFP after
stimulation with JY, whereas 25% of the cells responded to stimulation
with the combination of PMA and ionomycin. We have also seen this
discrepancy in other clones with different specificities (Figure 4B and
results not shown). These observations indicate that approximately one
fourth to one third of the cells within a given population of cloned T
cells is capable of responding to antigen stimulation by up-regulating GFP. This finding is well in agreement with observations that use
intracellular staining for the production of cytokines in T-cell
clones,20 studies on cloned Jurkat cells stably transfected with an NFAT-LacZ expression vector,2 and studies on cloned T-cell hybridomas carrying a vector with the mouse IL-2 promoter region
coupled to the LacZ reporter gene.15
After having obtained proof of concept, we tested the possibility of
isolating alloreactive T cells from a heterogeneous T-cell pool in 2 separate experiments. A very high proportion of clones obtained from T
cells that expressed GFP after overnight stimulation with JY cells were
antigen specific. As expected, this proportion was considerably higher
than that of clones obtained from random cloning (without selecting the
GFP+ cells) of the same T-cell blasts. Both cytotoxic
CD8+ and proliferative CD4+ T-cell clones were
obtained, indicating that our reporter system allows for isolation not
only of IL-2-producing CD4+ T cells but also of
CD8+ CTL, that mostly do not produce IL-2. This finding is
consistent with the fact that NFAT-binding sites are implicated in the
control of expression of multiple cytokines, among which IL-2 (reviewed in Rau et al1). Interestingly, apart from these
"classical" clones, we also isolated T-cells clones that
specifically up-regulated GFP after an overnight stimulation with JY
target cells but were not cytolytic or proliferative toward JY cells.
Some of these clones also specifically produced IL-4 and/or IL-10, but
no IFN after stimulation with JY cells but not with the autologous
EBV-B cells. Such T-cell clones would not have been isolated using
cytotoxicity or proliferation as the only read out of functional
activity. Nor would these clones have been isolated using cytoplasmic
staining or ELISPOT-assays, as these assays are based on the production of IFN. It can therefore be envisioned that the present reporter system allows for isolation of T-cell clones with functions other than
classical helper (Th) or CTL activities, for example, T
cells with regulatory activities (Treg
cells).21
It is clear that the current NFAT-GFP reporter system allows for an
easier and more rapid isolation of antigen-specific T-cell clones than
the frequently used method of repeated in vitro stimulations of
polyclonal T cells, followed by random cloning of the responding T
cells by limiting dilution5 or single-cell deposition. The recently developed tetramer technology also allows the visualization and subsequent isolation of antigen-specific T-cell clones from a
polyclonal population of T cells.22 The use of tetramers
has the limitation that prior knowledge of the MHC restriction element and the antigenic peptide is required for their application. This is
not necessary for the reporter system presented here.
However, some drawbacks of the current system are that the T cells need
to be brought in cycle before being transduced and that the
transduction efficiencies are well below 100%. Moreover, not all cells
within a clonal population of T cells up-regulate GFP on activation.
Future improvements of this system include insertion of a marker under
control of a constitutive promoter element in the same retroviral
construct, which would permit isolation of the transduced cells before
activation. A further improvement of our system would be the use of
vectors that allow transduction of quiescent T cells.
| |
Acknowledgments |
We thank Dr H. M. Blau for the original self-inactivating retroviral
construct, Dr G. Nolan for the original LZRSpBMN retroviral vector and
the virus producer cell line Phoenix-A, Dr L. A. Herzenberg for plasmid
NFATZ, Dr J. Borst for the T cell line JS136, Dr R. A. W. van Lier for
HLA-DR (R3E2) antibodies, and Mr E. Notenboom and Mrs A. Pfauth for
expert technical assistance in FACS-sorting.
| |
Footnotes |
Submitted October 11, 1999; accepted February 27, 2000.
Supported by grant 96-1275 from the Dutch Cancer Society, Amsterdam,
The Netherlands.
Reprints: Hergen Spits, Department of Immunology, The
Netherlands Cancer Institute/Antoni van Leeuwenhoek Hospital, Plesmanlaan 121, NL-1066CX, Amsterdam, The Netherlands; e-mail: hergen{at}nki.nl.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Rao A, Luo C, Hogan PG.
Transcription factors of the NFAT family: regulation and function.
Annu Rev Immunol.
1997;15:707[Medline]
[Order article via Infotrieve].
2.
Fiering S, Northrop JP, Nolan GP, Mattila PS, Crabtree GR, Herzenberg LA.
Single cell assay of a transcription factor reveals a threshold in transcription activated by signals emanating from the T-cell antigen receptor.
Genes Dev.
1990;4:1823[Abstract/Free Full Text].
3.
Karttunen J, Shastri N.
Measurement of ligand-induced activation in single viable T cells using the lacZ reporter gene.
Proc Natl Acad Sci U S A.
1991;88:3972[Abstract/Free Full Text].
4.
Karttunen J, Sanderson S, Shastri N.
Detection of rare antigen-presenting cells by the lacZ T-cell activation assay suggests an expression cloning strategy for T-cell antigens.
Proc Natl Acad Sci U S A.
1992;89:6020[Abstract/Free Full Text].
5.
Sharrock CE, Kaminski E, Man S.
Limiting dilution analysis of human T cells: a useful clinical tool.
Immunol Today.
1990;11:281[Medline]
[Order article via Infotrieve].
6.
Yssel H, de Vries JE, Koken M, Van Blitterswijk W, Spits H.
Serum-free medium for generation and propagation of functional human cytotoxic and helper T cell clones.
J Immunol Methods.
1984;72:219[Medline]
[Order article via Infotrieve].
7.
Kozak M.
Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo.
Nature.
1984;308:241[Medline]
[Order article via Infotrieve].
8.
Hofmann A, Nolan GP, Blau HM.
Rapid retroviral delivery of tetracycline-inducible genes in a single autoregulatory cassette.
Proc Natl Acad Sci U S A.
1996;93:5185[Abstract/Free Full Text].
9.
Kinsella TM, Nolan GP.
Episomal vectors rapidly and stably produce high-titer recombinant retrovirus.
Hum Gene Ther.
1996;7:1405[Medline]
[Order article via Infotrieve].
10.
Heemskerk MHM, Hooijberg E, Ruizendaal JR, et al.
Enrichment of an antigen specific T cell response by retrovirally transduced human dendritic cells.
Cell Immunol.
1999;195:10[Medline]
[Order article via Infotrieve].
11.
Hanenberg H, Xiao XL, Dilloo D, Hashino K, Kato I, Williams DA.
Colocalization of retrovirus and target cells on specific fibronectin fragments increases genetic transduction of mammalian cells.
Nat Med.
1996;2:876[Medline]
[Order article via Infotrieve].
12.
Dardalhon V, Noraz N, Pollok K, et al.
Greenfluorescent protein as a selectable marker of fibronectin-facilitated retroviral gene transfer in primary human T lymphocytes.
Hum Gene Ther.
1999;10:5[Medline]
[Order article via Infotrieve].
13.
O'Hehir RE, Lamb JR.
Induction of specific clonal anergy in human T lymphocytes by Staphylococcus aureus enterotoxins.
Proc Natl Acad Sci U S A.
1990;87:8884[Abstract/Free Full Text].
14.
Hooijberg E, van den Berk PC, Sein JJ, et al.
Enhanced antitumor effects of CD20 over CD19 monoclonal antibodies in a nude mouse xenograft model.
Cancer Res.
1995;55:840[Abstract/Free Full Text].
15.
Emilie E, Peuchmaur M, Barad M, et al.
Visualizing interleukin 2 gene expression at the single cell level.
Eur J Immunol.
1989;19:1619[Medline]
[Order article via Infotrieve].
16.
Choi YW, Kotzin B, Herron L, Callahan J, Marrack P, Kappler J.
Interaction of Staphylococcus aureus toxin "superantigens" with human T cells.
Proc Natl Acad Sci U S A.
1989;86:8941[Abstract/Free Full Text].
17.
Kappler J, Kotzin B, Herron L, et al.
V beta-specific stimulation of human T cells by staphylococcal toxins.
Science.
1989;19:244811.
18.
Borst J, Spits H, Voordouw A, de Vries E, Boylston A, de Vries JE.
A family of T-cell receptor molecules expressed on T-cell clones with different specificities for allomajor histocompatibility antigens.
Hum Immunol.
1986;17:426[Medline]
[Order article via Infotrieve].
19.
Borst J, de Vries E, Spits H, de Vries JE, Boylston AW, Matthews EA.
Complexity of T cell receptor recognition sites for defined alloantigens.
J Immunol.
1987;139:1952[Abstract].
20.
Jung T, Wijdenes J, Neumann C, de Vries JE, Yssel H.
Interleukin-13 is produced by activated human CD45RA+ and CD45RO+ T cells: modulation by interleukin-4 and interleukin-12.
Eur J Immunol.
1996;26:571[Medline]
[Order article via Infotrieve].
21.
Groux H, O'Garra A, Bigler M, et al.
A CD4+ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis.
Nature.
1997;389:737[Medline]
[Order article via Infotrieve].
22.
Dunbar PR, Ogg GS, Chen J, Rust N, van der Bruggen P, Cerundolo V.
Direct isolation, phenotyping and cloning of low-frequency antigen-specific cytotoxic T lymphocytes from peripheral blood.
Curr Biol.
1998;8:413[Medline]
[Order article via Infotrieve].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Touma, Z.-Y. J. Sun, L. K. Clayton, W. E. Marissen, A. M. Kruisbeek, G. Wagner, and E. L. Reinherz
Importance of the CD3{gamma} Ectodomain Terminal beta-Strand and Membrane Proximal Stalk in Thymic Development and Receptor Assembly
J. Immunol.,
March 15, 2007;
178(6):
3668 - 3679.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Schotte, M. Nagasawa, K. Weijer, H. Spits, and B. Blom
The ETS Transcription Factor Spi-B Is Required for Human Plasmacytoid Dendritic Cell Development
J. Exp. Med.,
December 6, 2004;
200(11):
1503 - 1509.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. W. H. G. Kessels, M. D. van den Boom, H. Spits, E. Hooijberg, and T. N. M. Schumacher
Changing T cell specificity by retroviral T cell receptor display
PNAS,
December 19, 2000;
97(26):
14578 - 14583.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction