|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 96 No. 2 (July 15), 2000:
pp. 727-731
PHAGOCYTES
Expression of the familial Mediterranean fever gene and activity
of the C5a inhibitor in human primary fibroblast cultures
Yaacov Matzner,
Suzan Abedat,
Eli Shapiro,
Shlomit Eisenberg,
Ariela Bar-Gil-Shitrit,
Polina Stepensky,
Sima Calco,
Yehudit Azar, and
Simcha Urieli-Shoval
From the Hematology Unit, Hadassah University Hospital, Jerusalem,
Israel.
 |
Abstract |
Familial Mediterranean fever (FMF) is an inherited disease whose
manifestations are acute but reversible attacks of sterile inflammation
affecting synovial and serosal spaces. The FMF gene (MEFV) was recently cloned, and it codes for a protein
(pyrin/marenostrin) homologous to known nuclear factors. We previously
reported the deficient activity of a C5a/interleukin (IL)-8 inhibitor,
a physiologic regulator of inflammatory processes, in FMF serosal and
synovial fluids. We now describe the concomitant expression of
MEFV and C5a/IL-8-inhibitor activity in primary
cultures of human fibroblasts. Fibroblasts grown from synovial and
peritoneal tissues displayed C5a/IL-8-inhibitor activity that could be
further induced with phorbol myristate acetate (PMA) and IL-1 . Very
low levels of chemotactic inhibitor were evident in skin fibroblast
cultures or in peritoneal and skin fibroblasts obtained from FMF
patients. MEFV was expressed in peritoneal and skin fibroblasts
at a lower level than in neutrophils and could be further induced by
PMA and IL-1. In the FMF cultures, the MEFV transcript
carried the M694V mutation, consistent with the genetic defect found in
patients with this disease. MEFV was also expressed in other
cell lines that do not produce C5a/IL-8 inhibitor. These findings
suggest that human primary fibroblast cultures express MEFV and
produce C5a/IL-8-inhibitor activity. The interrelationship between
pyrin, the MEFV product, and the C5a/IL-8 inhibitor requires
further investigation.
(Blood. 2000;96:727-731)
© 2000 by The American Society of Hematology.
| |
Introduction |
The etiology of familial Mediterranean fever (FMF), an
inherited disease characterized by recurrent episodes of unprovoked inflammation involving serosal and synovial spaces, was long a puzzle.1-3 Several years ago, we postulated a defect in an
inhibitor of inflammation as the cause of this disease. Because the
release of chemotactic factor is one of the first events occurring in an inflammatory response, we postulated that the most effective site of
action for such an inhibitor would be at the level of the chemotactic
response. Accordingly, we described a serine protease that inactivates
C5a and interleukin (IL)-8.4-7 The activity of this
enzyme, designated C5a/IL-8 inhibitor, was documented in peritoneal and
synovial fluids but was absent from nonconcentrated human
serum4,5; it was produced by synovial and peritoneal fibroblasts but not by skin fibroblasts.8 In addition, it
displayed reduced activity in serosal fluids from FMF
patients.7,9-12 These findings suggested that the C5a/IL-8
inhibitor acts to prevent inappropriate inflammation in serosal tissues
and that its reduced activity in FMF could account for the attacks of
sterile inflammation characteristic of this disease.
Recently, the FMF gene designated MEFV was identified by
positional cloning.13,14 Several point
mutations were recognized, and homozygous patients for these mutations
were found to be suffering from FMF. The gene codes for a protein
termed pyrin/marenostrin that by computer alignment resembles
previously described nuclear factors. As MEFV expression was
described mainly in mature neutrophils, the authors suggested that it
plays a role in the inflammatory process.
In an attempt to shed light on the pathogenesis of the inflammatory
attacks in FMF, we examined the expression pattern of MEFV in
human primary fibroblast cultures from normal and FMF patients, and
compared it with C5a-inhibitor activity in these cultures.
| |
Materials and methods |
Materials
Recombinant C5a (rC5a) was purchased from Sigma (St Louis, MO) and
was dissolved in distilled-H2O containing 2.5 mg/mL of bovine serum albumin (BSA). Media and buffers
(Dulbecco's phosphate-buffered saline, Hank's balanced salt solution
(HBSS), Dulbecco's modified Eagle's medium, F-10 medium, and
supplements) were obtained from Biological Industries (Beit Ha'emek,
Israel), and fetal calf serum (FCS) from Gibco (Grand
Island, NY). IL-1 was purchased from Pepro Tech (Rocky Hill, NJ).
All other chemicals were of reagent grade and were purchased from Sigma.
Cell cultures
Human promyelocytic leukemia (HL-60)
cells, generously provided by Eithan
Fibach, PhD, Hadassah University Hospital, were cultured and induced
with retinoic acid as previously described by us.15 M9K and
JMN (mesothelioma cell lines) were generously provided by Brenda
Gerwin, PhD, National Institutes of Health (Bethesda, MD). Synovial
cultures were prepared from surgical specimens obtained from patients
with osteoarthritis who were undergoing orthopedic surgical procedures.
Peritoneal biopsies were obtained from FMF patients and otherwise
healthy patients undergoing surgical procedures because of hernia or
suspected appendicitis. Skin biopsies were obtained from FMF patients
and healthy volunteers. The patients and volunteers signed an informed consent approved by the Human Studies Committee of Hadassah Hospital.
Primary cultures were established and maintained by a modification of
the method of Matzner et al.8 Briefly, the biopsy material
was incubated in 0.025% EDTA/0.125% trypsin solution at 4°C
overnight and then transferred to new, identical solution, incubated at
37°C for 20 minutes, and teased apart. The monolayers thus obtained
were identified as fibroblasts by their morphology and by positive
immunofluorescent staining for fibronectin and negative staining for
cytokeratin. They were grown in F-10 medium containing 2 mmol/L
L-glutamine, 100 U/mL penicillin, 100 µg/mL streptomycin, and 20% FCS and were passaged with 0.05% EDTA/0.25% trypsin when confluent (every 2 to 4 weeks).
Conditioned media were obtained within 3 to 5 days from confluent
monolayer cultures (105 cells per 10 mm/well in a 24-well dish) and tested for C5a-inhibitor activity. One day before a scheduled
assay, the medium was replaced with serum-free medium. Inducers were
added for the time indicated (phorbol myristate acetate [PMA] for 1 hour and IL-1 for 24 hours), after which the cultures were washed
with HBSS and re-fed with serum-free medium for 24 hours. Supernatants
and cells were then harvested for C5a-induced myeloperoxidase (MPO)
release or reverse transcription-polymerase chain reaction
(RT-PCR) assays, respectively.
MPO release
C5a-induced MPO release from neutrophils was used to measure
C5a-inhibitor activity in conditioned media of human primary fibroblast
cultures, as described.12 Briefly, 50 µL of
5 nmol/L rC5a and 50 µL of the conditioned media derived from 3 wells
of a 24-well dish were each loaded into 3 wells in a 96-well microtiter plate and incubated for 20 minutes at 37°C. To each well, we added 25 µL freshly prepared human neutrophils (4 × 106
cells/mL in HBSS/25 mmol/L Hepes/0.25% BSA) that had
been incubated with 5 µg/mL cytochalasin B for 10 minutes at
37°C. Degranulation was allowed to proceed for 10 minutes at 37°C, and MPO release was then measured. The results
were corrected for MPO release in the absence of rC5a and compared with
those obtained in wells containing rC5a in the absence of a putative
source of C5a inhibitor.
Reverse transcription PCR
Total RNA from the various cultured fibroblasts was prepared with
the use of Tri Reagent (Molecular Research Center, Cincinnati, OH).
Complementary DNA (cDNA) was synthesized with the use of oligo
(dT)12-18 primer and SuperScript II reverse transcriptase (Gibco BRL, Gaithersburg, MD). The cDNA was amplified with Red Hot DNA
polymerase (Advanced Biotechnologies, Surrey, UK) and primers designed
from exon 10 of MEFV: forward common, 5'
TGACAGCTGTATCATTGTTCTGGGCT C TCCG 3'; reverse normal, 5'
TCGGGGGAACGCTGGACGCCTGGTACTCATTTTCC TCCT 3'; reverse M694V
mutant, 5' CGGGGGAACGCTGGACGCCTGGTACTCATTTT CCTTCCC
3'.16 Mixtures were incubated in a thermocycler (MJ Research, Watertown, MA) under the following conditions: 1 cycle of 10 minutes at 94°C followed by 34 cycles each consisting of 10 seconds
at 94°C, 10 seconds at 60°C, and 30 seconds at 72°C and, at
the end, followed by 1 cycle of 10 minutes at 72°C. The amplified
products were separated by electrophoresis on a 2% agarose gel.
Ethidium bromide staining of the agarose gel was used to detect the
amplified fragments. Amplification of a fragment of the housekeeping
gene actin (220-base pair [bp] fragment) was always used as a
positive control for successful amplification of the
cDNA.17 Negative controls included replacement of the cDNA
mixture with H2O in the PCR reaction and performance of the RT reaction in the absence of reverse transcriptase. Additional primer
pairs used were primers from exons 8 and 10 (forward, 5' TTCAATGTTCCAGAGCTG 3'; reverse, 5' TGTAGTCCACGAAGATGC
3', respectively) and 9 and 10 (forward, 5'
GATTGGCGCTCAGGCACATGCTGTTA 3'; reverse, 5' GTCGGGGGAACGC
TGGACGCCTGGTA 3', respectively). The experiments with FMF
cultures were carried out with the primer pair designed from exon 10 in
order to locate the M694V mutation previously described.16
Semiquantitative RT-PCR was performed as described with the use of the
primers from exons 8 and 10. Mixtures were incubated in a thermocycler
under the following conditions: 1 cycle of 2 minutes at 95°C
followed by 25 cycles for actin and 33 cycles for MEFV,
each consisting of 30 seconds at 95°C, 30 seconds at 55°C, and
30 seconds at 72°C and, at the end, followed by 1 cycle of 10 minutes at 72°C.
Calculations
MPO release was corrected for enzyme release in the absence of rC5a.
Inhibition of MPO release was calculated in comparison with that in
wells containing rC5a in the absence of a putative source of C5a
inhibitor ("culture") as follows:
Conditioned medium from FMF culture was assayed in comparison with
that of non-FMF culture at the same passage. Induced culture medium was
always assayed in comparison with culture medium in the absence of
inducer. Significance was determined by the paired t test.
| |
Results |
C5a-inhibitor activity in primary fibroblast cultures
We previously reported that supernatants of cultured human
peritoneal and synovial fibroblasts, but not skin fibroblasts, inhibit
C5a-induced neutrophil chemotaxis.8 We have now extended those studies, using the more accurate and less laborious C5a-induced MPO release assay, and compared the results with those obtained from
cultures established from FMF patients (Table
1). C5a-inhibitor activity was always
present between the third and fifth passage of the normal synovial and
peritoneal cultures where more than 95% of the cells were fibroblasts.
After the fifth passage, most of these primary cultures lost their
ability to express C5a-inhibitor activity. As previously documented,
skin fibroblast cultures display very low levels of this activity.
During the last decade, we established 3 peritoneal and 2 skin
fibroblast cultures from FMF patients. Assay of these cultures and of
normal cultures at the same passage indicated that the FMF cultures
fail to secrete significant C5a-inhibitor activity (Table 1).
The induction of the C5a inhibitor by PMA is shown in Table
2. Peritoneal fibroblast cultures
expressing maximal C5a-inhibitor activity at the third to fifth passage
could not be further induced by PMA (100 nmol/L for 1 hour). On the
other hand, cultures that had lost this ability, either partially or
completely, could be induced, at least in part, by the same
concentrations of PMA. Induction of those cultures with IL-1 (10 ng/mL for 24 hours) revealed similar effects (Table
3). In addition, skin fibroblast cultures,
lacking C5a-inhibitor activity, could be partially induced by PMA
(Table 2) and IL-1 (Table 3). C5a-inhibitor activity could be
induced by 50 to 500 nmol/L PMA after incubation for 30 to 60 minutes.
There was no induction of activity when PMA at 500 nm remained in the
culture for 24 hours or when PMA was added following preincubation of
the culture with the protein kinase C inhibitor staurosporine (results
not shown). FMF cultures, both peritoneal and skin, could not be
induced by PMA (Table 2) or IL-1 (Table 3).
MEFV expression in primary fibroblast cultures
The recently identified FMF gene, MEFV, was found
to be expressed mainly in mature neutrophils.13-14 We have
now extended this finding and compared MEFV expression with
C5a-inhibitor activity in various cell cultures. MEFV
expression was detected by RT-PCR analysis of total RNA extracted from
the studied cells with the use of several primer pairs designed from
different exons as described in "Materials and methods."
As shown in Figure 1, MEFV was
expressed in human neutrophils (lane 1), absent from native HL-60
cells (lane 2), but expressed in retinoic-acid-induced
HL-60 cells (lane 3). This suggests that MEFV is
expressed during early stages of myeloid differentiation, coincidental
with the appearance of the primary granules.18 In addition,
MEFV was also expressed in primary fibroblast cultures obtained
from normal peritoneal tissue (lane 4). Semiquantitative RT-PCR assays
suggested 2- to 3-log lower expression of MEFV in the
fibroblast cultures as compared with neutrophils (Figure
2). The low expression of MEFV in
the fibroblast cultures could be further induced with the use of
certain agents (Abedat et al, unpublished data, February
2000). One example of the use of IL-1 as an inducer is
shown in Figure 2 and suggests a 1- to 2-log increase in MEFV
expression in peritoneal fibroblasts after the induction. These results
suggest that MEFV may be up-regulated during certain
inflammatory conditions.
View larger version (60K):
[in this window]
[in a new window]
| Fig 1.
MEFV expression in various cells.
RT-PCR analysis was performed on total RNA with the use of common and
normal primers designed from exon 10 as described in "Materials and
methods." The size of the amplified MEFV fragment was 200 bp. Lane 1: Normal human neutrophils. Lane 2: HL-60 cells,
uninduced. Lane 3: Retinoic acid-induced HL-60
cells after 5 days incubation. Lane 4: Peritoneal
fibroblasts, third passage.
|
|
View larger version (64K):
[in this window]
[in a new window]
| Fig 2.
Semiquantitative RT-PCR assay of MEFV expression.
RT-PCR analysis was performed with the use of primers from exons 8 and
10 as described in "Materials and methods." The size of the
amplified MEFV fragments was 420 bp. Lane 1: Normal human
neutrophils; undiluted cDNA sample. Lane 2: Neutrophil cDNA diluted
1:100. Lane 3: Neutrophil cDNA diluted 1:1000. Lane 4: Normal
peritoneal fibroblasts, fourth passage; undiluted sample. Lane 5:
Normal peritoneal fibroblasts induced for 24 hours with 10 ng/mL
IL-1, undiluted sample. Lane 6: IL-1-induced peritoneal
fibroblasts; cDNA diluted 1:10. Lane 7: IL-1-induced peritoneal
fibroblasts; cDNA diluted 1:100. All undiluted samples included the
same amount of RNA in the RT reaction.
|
|
We then compared MEFV expression with C5a-inhibitor activity.
The expression of MEFV in all 6 normal primary fibroblast
cultures (5 peritoneal and 1 synovial) is shown in Figure
3. All of the culture media displayed
C5a-inhibitor activity in the absence of stimulus. Other cell lines
that express MEFV (ie, the mesothelioma cell lines M9K and JMN)
did not secrete C5a-inhibitor activity (results not shown).
View larger version (44K):
[in this window]
[in a new window]
| Fig 3.
MEFV expression and C5a-inhibitor activity in
normal peritoneal and synovial fibroblast cell cultures.
RT-PCR was performed with the use of the normal primers as described in
Figure 1. C5a-inhibitor activity is shown at the bottom and was assayed
by the MPO release assay as described in "Materials and methods."
A490 readings for control C5a-induced MPO release were 0.39 to 0.62. Lanes 1 to 5: Five different normal peritoneal fibroblasts
(lanes 1, 3, 4, and 5, third and fourth passage; lane 2, second
passage). Lane 6: Normal synovial fibroblasts, third passage. Lane 7:
H2O.
|
|
The expression of MEFV and the activity of C5a inhibitor in
primary fibroblast cultures could be further induced by PMA or IL-1.
Figure 4 shows the induction of both
peritoneal and skin fibroblast cultures at late passages (the skin
cultures lack C5a-inhibitor activity while the peritoneal ones lost the
activity, either partially or completely) (Tables 2, 3).
Following induction with both inducers, concomitant increase in
MEFV expression and C5a-inhibitor activity was observed in the
peritoneal and, to a lesser extent, in skin-fibroblast cultures.
View larger version (32K):
[in this window]
[in a new window]
| Fig 4.
MEFV expression and C5a-inhibitor activity in
normal skin and peritoneal fibroblast cell cultures induced with (A)
IL-1 or (B) PMA.
RT-PCR was performed with the use of primers from exons 9 and 10 as
described in "Materials and methods." The size of the amplified
MEFV fragment was 350 bp. C5a-inhibitor activity is shown at
the bottom (see legend to Figure 3). Lanes 1-4: Cultures induced with
10 ng/mL IL-1 for 24 hours. Lanes 5-8: Cultures induced with PMA 100 nmol/L for 1 hour. Lane 1: Normal peritoneal fibroblasts. Lane 2:
IL-1-induced peritoneal fibroblasts. Lane 3: Normal skin
fibroblasts. Lane 4: IL-1-induced skin fibroblasts. Lane 5: Normal
peritoneal fibroblasts. Lane 6: PMA-induced peritoneal fibroblasts.
Lane 7: Normal skin fibroblasts. Lane 8: PMA-induced skin fibroblasts.
The experiments were performed with cells from passage 6 and above. A
representative experiment is shown in the figure.
|
|
Figure 5 compares MEFV expression
and C5a-inhibitor activity in normal and FMF skin and peritoneal
fibroblast cultures. With the use of the normal primer (Figure 5A),
strong MEFV expression was evident in normal peritoneal
fibroblast culture (lane 3), which showed C5a-inhibitor activity. No
PCR band or C5a-inhibitor activity could be detected in the FMF culture
(lane 4). Normal skin fibroblasts, which lack spontaneous
C5a-inhibitory activity, expressed weak MEFV expression (lane
1). The FMF skin culture lacked C5a-inhibitor activity as well as
detectable PCR product when normal primer was used (lane 2).
View larger version (41K):
[in this window]
[in a new window]
| Fig 5.
MEFV expression in normal and FMF primary
fibroblast cultures.
Lane 1: Normal skin fibroblasts. Lane 2: FMF skin fibroblasts. Lane 3:
Normal peritoneal fibroblasts. Lane 4: FMF peritoneal fibroblasts.
Three experiments were performed for each cell type, each with cells
from a different passage (normal skin, passages 4, 6, 7; FMF skin,
passages 1, 5, 9; normal peritoneum, passages 2, 3, 4; FMF peritoneum,
passages 4, 5, 6). A representative experiment is shown in the figure.
(A) RT-PCR performed with the use of the normal MEFV primer.
(B) RT-PCR performed with the use of the mutant M694V MEFV
primer. Primers were designed from exon 10. (For details, see
"Materials and methods" and the legend to Figure 1.) (C)
Percentage of C5a inhibition. A490 readings for control
C5a-induced MPO release were 0.43 to 0.58.
|
|
PCR analysis of genomic DNA obtained from 3 FMF patients (2 from skin,
1 from peritoneum) revealed the M694V homozygous
mutation.16 We therefore repeated the expression
experiments, using the M694V mutant primer for the RT-PCR study. The
experiment depicted in Figure 5B revealed a mirror image of the results
shown in Figure 5A. When a normal primer was used, a PCR product in
normal skin (weak) and peritoneal cells (strong) was observed, whereas
no such product was observed in the corresponding FMF cells
(Figure 5A). However, when an M694V mutant primer was used, a PCR
product was amplified in the skin (weak) and peritoneal FMF cells
(strong), but not in the normal cells (Figure 5B). As mentioned,
C5a-inhibitor activity was detected only in the normal peritoneal
fibroblast culture (Figure 5C).
| |
Discussion |
In the present study, we demonstrate expression of the FMF
gene (MEFV) and C5a/IL-8-inhibitor activity in human primary
fibroblast cultures.
Appreciating the inflammatory nature of FMF attacks, we
previously suggested that they might result from an inborn deficiency in a physiologic regulator of the inflammatory response, just as
hereditary angioedema is attributed to an inherited deficiency of
C1-esterase inhibitor and certain hypercoagulable states may result
from an inherited deficiency of endogenous anticoagulant(s). The
putative inflammatory regulator was indeed detected by us in normal
synovial and peritoneal fluids4-7 and was missing in serosal fluids obtained from FMF patients.7,9-12 It is a
50-kd serine protease, designated C5a inhibitor, that
inactivates C5a and IL-8 by limited proteolysis.6 It was
purified to homogeneity; neutralizing polyclonal and monoclonal
antibodies were raised; and partial amino acid sequence was
obtained.12 Concomitantly, we showed that the protein is
produced by human primary fibroblast cultures from synovial and
peritoneal tissues and is lacking in skin fibroblasts, suggesting high
local anti-inflammatory activity in tissues that might be affected in
FMF.8
We have now extended these studies to FMF patients and show the
deficient production of C5a inhibitor by FMF cultures. By using PMA or
IL-1 as stimulators, we demonstrate that skin fibroblasts, which
express very low spontaneous C5a-inhibitor activity, could be partially
induced. On the other hand, C5a-inhibitor activity could not be induced
in any of the 5 FMF cultures. These results, which explain, at least in
part, the serosal location of the inflammatory attacks of FMF, also
suggest that the anti-inflammatory activity of the C5a inhibitor plays
a role in other tissues as well. In fact, a transient erysipelas-like
rash is an infrequent manifestation of FMF.1-3,19
MEFV was found to be expressed mainly in
neutrophils.13,14 Centola et al18 did not
detect MEFV expression in several synovial samples; neither was
it detected in a single cDNA library established from peritoneal
fibroblast primary culture.13 The French FMF Consortium did
detect message by RT-PCR in a synovial sample taken from a patient with
rheumatoid arthritis, but it was unknown whether this represented
expression in synoviocytes or infiltrating inflammatory
cells.14 Thus, it was of interest to investigate
MEFV expression in serosal tissues that are affected in FMF.
Such expression, if found, could give support for a possible relationship between the putative nuclear factor encoded by
MEFV and the anti-inflammatory activity that was assumed to
prevent undesired inflammatory attacks by means of C5a/IL-8
inactivation. Our results indicate the expression of MEFV and
the production of C5a-inhibitor activity by serosal fibroblast
cultures. Moreover, both could be further induced by the inflammatory
mediators IL-1 and PMA. FMF cultures, in which MEFV
transcript carried the M694V mutation, lacked C5a-inhibitor activity.
On the basis of these results, one might hypothesize that the C5a
inhibitor functions as a tissue-specific inflammatory mediator that may
be dependent on pyrin/marenostrin for proper expression and secretion.
Pyrin/marenostrin, which is encoded by MEFV, includes conserved
domains characteristic of known transcription factors, such as the
murine rpt-1 that down-regulates IL-2 expression.13 It
could regulate the C5a inhibitor directly, or indirectly via one or
more mediators.20 When pyrin/marenostrin expression is normal, it may result in up-regulation of the C5a inhibitor and, consequently, inhibit the development of an undesirable inflammatory response. On the other hand, dysfunction of pyrin/marenostrin would
result in the observed decrease in C5a-inhibitor activity, resulting in
the uncontrolled inflammatory attacks characteristic of
FMF.21
This hypothesis requires further investigation since several cell lines
other than serosal fibroblasts express MEFV at various levels
without production of C5a-inhibitor activity. Once additional cultures
from FMF patients are available, transfection experiments should lead
to a better understanding of pyrin/marenostrin function and its
interaction with the C5a inhibitor and other proteins involved in the
regulation of inflammation.
| |
Acknowledgments |
We thank Dr B. M. Babior and Dr Alexandra Mahler for critical reading
of the manuscript and the surgeons at the Hadassah Mount Scopus
Hospital and Dr Vardiela Meiner from the Genetics Department for
providing the synovial, peritoneal, and skin tissues.
| |
Footnotes |
Submitted September 20, 1999; accepted March 8, 2000.
Partially supported by the USA-Israel Binational grant BSF
95-00588.
Reprints: Yaacov Matzner, Hematology Unit,
Hadassah University Hospital, Mount Scopus, Jerusalem, 91240 Israel;
e-mail: matzner{at}cc.huji.ac.il.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Eliakim M, Levy M, Ehrenfeld M.
Recurrent polyserositis. Amsterdam, Netherlands: Elsevier-North Holland; 1981.
2.
Sohar E, Gafni J, Pras M, Heller H.
Familial Mediterranean fever: a survey of 470 cases and review of the literature.
Am J Med.
1967;43:227[Medline]
[Order article via Infotrieve].
3.
Samuels J, Aksentijevich I, Torosyan Y, et al.
Familial Mediterranean fever at the millennium: clinical spectrum, ancient mutations, and a survey of 100 American referrals to the National Institutes of Health.
Medicine (Baltimore).
1998;77:268[Medline]
[Order article via Infotrieve].
4.
Matzner Y, Partridge REH, Babior BM.
A chemotactic inhibitor in synovial fluid.
Immunology.
1983;49:131[Medline]
[Order article via Infotrieve].
5.
Matzner Y, Brzezinski A.
A C5a inhibitor in peritoneal fluid.
J Lab Clin Med.
1984;103:227[Medline]
[Order article via Infotrieve].
6.
Ayesh SK, Ferne M, Flechner I, Babior BM, Matzner Y.
Partial characterization of a C5a-inhibitor in peritoneal fluid.
J Immunol.
1990;144:3066[Abstract].
7.
Ayesh SK, Azar Y, Babior BM, Matzner Y.
Inactivation of interleukin-8 by the C5a-inactivating protease from serosal fluid.
Blood.
1993;81:1424[Abstract/Free Full Text].
8.
Matzner Y, Gavison R, Shlomai Z, et al.
Production of C5a antagonist by synovial and peritoneal tissue fibroblasts.
J Cell Physiol.
1986;129:215[Medline]
[Order article via Infotrieve].
9.
Matzner Y, Partridge REH, Levy M, Babior BM.
Diminished activity of a chemotactic inhibitor in synovial fluids from patients with familial Mediterranean fever.
Blood.
1984;63:629[Abstract/Free Full Text].
10.
Matzner Y, Brzezinski A.
C5a-inhibitor deficiency in peritoneal fluids from patients with familial Mediterranean fever.
N Engl J Med.
1984;311:287[Abstract].
11.
Matzner Y, Ayesh S, Hochner-Celniker D, Ackerman Z, Ferne M.
Proposed mechanism of the inflammatory attacks in familial Mediterranean fever.
Arch Intern Med.
1990;150:1289[Abstract/Free Full Text].
12.
Ayesh SK, Azar Y, Barghouti II, Ruedi JM, Babior BM, Matzner Y.
Purification and characterization of a C5a inactivating enzyme from human peritoneal fluid.
Blood.
1995;85:3503[Abstract/Free Full Text].
13.
The International FMF Consortium.
Ancient missense mutations in a new member of the RoRet gene family are likely to cause familial Mediterranean fever.
Cell.
1997;90:1[Medline]
[Order article via Infotrieve].
14.
The French FMF Consortium.
A candidate gene for familial Mediterranean fever.
Nat Genet.
1997;17:25[Medline]
[Order article via Infotrieve].
15.
Matzner Y, Gavison R, Rachmilewitz EA, Fibach E.
Expression of granulocytic functions by leukemic promyelocytic HL-60 cells: differential induction by dimethylsulfoxide and retinoic acid.
Cell Differ.
1987;21:261[Medline]
[Order article via Infotrieve].
16.
Eisenberg S, Aksentijevich I, Deng Z, Kastner DL, Matzner Y.
Diagnosis of familial Mediterranean fever by a molecular genetic method.
Ann Intern Med.
1998;129:539[Abstract/Free Full Text].
17.
Kaneko-Ishino T, Kuroiwa Y, Miyoshi N, et al.
Peg 1/Mest imprinted gene on chromosome 6 identified by cDNA subtraction hybridization.
Nat Genet.
1995;11:52[Medline]
[Order article via Infotrieve].
18.
Centola M, Aksentijevich I, Kastner DL.
The hereditary periodic fever syndromes: molecular analysis of a new family of inflammatory diseases [review].
Hum Mol Genet.
1998;7:1581[Abstract/Free Full Text].
19.
Matzner Y.
Biologic and clinical advances in familial Mediterranean fever.
Crit Rev Oncol Hematol.
1995;18:197[Medline]
[Order article via Infotrieve].
20.
Latchman DS.
Transcription-factor mutations and disease.
N Engl J Med.
1996;334:28[Free Full Text].
21.
Babior BM, Matzner Y.
The familial Mediterranean fever gene: cloned at last.
N Engl J Med.
1997;337:1548[Free Full Text].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
A. L. Waite, P. Schaner, C. Hu, N. Richards, B. Balci-Peynircioglu, A. Hong, M. Fox, and D. L. Gumucio
Pyrin and ASC Co-Localize to Cellular Sites that Are Rich in Polymerizing Actin
Exp Biol Med,
January 1, 2009;
234(1):
40 - 52.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Farasat, I. Aksentijevich, and J. R. Toro
Autoinflammatory Diseases: Clinical and Genetic Advances
Arch Dermatol,
March 1, 2008;
144(3):
392 - 402.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Simon and J. W. M. van der Meer
Pathogenesis of familial periodic fever syndromes or hereditary autoinflammatory syndromes
Am J Physiol Regulatory Integrative Comp Physiol,
January 1, 2007;
292(1):
R86 - R98.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. J. Chae, G. Wood, S. L. Masters, K. Richard, G. Park, B. J. Smith, and D. L. Kastner
The B30.2 domain of pyrin, the familial Mediterranean fever protein, interacts directly with caspase-1 to modulate IL-1beta production
PNAS,
June 27, 2006;
103(26):
9982 - 9987.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E Rabinovich, A Livneh, P Langevitz, N Brezniak, E Shinar, M Pras, and Y Shinar
Severe disease in patients with rheumatoid arthritis carrying a mutation in the Mediterranean fever gene
Ann Rheum Dis,
July 1, 2005;
64(7):
1009 - 1014.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S Rosengren, H M Hoffman, W Bugbee, and D L Boyle
Expression and regulation of cryopyrin and related proteins in rheumatoid arthritis synovium
Ann Rheum Dis,
May 1, 2005;
64(5):
708 - 714.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. C. Braun, R. Y. Reins, T.-b. Li, T. J. Hollmann, R. Dutta, W. A. Rick, B.-B. Teng, and B. Ke
Renal Expression of the C3a Receptor and Functional Responses of Primary Human Proximal Tubular Epithelial Cells
J. Immunol.,
September 15, 2004;
173(6):
4190 - 4196.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K Konstantopoulos, A Kanta, C Deltas, V Atamian, D Mavrogianni, A G Tzioufas, I Kollainis, K Ritis, and H M Moutsopoulos
Familial Mediterranean fever associated pyrin mutations in Greece
Ann Rheum Dis,
May 1, 2003;
62(5):
479 - 481.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. A. Wise, J. D. Gillum, C. E. Seidman, N. M. Lindor, R. Veile, S. Bashiardes, and M. Lovett
Mutations in CD2BP1 disrupt binding to PTP PEST and are responsible for PAPA syndrome, an autoinflammatory disorder
Hum. Mol. Genet.,
April 15, 2002;
11(8):
961 - 969.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Richards, P. Schaner, A. Diaz, J. Stuckey, E. Shelden, A. Wadhwa, and D. L. Gumucio
Interaction between Pyrin and the Apoptotic Speck Protein (ASC) Modulates ASC-induced Apoptosis
J. Biol. Chem.,
October 12, 2001;
276(42):
39320 - 39329.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Mansfield, J. J. Chae, H. D. Komarow, T. M. Brotz, D. M. Frucht, I. Aksentijevich, and D. L. Kastner
The familial Mediterranean fever protein, pyrin, associates with microtubules and colocalizes with actin filaments
Blood,
August 1, 2001;
98(3):
851 - 859.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. DiMartino, A. B. Shah, G. Trujillo, and R. R. Kew
Elastase Controls the Binding of the Vitamin D-Binding Protein (Gc-Globulin) to Neutrophils: A Potential Role in the Regulation of C5a Co-Chemotactic Activity
J. Immunol.,
February 15, 2001;
166(4):
2688 - 2694.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction
