|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 96 No. 2 (July 15), 2000:
pp. 491-497
HEMATOPOIESIS
A new transacting factor that modulates hypoxia-induced
expression of the erythropoietin gene
Madhu Gupta,
Paul T. Mungai, and
Eugene Goldwasser
From the Department of Biochemistry and Molecular Biology, The
University of Chicago; and The Heart Institute for Children, Hope
Childrens Hospital, Oak Lawn, IL.
 |
Abstract |
Hypoxia is a strong stimulus for the transcription of a set of
genes, including erythropoietin and vascular endothelial growth factor.
Here we report on the cloning, functional significance, and expression
of a complementary DNA (cDNA) that is involved in hypoxia-mediated
expression of these 2 genes. The full-length cDNA encodes a predicted
protein of 806 amino acids that contains a leucine zipper motif.
This protein, termed HAF for hypoxia-associated factor, binds to
a 17-base pair (bp) region of the erythropoietin promoter, which was
shown earlier to participate in hypoxia-induced expression of the
erythropoietin gene. In Hep3B cells, clones modified to express
HAF antisense RNA showed an attenuated response to
hypoxia-mediated induction of both erythropoietin and vascular endothelial growth factor transcription. HAF showed sequence-specific interaction with a DNA element in the 5' untranslated region of VEGF gene. The HAF 2.6-kilobase (kb) messenger RNA (mRNA) is
expressed in most adult tissues. The highest expression occurs in fetal liver and the least in adult liver. HAF is the murine homolog of
Sart-1, a 125-kd human protein expressed in the nuclei of normal and
malignant cells.
(Blood. 2000;96:491-497)
© 2000 by The American Society of Hematology.
| |
Introduction |
Hypoxia is known to up-regulate expression of several
genes, including erythropoietin (EPO), tyrosine hydroxylase,
vascular endothelial growth factor (VEGF), platelet-derived
growth factor B chain, phosphoglycerate kinase 1, and lactate
dehydrogenase A (for review see Bunn and Poyton1). The
physiologic importance of hypoxia-induced regulation of EPO and
VEGF genes has been established in red blood cell formation and
angiogenesis.1,2
EPO is primarily produced by fetal liver3 and adult
kidneys4 and, to some extent, by brain cells5
and hemopoietic progenitor cells.6 Hypoxia-induced
expression of EPO is regulated by both the rate of gene
transcription and posttranscriptional events.7
Transcriptional regulation is achieved by the concerted action of
several transacting factors interacting with the proximal promoter
region and with the 3' untranslated region of the EPO gene.8-12 In the 3' untranslated region of the
EPO gene, there is a 50-bp hypoxia-responsive-enhancer (HRE)
element located approximately 120 bp 3' of the polyadenylation
site. This enhancer element is functionally tripartite. One site binds
the hypoxia-inducible factor (HIF-1).13 The second is
required for transactivation of the EPO gene mediated by HIF-1,
but factors interacting with site 2 have not yet been described. The
third is a binding site for the orphan receptors, hepatocyte nuclear
factor 4 (HNF-4), and EAR3/COUP-TF-1; HNF-4 may act as a positive
regulator and EAR3/COUP-TF-1 may play an antagonistic role in
hypoxia-induced expression of the EPO gene.14 The
role of the p300/CREB binding proteins was also described
recently.15 HIF-1 has also been shown to be involved in the
activation of VEGF gene transcription through its interaction
with a 47-bp sequence located at nucleotides 985 to 939 5' of the
transcription start site.16
Several nuclear factors that recognize a sequence in the EPO
promoter have been shown to function synergistically with those interacting with the 3' enhancer.12 We have earlier
defined the role of the  61 to 45-bp sequence EP17 in
hypoxia-inducible expression; the transcription start site of the
murine EPO gene is numbered zero. Factors interacting with EP17
synergize with those binding to the 3' enhancer for the maximal
transcriptional response to hypoxia.17 In this paper we
report the cloning and partial characterization of a factor that
interacts with the EP17 sequence of the EPO promoter and
the 5' UTR of the VEGF gene. This factor acts in the
regulation of hypoxia-induced expression of genes.
| |
Materials and methods |
Cell culture murine
NN10 cells18 were grown in Dulbecco's modified Eagle's
medium (DMEM) low glucose (Sigma, St Louis, MO), supplemented with 5%
fetal calf serum (FCS) (HyClone, Logan, UT), sodium bicarbonate (44 mmol/L), and gentamicin (40 mg/L). The human hepatoma cells Hep3B
(ATCC, HB8064) were grown in minimum essential medium alpha (Sigma)
supplemented with 10% FCS, sodium bicarbonate (26 mmol/L), and
gentamicin (40 mg/L); incubated in an atmosphere of 5%
CO2, 95% air, and passed every 3 to 4 days
after trypsinization of the confluent cell layer. These cultures were
grown at 37°C.
Preparation of a complementary DNA library
Total RNA was prepared from NN10 cells.19
PolyA+ RNA was isolated by 2 rounds of affinity
chromatography on oligo(dT)-cellulose20 (Life
Technologies, Grand Island, NY). Complementary DNAs (cDNAs) were
synthesized using a random primer and Maloney murine leukemia reverse
transcriptase as per the manufacturer's instruction (Stratagene, La
Jolla, CA). After second strand synthesis with DNA polymerase 1 and
RNase H, the double-stranded cDNA was size fractionated on Sephacryl
S-400 columns (Pharmacia, Piscataway, NJ), and ligated to EcoR1
adapters. After digestion with EcoR1 (Boehringer Mannheim, Indianapolis, IN), the cDNA was ligated to the dephosphorylated EcoR1 digested arms of the  gt11 vector and packaged using
Giga pack II-gold packaging extract (Stratagene). The titer of the primary library was 1 to 2 × 106 pfu/µg of
gt11 DNA. The library was amplified to a titer of 2 × 109 pfu/µL.
Expression screening of the NN10 library
Screening of the library was performed as described by Singh et
al.21 Briefly, after infection of Y1090 Escherichia
coli cells (Stratagene), aliquots of the amplified cDNA library
were plated in NZYM broth (Life Technologies), containing agarose
(0.7% wt:vol), at a density of 50 000 pfu per 150-mm plate. The
plates were incubated at 42°C for 3.5 hours until small plaques
were just visible. The agarose was then overlaid with nitrocellulose membranes (Schleicher & Schuell, Keene, NH), which had been presoaked for 30 minutes in 10 mmol/L isopropyl thiogalactose (IPTG) and then air
dried. Incubation was continued at 37°C for 3.5 hours after which
the orientation of the filter on the plate was marked. The membranes
were placed in blocking solution (5% nonfat dried milk, 50 mmol/L
TrisHCl pH 7.5, 50 mmol/L NaCl, 1 mmol/L EDTA, and 1 mmol/L
dithiothreitol (DTT)) at 4°C overnight. A duplicate membrane was
prepared by incubation of the plate for 4 hours at 37°C. The probe
used for screening the library was a 3 × tandem repeat of the
EP17 sequence 5'CCCCCACCCCCACCCGC3', generated as a
complementary synthetic oligonucleotide (3EP17), with a BamH1 restriction site at the 5' end and an EcoR1 site at the
3' end. After gel purification and annealing, the double-stranded
oligonucleotide was digested with EcoR1 and BamH1, and
cloned into pBluescript SKII (Stratagene). The fragment of the
resulting plasmid was end-labeled by first digesting the plasmid DNA
with EcoR1 and filling in the ends using the Klenow fragment of
DNA polymerase-1 and  -32P dCTP (110 TBq/mmol [3000
Ci/mmol/L]) (Amersham, Arlington Heights, IL). After
labeling, the fragment was released from the vector by digesting with
BamH1 and gel purified on a 10% polyacrylamide gel.
Hybridization of the membranes with the labeled probe was carried out
for 3 hours at 25°C in 10 mmol/L TrisHCl pH 7.5, 50 mmol/L NaCl, 1 mmol/L EDTA, and 1 mmol/L DTT containing 2 × 106
cpm/mL of labeled probe. Membranes were washed at 25°C for 30 minutes in the same buffer without the probe. Signal was detected by
autoradiography on Kodak XAR-5 film (Eastman Kodak,
Rochester, NY). The plaques showing signals in duplicate filters were
cored, the phage DNA eluted in SM buffer (100 mmol/L NaCl, 8 mmol/L
MgSO4, 50 mmol/L TrisHCl pH 7.5, 0.01% gelatin) and
rescreened on duplicate membranes. After 3 additional rounds of
screening, the DNA from purified phage was prepared.22 The
cloned fragment was released after EcoR1 digestion and was
subcloned at the EcoR1 site of pBluescript. Additional clones
were obtained by screening the library with radiolabeled fragments
representing 5' and 3' regions of the cloned DNA. The
entire DNA was sequenced in both directions by using the dideoxy
sequencing method and by automated polymerase chain reaction (PCR)
sequencing at The University of Chicago sequencing facility using
either T7, T3, or gene specific primers. We designate the product of
this cloned gene as HAF, for hypoxiaassociated factor.
Bacterial expression of proteins
A crude extract of the recombinant phage-encoded protein was
prepared after infection of Y 1089 E coli (Stratagene),
isolation of the temperature-sensitive lysogenized colonies, and
induction of protein expression with 10 mmol/L IPTG.23 The
crude extract was analyzed for EP17 DNA binding activity using the
mobility shift assay as described below.
For expression of recombinant protein as the glutathione-s-transferase
(GST) fusion protein, 1.2-kilobase (kb) of HAF cDNA sequences (nucleotide [nt] 1-1200) were cloned in frame with the glutathione binding domain of Schistosoma japonicum GST in the pGEX-2T bacterial expression vector (Pharmacia). The orientation of HAF
cDNA was confirmed by Pst1 digestion. The E coli strain BL-21 (DE3)pLysS was transformed with parental pGEX-2T or with the HAF
pGEX-2T vector containing the 390 N-terminal amino acids of HAF fused
in frame with GST. Bacteria were grown in 50 mL of Luria-Bertani (LB)
medium (Life Technologies), supplemented with 100 µg of ampicillin
per milliliter, for 12 hours at 30°C. The cultures were then
diluted 10-fold in LB containing ampicillin and grown for 1 hour to an
absorbance of 0.8 at 600 nm before induction with 0.1 mmol/L IPTG for 6 hours at 20°C. IPTG-induced bacteria were pelleted and washed with
10 mL of ice-cold phosphate-buffered saline with 20 mmol/L
MgCl2 (PBSM) containing 100 µg each of aprotinin, leupeptin, and pepstatin, and 0.1 mmol/L PMSF. The pellet was resuspended in the above buffer and cellular proteins were extracted by
sonication (a total of 6 bursts of 30 seconds each) at 4°C and
incubation with 1% Triton X-100 (Eastman Kodak, Rochester, NY).
Cellular debris was removed by centrifugation. Purification of the GST
fusion protein by affinity chromatography on glutathione agarose beads
was performed as follows; the bacterial lysate (300 mL) was incubated
with 2.0 mL of a 50% (vol/vol) slurry of glutathione-Sepharose (Sigma)
in PBSM at 4°C for 1 hour. After centrifugation, the Sepharose was
thoroughly washed with PBSM plus 0.1% Triton X-100, and eluted with
100 mmol/L glutathione in 500 mmol/L TrisHCl pH 8.0, 10 mmol/L DTT, and
50 mmol/L MgCl2, for 20 minutes at 4°C.
Electrophoretic mobility shift assays
DNA binding activity of the crude lysate expressing the recombinant
protein (5 µg), and of purified GST-HAF fusion protein (5-20 µg)
were analyzed by mobility shift assays as described previously.8,25 Binding reactions with purified GST-HAF (10 µg) contained 2 µg of bovine serum albumin (BSA) (Sigma) as carrier and 0.1 to 0.5 µg of double-stranded poly (dI-dC). The probes used
were double-stranded oligonucleotides corresponding to EP17 and to the
+504 to +533-bp region of the VEGF gene (AGACACCGCCCCCAGCCCCAGCGCCCACCTC).
For the supershift assay, antibody against HAF was raised in rabbits
using a synthetic peptide at positions 30 to 44, (H2N-PRHREHKKHKHRSSG-COOH). The peptide was synthesized and
immunization was performed at Primm Laboratories (Cambridge, MA). The
specificity of the antibody was tested by Western blotting where Hep3B
lysate proteins (200 µg) and protein markers (high-molecular-weight
rainbow marker, Amersham) were resolved by 10% SDS PAGE and
electrotransferred to a Protran-nitrocellulose membrane (Schleicher & Schuell, Keene, NH). After blocking and washing, the membrane was
incubated with HAF antibody (1:1000), followed by washing and
incubation with secondary anti rabbit antibody (1:6000). The signal was
generated by Supersignal Substrate Western Blotting Kit
(Pierce, Rockford, IL) and detected by autoradiography.
Nuclear extracts from the same cells were prepared and binding
reactions were carried out with 5 µg of nuclear proteins in the
presence of 1, 5, and 10 µL of immune or 10 µL of preimmune sera
and 0.5 µg of double-stranded poly (dI-dC) as a nonspecific
competitor. After 5 minutes of incubation, labeled EP17 was added and
incubated an additional 15 minutes at 25°C before electrophoresis.
Production of clones stably expressing hypoxia-associated factor
antisense RNA
The plasmid pCB6+HAF AS was generated by cloning the
700-bp 5' region of HAF cDNA in the reverse orientation into the
pCB6+ vector (a gift from Dr V. Sukhatme, Harvard Medical
School, Boston, MA). The expression of the cloned cDNA was under the
control of the cytomegalovirus (CMV) promoter. The vector
also contained a neo-resistance gene. Plasmid DNA (pCB6+
and pCB6+HAF AS, 20 µg each) were transfected into
106 Hep3B cells by the calcium-phosphate precipitation
method.26 Twenty-four hours after transfection the medium
was changed. Selection for stably transfected cells was made after 48 hours by replacing the medium with DMEM containing G418 (Life
Technologies) at 0.5, 1, and 2.5 mg/mL. These concentrations are toxic
to wild-type Hep3B cells. The selection in G418 continued for 3 weeks
with a change of medium twice per week. Neo-resistant clones were
isolated by partial trypsinization of the attached cells with 1 mL of
0.06% trypsin in Hanks balanced salt solution, supplemented with 11.6 mmol/L NaCl and 0.5 mmol/L EDTA, colonies were picked into 24-well plates in DMEM containing G418 at the same 3 concentrations.
Twenty-four different clones were trypsinized, expanded into
25-cm2 flasks, grown to confluency for a period of 2 to 8 weeks, and maintained in G418 to prevent back mutations.
Expression of transfected HAF antisense RNA was confirmed by Northern
blot analysis. Cells transfected with the pCB6+ vector
alone and selected for neo resistance served as controls. Cells
expressing antisense RNA and controls were exposed to 2% O2, 5% CO2, and 93% air for 48 hours. Total
RNA was isolated, size fractionated on 1.2% formaldehyde agarose gels,
and hybridized with either radiolabeled 642-bp monkey EPO cDNA
or radiolabeled 400-bp human VEGF cDNA (3' untranslated
region, kindly provided by Dr C. Simon, The University of Chicago, IL).
Northern blot analysis
For study of HAF tissue distribution, liver, kidneys, brain, heart,
spleen, and intestines were harvested from 20-g adult B6D2F1/J mice.
The organs were quick frozen and powdered in liquid nitrogen. The
tissue powder was homogenized in buffer (4 mol/L guanidinium
isothiocyanate, 25 mmol/L sodium citrate pH 7.0, 0.1 mol/L
 -merceptoethanol), and RNA was purified on a CsCl
cushion.20
The study of HAF expression used kidneys and livers harvested from
specified ages of fetuses and at different intervals after birth.
Tissue samples for each data point (n = 6 to 10) were pooled and
processed for RNA extraction as described above. Northern blot analysis
of 20 µg of total RNA was as previously described. After
prehybridization in a buffer containing 1 mol/L NaCl, 50% formamide,
10% dextran sulfate, and 1% sodium dodecyl sulfate at 42°C for 2 hours, the membrane was incubated overnight at 42°C in the same
buffer with 1 × 106 cpm/mL of labeled HAF cDNA (nt
1-700) that was random primed using the Klenow fragment of DNA
polymerase 1 and  -32P dCTP (specific activity 110 TBq/mmol [3000 Ci/mmol]) (Amersham). After final washing
under stringent conditions (0.2XSSC, 0.1% SDS, 65°C for 30 minutes), the signal was detected by autoradiography.
| |
Results |
Cloning of HAF and its interaction with the EPO promoter
The messenger RNA (mRNA) of the murine erythroleukemic cell line
NN10 was used as a source for constructing the cDNA expression library
because those cells constitutively express EPO at high levels,18 and because NN10 nuclei contain factors that
interact with EP17. Initially 1 × 106 plaques were
screened with radiolabeled 3EP17. Of 5 clones obtained by 3 rounds of
screening, 2 showed overlapping sequences that were tested for specific
binding to EP17. These 2 clones were plated at 100 pfu per plate and
lifted onto IPTG-saturated filters. Each filter was cut in half and
each half screened with 32P-3EP17 in the presence of a
150-fold molar excess of either unlabeled wild-type EP17 or an
unlabeled mutant EP17, where A at positions 6 and 12 was replaced by G. In our earlier study, this mutant did not compete with EP17 for the
nuclear binding factor.17 For both clones, cold EP17
effectively competed for probe binding, whereas mutant EP17 did not
(data not shown). The specificity of these clones for EP17 was
confirmed further by performing a mobility shift assay using a crude
extract prepared from a lysate of Y1089 E coli after infection
with recombinant phage and lysis by expressing its
temperature-sensitive phage repressor. The gel shift data (Figure
1A) show specific complex formation with
radiolabeled EP17 that was competed by EP31 (nucleotides 61 to
31) but not by EP22 (91 to 69) of the EPO
gene.
View larger version (77K):
[in this window]
[in a new window]
| Fig 1.
Gel-shift assay with HAF protein.
The probe used was the region 45 to 61 bp (EP17) of the epo
promoter. (A) Gel-shift assay using a crude extract from HAF
recombinant lysogen. The crude extract (CE) (5 µg) was incubated with
radiolabel led EP17 alone (lane 1), or in the presence of a 500-fold
molar excess of the specific competitor EP31 (lane 2) or nonspecific
competitor EP22 (lane 3). (B) Gel-shift assay with HAF GST-fusion
protein. Increasing amounts (5, 10, and 20 µg) of GST protein (lanes
2-4) or HAF GST-fusion protein (lanes 5-10) were incubated with 100 ng
of poly dI-dC (lanes 5-7), or 500 ng of poly dI-dC (lanes 2-4 and
8-10). Lanes 11 and 12 represent binding reactions with 10 µg of
GST-fusion protein in the presence of 100- and 500-fold molar excess of
the specific competitor EP31. Lane 1 represents the binding reaction
with no protein. Each of these reactions was carried out in the
presence of 2 µg of BSA as carrier protein. The arrow indicates the
shifted complex. F is free probe.
|
|
The DNA binding ability of the encoded HAF protein, outside the
galactosidase domain, was confirmed by gel shift assay with GST-HAF fusion protein containing GST and the 390 amino terminal sequence of HAF and radiolabeled EP17. The data show interaction of the GST-HAF fusion protein with labeled EP17, in a sequence specific manner (Figure 1B). GST alone (Figure 1B) or a GST fusion protein encoded by HAF in reverse orientation did not show any interaction with EP17 (data not shown). These data clearly show that
HAF binds to EP17 in a sequence-specific manner.
The complete nucleotide sequence of murine HAF cDNA derived
from several overlapping clones contains an open reading frame encoding
806 amino acids. The first ATG codon encoding the putative start
methionine shows favorable context for translational initiation based
on the Kozak consensus criteria.27,28 The sequence of HAF
cDNA was submitted to GenBank under the accession number AF129931. A
search of the GenBank database revealed that the nucleotide sequence
encoding HAF cDNA is homologous (94% identity/96% similarity) to the
cDNA sequence of Sart-1 (accession number AB006198) isolated from a
human squamous cell carcinoma.29 In comparison to
Sart-1, the HAF protein has an insertion of 6 amino acids from position
454 to position 459. In addition, HAF cDNA shows 31% identity and 47%
similarity with the Caenorhabditis elegans
chromosome III locus CELF19F10 (accession number U97005).
Analysis of the full length HAF protein using Prosite
software (Swiss Institute of Bioinformatics, Geneva,
Switzerland) identified several possible sites for posttranslational
modification, including N-glycosylation, protein kinase A, casein II
kinase, protein kinase C, tyrosine kinase, and amidation.
Further computer analysis of the encoded protein revealed the presence
of a leucine zipper motif (amino acids 365-386), comprising 4 leucines
each separated by 6 residues. Immediately adjacent to this domain, the
HAF protein has several clusters of basic amino acids, which probably
can serve as DNA binding domains. Additional analysis of the possible
secondary structure of the putative HAF protein revealed that it may be
about 58% alpha helix. No stretches of hydrophobic amino acids,
consistent with the presence of a transmembrane domain, are present.
Supershift of nuclear protein-EP17 complex with
antihypoxia-associated factor
The antibody raised to the N-terminal region of HAF recognizes
endogenous HAF with 2 possible degradation products of approximate molecular weight of 105 and 25 kd, which together may represent approximately the 130 kd endogenous HAF. No cross-reactivity with other
cellular proteins was observed (Figure 2A).
A supershift assay using this antibody confirms the role of endogenous
HAF in binding to EP17. Nuclear proteins from Hep3B cells bound to labeled EP17, as indicated by S in Figure 2B. When HAF antiserum was
included in the binding reaction, we found 2 additional complexes, in
addition to the S complex, 1 nonspecific (NS) and 1 supershift (SS).
With increased concentration of HAF antiserum, the amount of the SS
complex increased, the S decreased, and the NS complex remained
unaffected. When nuclear proteins were incubated with preimmune serum
in place of HAF immune serum, a nonspecific complex with mobility
similar to that of NS was formed. Preimmune serum had no
effect on the formation of the specific complex and did not produce SS.
In the binding reaction, when labeled EP17 was incubated alone with
the immune or preimmune serum in the absence of nuclear
factors, it produced a complex with identical mobility to NS
but no SS or S complexes were formed (Figure 2B). These data
demonstrate that an antibody raised against HAF recognized the nuclear
proteins of Hep3B cells that bind to the EP17 probe. The NS band
is generated by nonspecific interaction of the probe with serum
proteins.
View larger version (49K):
[in this window]
[in a new window]
| Fig 2.
Super-shift assay with HAF antibody and Hep3B nuclear
extract.
(A) Western blot showing the specificity of HAF antibody utilized in
the supershift assay. Arrows indicate the two proteins discussed in
the text. (B) Increasing amounts (1, 5, and 10 µL) of anti-HAF serum
were incubated with Hep3B nuclear proteins (5 µg) in the presence
of the EP17 probe (lanes 2-4). Lane 1 is a control reaction with
nuclear proteins alone. Control reactions with preimmune serum in
the presence (lane 5) or absence (lane 6) of nuclear extract. Imm.
Serum and P.I. Serum refers to immune and preimmune serum respectively,
N.E. refers to nuclear extract. S, NS, and SS represent specific,
nonspecific, and super-shifted complexes, respectively.
|
|
Role of hypoxia-associated factor in hypoxia-induced gene
expression
We used an antisense strategy to determine the functional
role of HAF in hypoxia-induced expression of the EPO gene.
HEP3B cells were transfected with the plasmid expressing the first
700-bp of HAF antisense RNA driven by the CMV promoter. Cells
transfected with the vector alone served as controls. After G418
selection, expression of HAF antisense RNA was confirmed by Northern
blot analysis. Of 10 clones analyzed, 4 (clones 2, 4, 5, and
6) showed a positive signal for partial HAF antisense RNA (0.7 kilobase [kb]) along with the full-length endogeneous HAF mRNA
(Figure 3A). To examine the effect of HAF
antisense RNA on hypoxia-induced expression of the EPO gene,
clones 4 and 5, along with a control (clone 8) were analyzed further.
Each of these clones was grown in duplicate, overnight, at 5%
CO2, and 95% air. One set of plates was transferred to 2%
oxygen, 5% CO2, and 93% N2 for 48 hours. The
other set of plates was incubated in 5% CO2 and 95% air
for 48 hours. Total RNA was analyzed for EPO message.
Quantitation of EPO mRNA normalized to -actin mRNA in
response to hypoxia showed 73 ± 10-fold induction of EPO
mRNA in the control clone (no 8). There were 3 separate determinations
each with a pool of 5 plates. In contrast, induction of EPO
mRNA in clones 4 and 5, containing HAF antisense was only
27 ± 8-fold and 19 ± 11-fold. Again, each was the result of
3 separate experiments with a pool of 5 plates. A representative
radiogram is shown in Figure 3B. Wild-type Hep3B cells showed a
81 ± 14-fold induction in EPO mRNA in response to
hypoxia.
View larger version (54K):
[in this window]
[in a new window]
| Fig 3.
Functional role of HAF in hypoxia-induced expression of
the epo gene.
(A) Northern analysis of Hep3B clones expressing HAF-antisense RNA.
Individual clones (1-8) stably transfected with either HAF cDNA in
reverse orientation (lanes 1-7) or the vector alone (lane 8); lanes 9 and 10 represent controls with non-transfected Hep3B cells and NN10
cells. Total RNA was isolated, size fractionated and hybridized with
the HAF cDNA probe. The thin arrow indicates the 2.6-kb HAF transcript.
The thick arrow indicates the presence of the 0.7-kb HAF antisense-RNA
in clones 2, 4, 5, and 6 but not in wild-type (clone 9) or clones
transfected with vector alone (8). The bottom panel shows -actin
mRNA. (B) Effect of HAF-antisense-RNA on hypoxic induction of epo mRNA.
Two clones (4 and 5 of panel A) expressing HAF antisense RNA (lanes
3-6), and a control clone (8 of panel A) (lanes 1 and 2) transfected
with vector alone were exposed to hypoxia (2% O2) for 48 hours (lanes 2, 4, and 6), or under normal oxygenation (lanes 1, 3, and
5). The probe used was a monkey epo cDNA. The arrow indicates 1.4-kb
epo mRNA. (C) Effect of HAF antisense RNA on hypoxia induced expression
of VEGF mRNA. The membrane in panel B was stripped of the epo probe and
hybridized to human VEGF cDNA. Arrows indicate different transcripts of
VEGF. (D) The same membrane was stripped and rehybridized with mouse
-actin cDNA to control for loading differences.
|
|
When the same membranes were stripped of the EPO probe and
hybridized with a VEGF cDNA probe, we found a reduced induction of VEGF mRNA in the antisense clones, compared with the control clone after hypoxic exposure. Quantitation of the major transcript of
VEGF mRNA (normalized for -actin mRNA) showed a
51 ± 10-fold increase in VEGF mRNA in the control clone
(no 8) in response to hypoxia, whereas antisense clones 4 and 5 showed
only a 30 ± 12-fold and a 21 ± 14-fold induction,
respectively, each representing the mean of 3 separate experiments
with a pool of 5 plates. A representative radiogram is shown in Figure
3C. Additional evidence for the role of HAF in VEGF gene
expression comes from a gel shift experiment in which we show that the
GST-HAF fusion protein interacts with a probe (VG30) consisting of
bases +504 to +533 of the VEGF 5'UTR. The VEGF
sequence also competes with EP17 for HAF binding (Figure
4A). To examine whether the VG30 sequence
recognizes native proteins in Hep3B nuclear extract and how the
mobility of the native proteins compares with that of recombinant
protein, an additional gel shift was conducted using VG30 as a probe.
Data presented in Figure 4B show that VG30 interacts with Hep3B nuclear factors in a sequence specific manner with 2 shifted complexes. The
mobility of the higher shifted complex corresponds to the mobility of
the complex obtained with HAF recombinant protein. Thus, collectively
our data indicate that (a) HAF interacts with the regulatory regions of
the EPO and VEGF genes, (b) a 30-bp sequence of the
VEGF gene in the 5'UTR interacts with nuclear factors of
Hep3B cells, and (c) expression of antisense HAF mRNA attenuates the
hypoxia-induced expression of EPO and VEGF mRNA.
View larger version (44K):
[in this window]
[in a new window]
| Fig 4.
Gel shift assay with VEGF UTR binding to HAF protein and
nuclear proteins of Hep3B cells.
(A) Lane 1, probe alone (30 mer); lane 2, GST-HAF + probe; lanes 3, 4, self competition at 100 and 500 molar excess; lanes 5, 6, lack of
competition with EP22 at 100 and 500 molar excess; lanes 7, 8, competition with EP17 at 100 and 500 molar excess; lane 9, GST only.
(B) Lane 1, probe alone (30 mer); lane 2, 3, nuclear proteins (5 and 10 µg) + probe; lanes 4, self-competition at 100 fold molar excess using
10 µg nuclear proteins; lanes 5, 6, GST-HAF (2 and 5 µg) + probe. The bottom of the gel contains the VEGF 30 mer probe
(VG30). The arrows indicate the specific complex.
|
|
Tissue distribution and development-stage-specific
expression of hypoxia-associated factor messenger RNA
The expression of HAF was studied by Northern blot analysis of total
RNA isolated from adult mouse liver, kidney, brain, heart, skeletal
muscle, and spleen. RNA from NN10 cells was used as a positive control.
A major transcript of about 2.6 kb was detected in those adult tissues
studied, with minimal expression in liver (Figure
5A).
View larger version (70K):
[in this window]
[in a new window]
| Fig 5.
Northern analysis of HAF expression in different tissues
and at different development stages in liver and kidney.
The probe used was 700 bp (nt 1-700) of HAF cDNA. Total RNA from NN10
cells was used as a positive control. (A) A 2.6-kb single transcript
was identified in all the tissues indicated above each lane with the
exception of the liver. The bottom panel shows ethidium bromide stained
28 S rRNA. (B) Expression of HAF in liver at indicated development
ages. The bottom panel shows ethidium bromide stained 28 S RNA. (C)
Quantitative analysis of panel B using densitometer scanning. Scanner
units were normalized for 28 S RNA. (D) Expression of HAF in kidneys at
different development stages. The arrow indicates 2.6-kb HAF mRNA in
upper panel and 28 S rRNA in bottom panel.
|
|
Because EPO production occurs in fetal liver3 and
switches to adult kidney,4 we analyzed HAF mRNA expression
in liver and kidney from 12- and 16-day mouse fetuses and from mice at 1, 8, 15, 22, 29, and 36 days after birth. Twelve-day fetal liver had
considerably higher HAF expression than did 16-day fetal liver. Hepatic
expression decreased gradually and it was barely detectable at 36 days
after birth (Figure 5B and C). Expression in kidneys was relatively
constant over all the times studied (Figure 5D).
| |
Discussion |
In this report we describe the cloning of a cDNA encoding a protein
(HAF) that shows sequence-specific interaction with a 17-bp sequence
(EP17) in the proximal promoter region of the EPO gene and
modulates expression of EPO and VEGF mRNA in
response to hypoxia.
Comparison of the HAF cDNA sequence with those in the GenBank showed
that HAF is a murine homolog of human Sart-1 cDNA. Sart-1 cDNA was
cloned as an antigenic peptide recognized by cytotoxic T lymphocytes
and was reported while this study was in progress.29 Sart-1
mRNA is suggested to encode 2 proteins, one 43 kd and the other 125 kd.
The 43-kd protein is cytosolic, whereas 125-kd protein (HAF homolog) is
nuclear. It was also suggested that the 43-kd but not the 125-kd
protein may be the major protein recognized by cytotoxic T lymphocytes.
HAF mRNA was detected in all murine tissues studied with the lowest
expression in adult liver. The highest level was found in fetal liver
at day 12; it declined with time and almost none was detected at 36 days past birth.
In rodents, the liver is the major site of EPO synthesis during
fetal life,3 whereas the kidney is the major source late in
gestation and after birth.4 Mechanisms behind this switch or those involved in suppression of EPO production by liver are poorly understood. Earlier, experiments with transgenic mice carrying EPO-LacZ constructs identified a silencer sequence in the
1.2-kb 3'-flanking region of the EPO gene. The silencer
element showed interaction with different sets of nuclear factors in
fetal liver, compared with adult liver.30 The expression of
HAF mRNA in fetal but not adult liver and the switch in EPO
expression from fetal liver to adult kidney suggest that HAF may play a
role in hepatic expression, as well as a permissive role in renal expression.
Hypoxia-regulated expression of the EPO gene is
shown to involve HIF-1, HNF4, and the COUP family of transcription
factors through their interaction with the HRE in the 3'
untranslated region. Earlier, other investigators have reported a
cooperative interaction of factors binding to HRE with those binding to
the proximal promoter of the EPO gene.12 We have
reported that HRE requires the presence of EP17 to produce its maximal
effect.17 In the same study, we also showed that EP17 does
not play a role in the basal expression of the EPO gene by
Hep3B cells. HIF-1 is a well-characterized transcription factor and is
a heterodimeric complex of HIF-1 and HIF-1 that belongs to the
bHLH family of transcription factors containing a PAS
domain.31,32 HIF-1 is a 826-residue protein, whereas
HIF-1 is identical to the ARNT protein with 2 isoforms of 774 and
789 amino acids generated by alternative splicing, HIF-1 and HIF-
protein levels and their DNA-binding activities are induced by
hypoxia.31-33
Besides EPO, HIF-1 has been shown to regulate hypoxia-mediated
expression of VEGF.16 Other similarities between
the EPO and VEGF gene regulation include their
induction by CoCl2 and suppression of this induction by
carbon monoxide.34,35 The evidence presented here suggests
that HAF also plays a role in VEGF gene expression. With
computer analysis, we found in the VEGF gene a sequence
(CCCCCAGCCCCA) with close similarity to EP17. By using the numbering
used in Genbank accession number U41383, this sequence is located at
position +512 to +523 bp in the 5' untranslated region of the
VEGF gene.36 This 12-base sequence has one
difference from the 5' 12 bases of the EP17 sequence in that
the seventh base from the 5' end is a G rather than a C. The 5 bases at the 3' end do not match those in EP17. Despite these
differences, HAF interacts with the VEGF 5'UTR similar to the EP17 in EPO promoter. The importance of poly C repeats
in EP17 for nuclear factor binding was established earlier by our point
mutation analysis, where replacement of Cs by A and G was sufficient to
decrease competition for factor binding.16
In this paper, we establish that HAF, a mouse homolog of the Sart-1
125-kd protein, through its interaction with the EP17 regulatory
element of the EPO promoter region, plays a role in hypoxia-induced regulation of EPO gene expression. This is
supported by the following observations: (1) HAF protein interacts with EP17 in a sequence-specific manner, (2) anti-HAF antibody produces a
supershift in the EP17 DNA/protein complexes obtained using Hep3B
nuclear extracts, and (3) HAF antisense RNA causes a reduction in mRNA
for EPO and VEGF in response to hypoxia in Hep3B cells. The fact that HAF antisense does not completely suppress
hypoxia-induced EPO expression is not surprising in view of our
finding17 that basal EPO expression seems to not
depend on EP17 function. Thus, HAF in conjunction with other
transacting factors may modulate the hypoxia-induced expression of
EPO and VEGF genes.
| |
Footnotes |
Submitted September 15, 1999; accepted March 7, 2000.
Supported in part by grant HL30121 from the National Heart,
Lung, and Blood Institute; by a gift from Kirin-Amgen, Inc, to the
University of Chicago and, for sequencing, by the Cancer Research Center support grant P30 CA14599 from the National Cancer Institute.
HAF cDNA GenBank accession number AF129931.
Reprints: Eugene Goldwasser, Department of Biochemistry and
Molecular Biology, University of Chicago, 920 E 58th St, Chicago, IL
60637; e-mail: egoldwas{at}midway.uchicago.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Bunn HF, Poyton RO.
Oxygen sensing and molecular adaptation to hypoxia.
Physiol Rev.
1996;76:839-885[Abstract/Free Full Text].
2.
Shweiki D, Itin A, Soffer D, Keshet E.
Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis.
Nature.
1992;359:843-845[Medline]
[Order article via Infotrieve].
3.
Zanjani ED, Poster J, Burlington H, Mann LI, Wasserman LR.
Liver as the primary site of erythropoietin formation in the fetus.
J Lab Clin Med.
1977;89:640-644[Medline]
[Order article via Infotrieve].
4.
Jacobson LO, Goldwasser E, Fried W, Plzak L.
The role of the kidney in erythropoiesis.
Nature.
1957;179:633-634[Medline]
[Order article via Infotrieve].
5.
Masuda S, Okano M, Yamagishi K, Nagao M, Ueda M, Sasaki R.
A novel site of erythropoietin production: oxygen-dependent production in cultured rat astrocytes.
J Biol Chem.
1994;269:19488-19493[Abstract/Free Full Text].
6.
Stopka T, Zivny JH, Stopkova P, Prchal JF, Prchal JT.
Human hematopoietic progenitors express erythropoietin.
Blood.
1998;91:3766-3772[Abstract/Free Full Text].
7.
Goldberg MA, Gaut CC, Bunn HF.
Erythropoietin mRNA levels are governed by both the rate of gene transcription and posttranslational events.
Blood.
1991;77:271-277[Abstract/Free Full Text].
8.
Beru N, Smith D, Goldwasser E.
Evidence suggesting negative regulation of the erythropoietin gene by ribonucleoprotein.
J Biol Chem.
1990;265:14100-14104[Abstract/Free Full Text].
9.
Semenza GL, Nejfelt MK, Chi SM, Antonarakis SE.
Hypoxia-inducible nuclear factor bind to an enhancer element located 3' to the human erythropoietin gene.
Proc Natl Acad Sci U S A.
1991;88:5680-5684[Abstract/Free Full Text].
10.
Pugh CW, Tan CC, Jones RW, Ratcliffe PJ.
Functional analysis of an oxygen-regulated transcriptional enhancer lying 3' to the mouse erythropoietin gene.
Proc Natl Acad Sci U S A.
1991;88:10553-10557[Abstract/Free Full Text].
11.
Beck I, Ramirez S, Weinmann R, Caro J.
Enhancer element at the 3'-flanking region controls transcriptional response to hypoxia in the human erythropoietin gene.
J Biol Chem.
1991;266:15563-15566[Abstract/Free Full Text].
12.
Blanchard KL, Acquaviva AM, Galson DL, Bunn HF.
Hypoxic induction of the human erythropoietin gene: cooperation between the promoter and enhancer, each of which contains steroid receptor response elements.
Mol Cell Biol.
1992;12:5373-5385[Abstract/Free Full Text].
13.
Semenza GL, Wang GL.
A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation.
Mol Cell Biol.
1992;12:5447-5454[Abstract/Free Full Text].
14.
Galson DL, Tsuchiya T, Tendler DS, et al.
The orphan receptor hepatic nuclear factor 4 functions as a transcriptional activator for tissue-specific and hypoxia-specific erythropoietin gene expression and is antagonized by EAR3/COUP-TF1.
Mol Cell Biol.
1995;15:2135-2144[Abstract].
15.
Ebert BL, Bunn HF.
Regulation of transcription by hypoxia requires a multiprotein complex that includes hypoxia-inducible factor 1, an adjacent transcription factor, and p300/CREB binding protein.
Mol Cell Biol.
1998;18:4089-4096[Abstract/Free Full Text].
16.
Forsythe JA, Jiang BH, Iyer NV, et al.
Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.
Mol Cell Biol.
1996;16:4604-4613[Abstract].
17.
Gupta M, Goldwasser E.
The role of the near upstream sequence in hypoxia-induced expression of the erythropoietin gene.
Nucleic Acids Res.
1996;24:4768-4774[Abstract/Free Full Text].
18.
Choppin J, Casadevall N, Lacombe C, et al.
Production of erythropoietin by cloned malignant murine erythroid cells.
Exp Hematol.
1985;13:610-615[Medline]
[Order article via Infotrieve].
19.
Chirgwin JM, Przybyla AE, McDonald RJ, Rutter WJ.
Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease.
Biochemistry.
1979;18:5294-5299[Medline]
[Order article via Infotrieve].
20.
Aviv H, Leder P.
Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose.
Proc Natl Acad Sci U S A.
1972;69:1408-1412[Abstract/Free Full Text].
21.
Singh H, Clerc RG, LeBowitz JH.
Molecular cloning of sequence-specific DNA binding proteins using recognition site probes.
Biotechniques.
1989;7:252-261[Medline]
[Order article via Infotrieve].
22.
Crompton MR, Bartlett TJ, MacGregor AD, et al.
Identification of a novel vertebrate homeobox gene expressed in haematopoietic cells.
Nucleic Acids Res.
1992;20:5661-5667[Abstract/Free Full Text].
23.
Singh H.
Detection, purification and characterization of cDNA clones encoding DNA binding proteins. In:
Ausubel FM,Brent R,Kingston RE,et al., eds.
Current Protocols in Molecular Biology. Vol 2. [AU]NJ: Current Protocols; 1991:12.7.1-12.7.10.
24.
Gupta M, Zak R, Libermann TA, Gupta MP.
Tissue-restricted expression of the cardiac alpha-myosin heavy chain gene is controlled by a downstream repressor element containing a palindrome of two ets-binding sites.
Mol Cell Biol.
1998;18:7243-7258[Abstract/Free Full Text].
25.
Gupta MP, Gupta M, Zak R.
An E-box/M-CAT hybrid motif and cognate binding protein(s) regulate the basal muscle-specific and cAMP-inducible expression of the rat cardiac alpha-myosin heavy chain gene.
J Biol Chem.
1994;269:29677-29687[Abstract/Free Full Text].
26.
Kingston RE, Chen CA, Okayana H, Rose JK.
Transfection of DNA into eukaryotic cells eds. Ausubel FM, Brent R, Kingston RE, et al, eds. Current Protocols in Molecular Biology. Vol 2. New York, NY: John Wiley; 1996:9.1.1-9.1.11.
27.
Kozak M.
Bifunctional messenger RNAs in eukaryotes.
Cell.
1986;47:481-483[Medline]
[Order article via Infotrieve].
28.
Kozak M.
The scanning model for translation: an update.
J Cell Biol.
1989;108:229-241[Abstract/Free Full Text].
29.
Shichijo S, Nakao M, Imai Y, et al.
A gene encoding antigenic peptides of human squamous cell carcinoma recognized by cytotoxic T lymphocytes.
J Exp Med.
1998;187:277-288[Abstract/Free Full Text].
30.
Loya F, Yang Y, Lin H, Goldwasser E, Albitar M.
Transgenic mice carrying the erythropoietin gene promoter linked to lacZ express the reporter in proximal convoluted tubule cells after hypoxia.
Blood.
1994;84:1831-1836[Abstract/Free Full Text].
31.
Wang GL, Jiang BH, Rue EA, Semenza GL.
Hypoxia-inducible factor 1 is a basic helix-loop-helix-PAS heterodimer regulated by cellular O2 tension.
Proc Natl Acad Sci U S A.
1995;92:5510-5514[Abstract/Free Full Text].
32.
Jiang BH, Rue E, Wang GL, Roe R, Semenze GL.
Dimerization, DNA binding, and transactivation properties of hypoxia-inducible factor 1.
J Biol Chem.
1996;271:17771-17778[Abstract/Free Full Text].
33.
Wang GL, Jiang BH, Semenza GL.
Effect of altered redox states on expression and DNA-binding activity of hypoxia-inducible factor 1.
Biochem Biophys Res Comm.
1995;212:550-556[Medline]
[Order article via Infotrieve].
34.
Goldberg MA, Schneider TJ.
Similarities between the oxygen-sensing mechanisms regulating the expression of vascular endothelial growth factor and erythropoietin.
J Biol Chem.
1994;269:4355-4359[Abstract/Free Full Text].
35.
Liu Y, Christou H, Morita T, Laughner E, Semenza GL, Kourembanas S.
Carbon monoxide and nitric acid suppress the hypoxic induction of vascular endothelial growth factor gene via the 5' enhancer.
J Biol Chem.
1998;273:15257-15262[Abstract/Free Full Text].
36.
Shima DT, Kuroki M, Deutsch U, Ng YS, Adamis AP, D'Amore PA.
The mouse gene for vascular endothelial growth factor: genomic structure, definition of the transcriptional unit, and characterization of transcriptional and post- transcriptional regulatory sequences.
J Biol Chem.
1996;271:3877-3883[Abstract/Free Full Text].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
M. Y. Koh, B. G. Darnay, and G. Powis
Hypoxia-Associated Factor, a Novel E3-Ubiquitin Ligase, Binds and Ubiquitinates Hypoxia-Inducible Factor 1{alpha}, Leading to Its Oxygen-Independent Degradation
Mol. Cell. Biol.,
December 1, 2008;
28(23):
7081 - 7095.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Shen, H. Su, Y. Fan, Y. Chen, Y. Zhu, W. Liu, W. L. Young, and G.-Y. Yang
Adeno-Associated Viral Vector-Mediated Hypoxia-Inducible Vascular Endothelial Growth Factor Gene Expression Attenuates Ischemic Brain Injury After Focal Cerebral Ischemia in Mice
Stroke,
October 1, 2006;
37(10):
2601 - 2606.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Dame, K. M. Kirschner, K. V. Bartz, T. Wallach, C. S. Hussels, and H. Scholz
Wilms tumor suppressor, Wt1, is a transcriptional activator of the erythropoietin gene
Blood,
June 1, 2006;
107(11):
4282 - 4290.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Fandrey
Oxygen-dependent and tissue-specific regulation of erythropoietin gene expression
Am J Physiol Regulatory Integrative Comp Physiol,
June 1, 2004;
286(6):
R977 - R988.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Aerbajinai, Y. T. Lee, U. Wojda, V. A. Barr, and J. L. Miller
Cloning and Characterization of a Gene Expressed during Terminal Differentiation That Encodes a Novel Inhibitor of Growth
J. Biol. Chem.,
January 16, 2004;
279(3):
1916 - 1921.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Bergqvist and G. Lowe
Venous Thromboembolism in Patients Undergoing Laparoscopic and Arthroscopic Surgery and in Leg Casts
Arch Intern Med,
October 28, 2002;
162(19):
2173 - 2176.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A. Heit
The Potential Role of Fondaparinux as Venous Thromboembolism Prophylaxis After Total Hip or Knee Replacement or Hip Fracture Surgery
Arch Intern Med,
September 9, 2002;
162(16):
1806 - 1808.
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Su, J. Arakawa-Hoyt, and Y. W. Kan
Adeno-associated viral vector-mediated hypoxia response element-regulated gene expression in mouse ischemic heart model
PNAS,
July 9, 2002;
99(14):
9480 - 9485.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Strebel, M. Prins, G. Agnelli, and H. R. Buller
Preoperative or Postoperative Start of Prophylaxis for Venous Thromboembolism With Low-Molecular-Weight Heparin in Elective Hip Surgery?
Arch Intern Med,
July 8, 2002;
162(13):
1451 - 1456.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. D. Douketis, J. W. Eikelboom, D. J. Quinlan, A. R. Willan, and M. A. Crowther
Short-Duration Prophylaxis Against Venous Thromboembolism After Total Hip or Knee Replacement: A Meta-analysis of Prospective Studies Investigating Symptomatic Outcomes
Arch Intern Med,
July 8, 2002;
162(13):
1465 - 1471.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. D. Hull, G. F. Pineo, P. D. Stein, A. F. Mah, S. M. MacIsaac, O. E. Dahl, W. A. Ghali, M. S. Butcher, R. F. Brant, D. Bergqvist, et al.
Timing of Initial Administration of Low-Molecular-Weight Heparin Prophylaxis Against Deep Vein Thrombosis in Patients Following Elective Hip Arthroplasty: A Systematic Review
Arch Intern Med,
September 10, 2001;
161(16):
1952 - 1960.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. V. Bhagwat, J. Lahdenranta, R. Giordano, W. Arap, R. Pasqualini, and L. H. Shapiro
CD13/APN is activated by angiogenic signals and is essential for capillary tube formation
Blood,
February 1, 2001;
97(3):
652 - 659.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction