| |
|
|
|
|
|
|
|||
|
Blood, Vol. 96 No. 2 (July 15), 2000:
pp. 560-568
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Division of Molecular and Genetic Medicine, Royal
Hallamshire Hospital, University of Sheffield, UK; the Medical School
of Gazi University, Ankara, Turkey; and the University Hospital of
Skejby, Aarhus, Denmark.
In this report we describe the molecular defect underlying partial
and severe quantitative von Willebrand factor (VWF) deficiencies in 3 families previously diagnosed with types 1 and 3 Von
Willebrand-disease. Analysis of the VWF gene in affected family members
revealed a novel C to T transition at nucleotide 1067 of the VWF
complemetary DNA (cDNA), predicting substitution of arginine by
tryptophan at amino acid position 273 (R273W) of pre-pro-VWF. Two
patients, homozygous for the R273W mutation, had a partial VWF
deficiency (VWF:Ag levels of 0.06 IU/mL and 0.09 IU/mL) and lacked
high-molecular weight VWF multimers in plasma. A third patient, also
homozygous for the R273W mutation, had a severe VWF deficiency (VWF:Ag
level of less than 0.01 IU/mL) and undetectable VWF multimers in
plasma. Recombinant VWF having the R273W mutation was expressed in
COS-7 cells. Pulse-chase experiments showed that secretion of rVWFR273W was severely impaired compared with wild-type rVWF. However, the mutation did not affect the ability of VWF to form dimers in the endoplasmic reticulum (ER). Multimer analysis showed that rVWFR273W failed to form high-molecular-weight multimers present in wild-type rVWF. We concluded that the R273W mutation is responsible for the
quantitative VWF deficiencies and aberrant multimer patterns observed
in the affected family members. To identify factors that may function
in the intracellular retention of rVWFR273W, we investigated the
interactions of VWF expressed in COS-7 cells with molecular chaperones
of the ER. The R273W mutation did not affect the ability of VWF to bind
to BiP, Grp94, ERp72, calnexin, and calreticulin in COS-7 cells.
(Blood. 2000;96:560-568)
Von Willebrand factor (VWF) is a multimeric plasma
glycoprotein with 2 essential roles in hemostasis. It acts as a carrier for factor VIII and mediates platelet adhesion to the subendothelium at
sites of vascular damage.1 Mutations in the VWF gene,
resulting in quantitative deficiencies or qualitative abnormalities of
VWF, cause von Willebrand disease (VWD), which is the most common
inherited bleeding disorder in humans. Current classification of VWD
recognizes 3 types.2 Type 1 VWD is characterized by partial
quantitative deficiency of VWF. It is generally inherited in an
autosomal dominant manner and accounts for up to 70% of the cases.
Type 3 VWD is characterized by a complete deficiency of VWF and is
generally inherited in an autosomal recessive manner.1,2
Type 2 VWD refers to qualitative deficiency of VWF and is subdivided
into types 2A, 2B, 2M, and 2N.2 Types 2A and 2M variants
show decreased platelet binding. In type 2A VWD, but not type 2M VWD,
this is associated with an absence of high-molecular-weight multimers. Type 2B variants have an increased affinity for platelet glycoprotein Ib. Type 2N VWD refers to variants having a decreased affinity for
factor VIII.2
The 178-kilobase (kb) gene encoding VWF has been localized to
chromosome 12 and contains 52 exons. The 8.7-kb VWF messenger RNA
(mRNA) encodes a pre-proprotein containing 2813 amino acids, including
a 22-residue signal peptide, a 741-residue propeptide and a
2050-residue mature subunit.3,4 Pro-VWF is organized into
repeats of 4 homologous domains. The domains from N to C terminus are
D1-D2-D'-D3-A1-A2-A3-D4-B1-B2-B3-C1-C2-CK.5 Multimer assembly begins in the endoplasmic reticulum (ER) with the formation of
pro-VWF dimers linked by interchain disulphide bonds between C-terminal
cysteine residues.6,7 Multimerization continues in the
Golgi apparatus8,9 through interchain disulphide bond formation between cysteine residues within the N-terminal of mature propeptide cleaved VWF. The propeptide, consisting of domains D1 and
D2, plays an essential role in the assembly of VWF multimers. VWF
lacking a propeptide has been shown to undergo dimerization, passage
from the ER to the Golgi apparatus, and secretion as
dimers.10 The D1 and D2 domains each contain Cys-X-X-Cys
sequences that resemble the active sites of the protein disulphide
isomerase (PDI) family of enzymes that catalyze the formation of
disulphide bonds during synthesis of secretory proteins in the
ER.11 Although PDI activity has not been shown for the VWF
propeptide, mutation of a cysteine residue to glycine in either of the
2 Cys-X-X-Cys sequences abolishes multimerization and results in the
secretion of dimers.12
There have been several mutations reported in the VWF gene sequence
encoding the propeptide that result in VWD.13-21 The
majority of these are nonsense and frameshift mutations causing type 3 VWD. Other propeptide mutations, including 3 missense mutations (N528S,17 G550R,20 and C623W 18), 2 in-frame insertions (ins625Gly18 and ins405AsnPro
19), and 1 in-frame deletion (delR437-D44221),
were associated with type 2A VWD. Only 1 missense mutation in the
propeptide (W377C) has been reported to cause type 3 VWD.14
This current report describes the molecular defect underlying VWD in 3 different families from Turkey previously diagnosed with types 1 and 3 VWD. Analysis of the VWF gene sequence in DNA from all 3 propositi and
affected family members detected a novel mutation, C1067T, predicting
substitution of arginine by tryptophan at amino acid 273 in the
propeptide of pre-pro-VWF. When expressed in COS-7 cells, recombinant
VWF (rVWF), having the R273W mutation (rVWFR273W), exhibited severely
impaired secretion, failed to form high-molecular-weight multimers, but
showed no difference in its ability to form disulphide-linked dimers
when compared with wild-type rVWF.
To identify candidate proteins that may retain rVWFR273W
intracellularly, we have investigated the interaction of rVWFR273W with
molecular chaperones in COS-7 cells. We showed that, as with earlier
reported VWF variants, rVWFR273W interacted with the molecular chaperones BiP, Grp94, and ERp72.22-24 We also showed for
the first time that wild-type rVWF, as well as rVWFR273W, interacted
with the molecular chaperones calnexin and calreticulin during biosynthesis.
Plasmid pSVHVWF1 containing the full-length human VWF complementary
DNA (cDNA) was kindly supplied by Dr Aida Inbal (Tel Aviv, Israel). A
rabbit polyclonal antibody to canine calnexin was kindly supplied by
Professor Neil Bulleid (Manchester, UK).25 Rabbit polyclonal antisera to canine calnexin (SPA-860), human calreticulin (SPA-600), mouse ERp72 (SPA-720), and rat monoclonal antibody to
chicken Grp94 were purchased from StressGen (York, UK). A goat polyclonal antibody to human BiP (N-20) was purchased from Santa Cruz
Biotechnology (Santa Cruz, CA). The following polyclonal antibodies
were purchased from Dako (Glostrup, Denmark): rabbit antihuman VWF,
alkaline phosphatase-conjugated swine antirabbit IgG, horseradish
peroxidase (HRP)-conjugated rabbit antigoat IgG, and HRP-conjugated
rabbit antihuman VWF. The sources of all other reagents used have been
described previously by Allen and coworkers.26
Laboratory assays and multimer analysis
Mutation detection
Determination of ABO genotypes ABO blood group genotypes of family members were determined by restriction enzyme analysis of amplified DNA fragments corresponding to exons 6 and 7 of the ABO glycosyltransferase gene.38,39 PCRs were identical in composition to those described previously.26 The sequences of the forward- and reverse-oriented primers used to amplify exon 6 were 5'-TGGCACCCTGCCAGCTCCAT and 5'-TCACTCGCCACTGCCTGGGT, respectively, whereas the sequences of those used to amplify exon 7 were 5'-TACTATGTCTTCACCGACCA (forward) and 5'-TAGAAATCGCCCTCGTCCTT (reverse). PCRs were subjected to the same amplification conditions as indicated previously26 using an annealing temperature of 57°C. The deletion of a single cytosine at nucleotide position 258 of the cDNA that distinguishes the O allele from the A and B alleles was detected by digestion of amplified exon 6 with Asp718. Digestion of amplified exon 7 with AluI was used to detect the G to A transition at nucleotide 700 that distinguishes the B allele from the A and O alleles.Plasmid construction Plasmid pSVHVWF1 contains full-length wild-type human VWF cDNA cloned into the expression vector pSV7D.40 Plasmid pSVVWFR273W contained a C to T transition at nucleotide 1067 of the VWF cDNA and was generated by mutagenesis of a shuttle vector pKpnI that contains a 4.5-kb fragment (nucleotides 401-4851) of the VWF cDNA obtained by KpnI digestion of pSVHVWF1 cloned into pGEM3Z. Mutagenesis was performed using the GeneEditor system (Promega, Madison, WI) and the mutagenic oligonucleotide: 5'GAGTACGCCTGGACCTGTGC3' (nucleotides 1058-1077 in the VWF cDNA). Clones containing the appropriate mutation were confirmed by sequence analysis. The mutated fragment was subcloned into the KpnI sites of pSVHVWF1 to obtain pSVVWFR273W. The presence of the appropriate mutation in pSVVWFR273W was confirmed again by sequence analysis.Transient transfection of COS-7 cells with wild-type pSVHVWF1 and pSVVWFR273W COS-7 cells, grown to 60% confluence in 10-cm dishes, were transfected using DEAE-dextran (0.4 mg/mL) and the appropriate plasmid DNA (15 µg per dish) as described previously.26Steady-state and pulse-chase analysis of von Willebrand factor secretion Steady-state and pulse-chase analysis of VWF processing and secretion were performed as described previously.26Metabolic labeling, cross-linking, and coimmunoprecipitation To coimmunoprecipitate metabolically labeled VWF with antibodies to calnexin and calreticulin, 48 hours after transfection, COS-7 cells were washed twice with cysteine- and methionine-free DMEM and incubated with the same medium for 1 hour. The cells were then incubated for 90 minutes with 100 µCi of Promix [35S]-cysteine and [35S]-methionine per 10-cm dish in 5 mL of cysteine- and methionine-free DMEM. The medium was removed and the cells washed twice with ice-cold phosphate-buffered saline (PBS) before lysis with 0.75 mL of CHAPS (3-[(3-Cholamidopropyl)dimethyl-ammonia]-1-propanesulphonate) lysis buffer (50 mmol/L HEPES, pH 7.4, containing 2% CHAPS, 200 mmol/L NaCl, 10 µg/mL soybean trypsin inhibitor [SBTI], 1 mmol/L phenylmethylsulfonyl fluoride [PMSF], and 0.02% sodium azide) on ice for 1 hour. Cell lysates were adjusted to 1 mL with lysis buffer then centrifuged for 15 minutes at 12 000g to pellet nuclei and cell debris. Cell lysates were precleared by incubation with 0.5% protein-A sepharose at 4°C for 1 hour, then incubated overnight at 4°C with 0.5% protein-A sepharose and the appropriate antibody. The sepharose beads were pelleted, washed 4 times with CHAPS lysis buffer, then prepared for either SDS-PAGE as described below or sequentially immunoprecipitated with anti-VWF as follows. The washed protein-A sepharose pellets were resuspended in 200 µL of 50 mmol/L Tris/HCl, pH 8.0, containing 1% wt/vol SDS, and boiled for 5 minutes. The samples were cooled and then diluted to 4 mL with lysis buffer to dilute out the SDS 20-fold and immunoprecipitated with rabbit anti-VWF polyclonal antibody, as described above.Isolation of microsomes from COS-7 cells Microsomes were prepared from COS-7 cells using a modification of the method of Austen and coworkers.41 COS-7 cells were transfected with pSVHVWF1, pSVVWFR273W, or mock transfected without expression plasmid, as described previously.26 The cells were washed twice with PBS 72 hours after transfection, then trypsinized with 2 mL 1 × trypsin/EDTA solution (Life Technologies, Glasgow, UK). The cells from 5 dishes for each transfection were pooled, then centrifuged at 1600 rpm for 3 minutes. The cells were washed with 10 mL ice-cold buffer A (50 mmol/L Tris, pH 7.4, containing 0.25 mol/L sucrose, 25 mmol/L KCl, 0.5 mmol/L MgCl2, 0.1 mmol/L PMSF, and 100 µg/mL SBTI), pelleted, washed again in buffer A, then resuspended in 2 mL of buffer A. The cells were homogenized on ice using 60 strokes of a Dounce homogenizer. The homogenates were centrifuged at 1000 rpm for 5 minutes to yield a postnuclear supernatant that was centrifuged at 150 000g (60 000 rpm in a TL100.2 Beckman bench top ultracentrifuge rotor [Beckman, Fullerton, CA]) for 10 minutes at 4°C. The microsomes were resuspended in 50 µL of 0.25 mol/L sucrose, containing 0.3 mmol/L PMSF.Sodium dodecylsulfate-polyacrylamide gel electrophoresis and immunoblotting Immunoprecipitated sepharose beads were resuspended in SDS-PAGE sample buffer (0.25 mol/L Tris-HCl, pH 6.8, containing 2% wt/vol SDS, 20% vol/vol glycerol, 50 mmol/L DTT, and 0.004% wt/vol bromophenol blue). Electrophoresis and autoradiography were performed as described previously.26 For BiP, Grp94, and ERp72 detection by immunoblotting, proteins were electrophoretically transferred from SDS-polyacrylamide gels onto nitrocellulose membranes. These were probed with either the goat anti-BiP polyclonal antibody N-20, rat anti-Grp94 monoclonal antibody, or rabbit anti-ERp72 polyclonal antibody, followed by polyclonal HRP conjugated rabbit antigoat, rabbit antirat, or swine antirabbit immunoglobulins, respectively, to facilitate antigen detection by enhanced chemiluminesence. For quantitation of VWF in calnexin and calreticulin immunoprecipitates, autoradiographs were subjected to densitometry by phosphorimage analysis using a Biorad GS250 molecular imager (Hertfordshire, UK).
Patient histories and phenotypic results The propositi from families A (AII:1, Figure 1[iA]), B (BII:3, Figure 1[iB]), and C (CII:6, Figure 1[iC]) were Turkish boys with histories of severe bleeding problems that included epistaxsis, easy bruising, bleeding from gums, tonsils, and superficial cuts. The parents of all 3 propositi were first cousins. None of the parents of the 3 propositi (AI:1, AI:2, BI:1, BI:2, CI:1, and CI:2, Figure 1) had any bleeding symptoms. The phenotypic data for all 3 families are summarized in Table 1. The propositus AII:1 had a prolonged bleeding time, reduced VWF:Ag (0.06 IU/mL), FVIII:Ag (0.18 IU/mL), FVIII:C (0.20 IU/mL), and VWF:RiCoF (0.06 IU/mL) levels. The propositus BII:3 had a prolonged bleeding time, reduced VWF:Ag (0.09 IU/mL), FVIII:Ag (0.33 IU/mL), FVIII:C (0.21 IU/mL), and VWF:RiCoF (0.04 IU/mL) levels. The propositus CII:6 had a prolonged bleeding time, reduced VWF:Ag (less than 0.01 IU/mL), FVIII:Ag (0.06 IU/mL), FVIII:C (0.09 IU/mL), and VWF:RiCoF (less than 0.01 IU/mL) levels. The propositus AII:1 was homozygous for the ABO blood group O allele, whereas the propositi BII:3 and CII:6 were homozygous for the A allele (Table 1).
Multimer analysis of plasma von Willebrand factor Multimer analysis of equal volumes (2 µL) of plasma from the members of families A (Figure 1, iiA, lanes 1-3), B (Figure 1, iiB, lanes 1-3), and C (Figure 1, iiC, lanes 1-3) failed to detect multimers in plasma from all 3 propositi (AII:1, Figure 1, iiA, lane 1; BII:3, Figure 1, iiB, lane 1; CII:6, Figure 1, iiC, lane 1). All sizes of VWF multimers were detected in plasma from other family members (Figure 1). To determine whether failure to detect multimers in plasma from the propositi was due to the low concentration of VWF in the plasma or to the absence of VWF multimers, appropriate volumes of plasma containing identical amounts of VWF (0.5 mU) were analyzed (Figure 1, iiA, iiB, lanes 4 and 5) and compared with normal plasma. There was a reduction in intensity of high-molecular-weight multimers in plasma from the propositi of families A and B; in both cases, there was a marked increase in the intensity of the protomer band compared with that in normal plasma. Detection of VWF multimers in plasma from the propositus of family C (CII:6) was not possible because of the insufficient amounts of VWF present in the limited volume of plasma available.Candidate mutation Arg273Trp CSGE and CCMA were used to analyze all exons, exon/intron boundaries, and the promoter of the VWF gene in DNA from all 3 propositi. In all 3 cases, CSGE analysis detected a change in exon 7 that, on sequencing, was shown to result from a C to T transition at position 1067 of the VWF cDNA, predicting the substitution of arginine by tryptophan at amino acid 273 in pre-pro-VWF. All 3 propositi were homozygous for the C1067T transition, whereas the parents were heterozygous for the same defect. In the case of families A and B, the mutation was inherited with the 10 repeat allele of the intron 40 VNTR-1, whereas in family C, the propositus inherited the mutation with the paternal 6 repeat allele and the maternal 11 repeat allele of the intron 40 VNTR-1 and with the paternal 156-bp allele and the maternal 164-bp allele of the intron 40 VNTR-2. The occurrence of this nucleotide change on at least 3 separate occasions led us to examine whether it is a polymorphic change. DNA corresponding to exon 7 of the VWF gene was therefore amplified from genomic DNA samples from 35 Turkish individuals and 35 normal white individuals and screened for the C1067T transition. None of the 140 alleles screened carried this change, providing support for the C1067T transition being a mutation and not a rare polymorphism (results not shown).Von Willebrand factor promoter polymorphisms Different haplotypes of the single nucleotide polymorphisms, 1234C/T, 1185A/G, and 1051G/A of the VWF promoter,
have been shown to be associated with plasma VWF levels.35
To investigate a possible influence of these SNPs on VWF levels in
plasma from members of families A, B, and C, we determined the promoter
genotypes at nucleotides 1185 and 1051 for the propositi
and their parents (Table 2). The propositi
from all 3 families had the same genotype 1185GG/ 1051AA.
Steady-state analysis of rVWFR273W secretion To investigate the synthesis and secretion of VWF having the R273W amino acid substitution, the expression vectors pSVHVWF1 and pSVVWFR273W were used to transfect COS-7 cells. Intracellular and secreted rVWFR273W levels were quantified by enzyme-linked immunosorbent assay (ELISA) and compared with those of wild-type rVWF (Figure 2).26,27 Secretion of rVWFR273W was decreased to 10% ± 4 (n = 4) and intracellular levels of rVWFR273W were increased to 122% ± 3 (n = 4) relative to the wild-type rVWF.
Pulse-chase analysis of rVWFR273W secretion To further investigate the reduced secretion of rVWFR273W from COS-7 cells, a pulse-chase approach was adopted. Transfected COS-7 cells were pulse-labeled for 20 minutes, then chased for various times up to 96 hours in unlabeled growth medium. The labeled VWF in cell lysates and medium samples was immunoprecipitated and analyzed by SDS-PAGE and autoradiography (Figure 3). Immediately after the pulse (0 hour of chase, Figure 3), similar amounts of wild-type rVWF and rVWFR273W were immunoprecipitatedfrom the cell lysates, indicating that an equivalent amount of rVWFR273W was synthesized compared with wild-type rVWF. In the case of wild-type rVWF, there was a decrease in the amount of VWF immunoprecipitated from the cells over the 96-hour time course and a concomitant increase in the amount of VWF immunoprecipitated from the medium until after 96 hours, when most of the wild-type rVWF had been chased out of the cells into the medium. In the case of rVWFR273W, similar to that with wild-type rVWF, there was a decrease in the amount of VWF immunoprecipitated from the cells over the 96-hour time course until no detectable rVWFR273W remained. However, over the 96-hour time course, rVWFR273W was only weakly detected in immunoprecipitates from the medium compared with wild-type rVWF, suggesting impaired secretion from the COS-7 cells.
Pulse-chase analysis of rVWFR273W dimer formation To determine the effect of the R273W mutation on the ability of rVWFR273W to form disulphide-linked dimers in the ER, transfected COS-7 cells were pulse-labeled for 20 minutes, then chased for various times up to 240 minutes in unlabeled growth medium. The labeled VWF in the cell lysates was immunoprecipitated and analyzed by reducing and nonreducing SDS-PAGE (Figure 4). Immediately after the pulse (Figure 4, 0-minute chase), both rVWF and rVWFR273W, when separated under reducing conditions, migrated as a single band of approximately 350 kd, corresponding to monomeric pro-VWF. Identical samples separated under nonreducing conditions migrated as a single diffuse band of approximately 350 kd, indicating that, immediately after the 20 minute pulse, both rVWF and rVWFR273W existed predominantly as pro-VWF monomers. The slight increase in mobility and the diffuse banding pattern of the VWF monomers when separated under nonreducing conditions, compared with identical samples separated under reducing conditions, indicated that intrachain disulphide bonds were present in the monomers immediately after the pulse. After 10 minutes of chase, a faint band of approximately 700 kd was detected in both rVWF and rVWFR273W immunoprecipitates separated under nonreducing conditions but not reducing conditions, indicating VWF dimers had begun to form 10 minutes after the pulse. There was no difference between the rVWF and rVWFR273W immunoprecipitates in either the increase in intensity of the dimer band or the decrease in intensity of the monomer band up to 240 minutes under nonreducing conditions. It was therefore concluded that the R273W mutation had no significant effect on the ability of VWF to form disulphide-linked dimers.
Multimer analysis of rVWFR273W We examined the effects of the R273W amino acid substitution on VWF multimer structure by SDS-agarose electrophoresis of VWF secreted by COS-7 cells (Figure 5). Wild-type rVWF exhibited a full range of multimers when the appropriate volume of COS-7 growth medium containing 1 mU rVWF was analyzed (Figure 5, lane 1). Because of the inefficient secretion of rVWFR273W, it was not possible to analyze directly the appropriate volume of COS-7 growth medium containing 1 mU rVWFR273W. Instead, appropriate volumes of growth medium containing equivalent amounts of wild-type rVWF and rVWFR273W (10 mU) were immunoprecipitated with rabbit antihuman VWF polyclonal antibody before analysis by SDS-agarose electrophoresis (Figure 5, lanes 2 and 3). The multimer pattern of immunoprecipitated wild-type rVWF (Figure 5, lane 2) had a more smeared appearance when compared with wild-type rVWF electrophoresed without prior immunoprecipitation (Figure 5, lane 1). However, rVWFR273W (Figure 5, lane 3) showed a marked increase in the proportion of low-molecular-weight multimers compared with wild-type rVWF (Figure 5, lane 2).
Interaction of rVWFR273W with BiP, Grp94, and ERp72 Several studies have shown that, during synthesis, VWF interacts transiently with the ER proteins BiP (Grp78), Grp94, and ERp7222-24 that assist folding and assembly of secretory proteins and retain incompletely folded proteins in the ER. To determine whether rVWFR273W interacts with BiP, Grp94, and ERp72, lysates prepared from COS-7 cells transfected with pSVHVWF1, or pSVVWFR273W or mock transfected, were immunoprecipitated with an anti-VWF polyclonal antibody. The resulting immunoprecipitates were subjected to reducing SDS-PAGE, then immunoblotted with antibodies raised to BiP, Grp94, or ERp72 (Figure 6). To provide positive detection of BiP, Grp94, and ERp72 by immunoblotting, ER-derived microsomes were prepared from duplicate COS-7 transfectants. Microsomes prepared from mock-transfected COS-7 cells (Figure 6A-C, lane 4), COS-7 cells transfected with wild-type pSVHVWF1 (Figure 6A-C, lane 5), or pSVVWFR273W (Figure 6A-C, lane 6) contained species of 72 kd (Figure 6A, lanes 4-6), 78 kd (Figure 6B, lanes 4-6), and 100 kd (Figure 6C, lanes 4-6), corresponding to ERp72, BiP, and Grp94, respectively. The immunoblot for BiP detection in microsomes also showed a faster migrating 70 kd species (Figure 6B, lanes 4-6). This represented contaminating cytosolic heat shock cognate protein (Hsc70), which cross-reacts with the antibody because the peptide immunogen used to raise the antibody (KEDVGTTVVGIDLGTTYSCVG) contains 13 residues (shown in bold) that are 100% conserved across the mammalian Grp78/Hsp70 family. VWF immunoprecipitates from wild-type pSVHVWF1 (Figure 6A-C, lane 2) and pSVVWFR273W (Figure 6A-C, lane 3) transfected COS-7 cells contained species corresponding to ERp72, BiP, and Grp94. In the case of Grp94, the bands were barely visible above the background on repeated occasions (Figure 6C, lanes 2,3). rVWFR273W and wild-type rVWF coimmunoprecipitated similar amounts of each chaperone, demonstrating that there was no detectable difference in the amount of each chaperone protein interacting with rVWFR273W and wild-type rVWF. The absence of the 70 kd species in VWF immunoprecipitates immunoblotted for BiP reflects the expected lack of interaction between ER resident VWF and the cytosolic chaperone Hsc70 (Figure 6B, lanes 2,3). The absence of any species in VWF immunoprecipitates from mock-transfected COS-7 cells (Figure 6A-C, lane 1) demonstrated that ERp72, BiP, and Grp94 precipitated with VWF antibodies was not due to nonspecific precipitation but represented bona fide interactions of rVWFR273W and wild-type rVWF with ERp72, BiP, and Grp94.
Interaction of wild-type rVWF and rVWFR273W with calnexin and calreticulin Previous studies have demonstrated that the ER membrane protein calnexin and its soluble luminal homologue calreticulin serve to assist the folding of newly synthesized glycoproteins and retain misfolded mutant glycoproteins.42-44 To investigate the possibility that calnexin and calreticulin play a role in VWF maturation and participate in the retention of rVWFR273W, we performed coimmunoprecipitation studies to determine whether wild-type rVWF and rVWFR273W interact with calnexin and calreticulin. COS-7 cells transfected with wild-type pSVHVWF1 or pSVVWFR273W were radiolabeled. Lysates prepared from these transfectants were initially immunoprecipitated with antibodies raised to calnexin (Figure 7, lanes 1-4), calreticulin (Figure 7, lanes 7-10), VWF (Figure 7, lanes 11,12), and a preimmune serum prepared from nonimmunized rabbits (Figure 7, lanes 5,6). The calnexin (Figure 7, lanes 1,2) and calreticulin (Figure 7, lanes 7, 8) immunoprecipitates contained many radiolabeled protein bands corresponding to a pool of newly synthesized interacting glycoproteins and included a species that migrated with an identical mobility to pro-VWF (Figure 7, lanes 11,12). To determine whether pro-VWF was present in the calnexin (Figure 7, lanes 1,2) and calreticulin (Figure 7, lanes 7,8) immunoprecipitates, identical calnexin and calreticulin immunoprecipitates were reimmunoprecipitated with an antibody to VWF (Figure 7, lanes 3,4,9,10). The secondary VWF immunoprecipitates from primary calnexin immunoprecipitates showed faint bands corresponding to wild-type pro-VWF (Figure 7, lane 3) and R273W pro-VWF (Figure 7, lane 4), whereas those from primary calreticulin immunoprecipitates showed strong bands corresponding to wild-type pro-VWF (Figure 7, lane 9) and R273W pro-VWF (Figure 7, lane 10). Densitometry of the pro-VWF bands in the VWF immunoprecipitates revealed that 2% of the total radiolabeled wild-type pro-VWF (Figure 7, lane 3) and 2% of the total radiolabeled R273W pro-VWF (Figure 7, lane 4) were coimmunoprecipitated with antibodies to calnexin, whereas 25% of the total radiolabeled wild-type pro-VWF (Figure 7, lane 9) and 25% of the total radiolabeled R273W pro-VWF (Figure 7, lane 10) were coimmunoprecipitated with antibodies to calreticulin. The absence of pro-VWF in the immunoprecipitates obtained using preimmune serum (Figure 7, lanes 5,6) demonstrated that the VWF did not coimmunoprecipitate with antibodies to calnexin and calreticulin because of nonspecific interaction of VWF with the serum, but that it represented bona fide interactions of calnexin and calreticulin with VWF.
We have studied 3 Turkish families previously diagnosed with types 1 and 3 VWD. Analysis of the VWF gene in DNA from affected members of all 3 families identified a C to T transition in exon 7 at nucleotide 1067 of the VWF cDNA that predicted substitution of arginine by tryptophan at amino acid position 273 (R273W) of pre-pro-VWF. In the case of the propositi in families A and B, previously diagnosed with type 1 VWD, the defect was inherited on the 10 repeat allele of the intron 40 VNTR-1 from both parents, suggesting that the propositi from families A and B may have inherited 2 copies of the same VWF allele and that the families may have been related to a common ancestor. In contrast, the propositus from family C, previously diagnosed with type 3 VWD, inherited the defect on 2 different parental alleles, which in turn were different from those on which the defect was inherited in families A and B. The repeat occurrence of this mutation on at least 3 different alleles in these families may reflect its location in a CpG dinucleotide, which has a 12-fold higher mutation frequency than other sequences.45
We thank Dr Aida Inbal (Tel Aviv, Israel) for providing pSVHVWF1, Professor Neil Bulleid (Manchester, UK) for providing anticalnexin polyclonal antibody, Hazel Holden for oligonucleotide synthesis and automated sequencing, and Dr Mike Makris and Dr Eddie Hampton for useful discussion of this work.
Submitted December 28, 1999; accepted March 10, 2000.
Supported by a project grant from the British Heart Foundation (grant number PG97016).
Reprints: Simon Allen, Division of Molecular and Genetic Medicine, Royal Hallamshire Hospital, Glossop Rd, Sheffield S10 2JF, UK; e-mail: simon.allen{at}sheffield.ac.uk.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
1. Sadler JE. Biochemistry and genetics of von Willebrand Factor. Ann Rev Biochem. 1998;67:395[Medline] [Order article via Infotrieve]. 2. Sadler JE. A revised classification of von Willebrand disease. Thromb Haemost. 1994;71:520[Medline] [Order article via Infotrieve].
3.
Mancuso DJ, Tuley EA, Westfield LA, et al.
Structure of the gene for human von Willebrand factor.
J Biol Chem.
1989;264:19514 4. Titani K, Kumar S, Takio K, et al. Amino acid sequence of human von Willebrand factor. Biochemistry. 1986;25:3171[Medline] [Order article via Infotrieve]. 5. Shelton-Inloes BB, Titani K, Sadler JE. cDNA sequence for human von Willebrand factor reveals five types of repeated domains and five possible protein sequence polymorphisms. Biochemistry. 1986;25:3164[Medline] [Order article via Infotrieve] |