|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 96 No. 3 (August 1), 2000:
pp. 1157-1165
TRANSPLANTATION
Molecular modification of a recombinant anti-CD3 -directed
immunotoxin by inducing terminal cysteine bridging enhances
anti-GVHD efficacy and reduces organ toxicity in a lethal murine
model
Daniel A. Vallera,
David W. Kuroki,
Angela Panoskaltsis-Mortari,
Donald J. Buchsbaum,
Buck E. Rogers, and
Bruce R. Blazar
From the Departments of Therapeutic Radiology, Section on
Experimental Cancer Immunology and Pediatrics, Division of Bone Marrow
Transplantation. University of Minnesota Cancer Center, Minneapolis,
MN, and Department of Radiation Oncology, University of Alabama at
Birmingham, Birmingham, AL.
 |
Abstract |
Immunotoxin (IT) therapy shows potential for selectively eliminating
GVHD-causing T cells in vivo, but the field has been hampered by
toxicity. Previously, we showed that a genetically engineered IT
consisting of a single-chain protein, including the anti-CD3sFv spliced
to a portion of diphtheria-toxin (DT390) has anti-GVHD
effects, but pronounced organ toxicity common to this class of agent. A
recombinant DT390 anti-CD3sFv protein previously shown to have anti-GVHD activity was modified to reduce its
filtration into kidney by genetically inserting a cysteine residue
downstream of the sFv moiety at the c-terminus of the protein. This
modification produced an intermolecular disulfide bridge, resulting in
a bivalent, rather than a monovalent IT, termed SS2, that selectively
inhibited T-cell proliferation in vitro. Although monomer and SS2 were
similar in in vitro activity, SS2 had a superior therapeutic
index in vivo with at least 8-fold more being tolerated with
reduced kidney toxicity. Most importantly, in a lethal model of
GVHD, 40 µg SS2 given for 1 day, protected 100% of the mice from
lethal GVHD for 3 months, whereas the maximum tolerated dose (MTD) of
monomer protected only 33%. To our knowledge, this is the first
time disulfide bonded ITs have been created in this way and this simple
molecular modification may address several problems in the IT field
because it (1) markedly increased efficacy curing mice of GVHD after a single daily treatment, (2) markedly decreased organ toxicity, (3)
increased the tolerated dosage, and (4) created a therapeutic window
where none existed before.
(Blood. 2000;96:1157-1165)
© 2000 by The American Society of Hematology.
| |
Introduction |
The expanded use of bone marrow (BM) transplantation,
in part due to the availability of matched unrelated donors, has
enhanced the need for anti-graft-versus-host disease (GVHD)
approaches. GVHD is a major complication and pathologic syndrome that
occurs when transplanted donor grafts containing T cells respond
against HLA and non-HLA antigens present on the recipient's cells with liver, gastrointestinal system, and skin as the primary target sites.1 Despite attempts to more closely match donors and
recipients, GVHD still is responsible directly or indirectly for about
20% of the mortality that follows BM transplantation.2
Because T cells mediate GVHD, numerous attempts have been made to
target T cells with anti-CD3 monoclonal antibody (mAb) recognizing the
CD3 component of the T-cell receptor (TCR) (reviewed by
Vallera3). Although promising in animal
models,4 one drawback is that anti-CD3 triggers T-cell
activation releasing a myriad of inflammatory cytokines that have
devastating side effects and are too high risk.5,6 One
solution to this problem is removal of the antibody Fc binding region
that prevents activation, but still permits targeting.7
This modification can be accomplished by cloning anti-CD3 single-chain
Fv (sFv).8 The Fv portion of an antibody is comprised of
the antibody VH and VL domains linked in a
single chain configuration with a short peptide that bridges about 3.5 nm between the carboxy terminus of one domain and the amino-terminus of
the other.9 sFv with a molecular weight (mw) of 20 kd, have been developed because they have more rapid blood clearance and better
tumor penetration.10-12 However, rapid clearance into
nontarget tissues has limited their benefit for therapy.
A number of laboratories have set out to target T cells using ITs in
which the antibody is linked to potent catalytic toxins such as
diphtheria toxin of which one molecule can kill a cell.13 One advantage of the IT approach is that unlike most drugs that inhibit
T-cell proliferation, IT will kill both dividing and nondividing targets. Although several laboratories have developed experimental approaches using IT (reviewed in Thrush et al14 and
Pastan15), clinical and preclinical studies with IT have
been limited by side effects such as renal toxicity, hepatic toxicity,
and vascular leak syndrome (VLS).16
Thus, we directed our studies toward the development of a modifiable
anti-CD3 sFv IT that could be studied in a mouse GVHD model.17 CD3 was chosen as a target marker because
studies showed that targeting CD3 with IT was superior to targeting
other pan-T-cell surface glycoproteins18,19 and were also
superior for treating GVHD.18,20 Genetic construction of
IT, rather than conventional biochemical coupling of antibodies and
toxins was chosen because recombinant ITs are homogeneous and can be modified to address future problems identified on in vivo testing. A
vector was assembled consisting of a DNA fragment encoding the sFv of
an antimurine CD3 spliced to a DNA fragment encoding the first 389 amino acids of DT (devoid of the region encoding its native binding site for human cells). DT was chosen for these studies
because it can be readily altered by genetic engineering as performed
in these studies to remove the portion of the B chain that binds to
eukaryotic cells, but retains the portion of the molecule that promotes
A-chain translocation.21 The kinetics of DT once
internalized shows first-order inhibition of protein synthesis.22 Previous studies showed that this
DT390 anti-CD3sFv protein was capable of potent anti-GVHD
activity, but these effects were accompanied by toxic side effects
predominantly directed at the kidneys.23 Such renal effects
have been common among this type of reagent in other
studies.24,25 We hypothesized that DT390
anti-CD3sFv was filtered into the kidneys and if a means of reducing
kidney clearance could be found, then higher levels of efficacy would
result and toxicity would drop.
Of particular interest to us was the design and expression of IT with a
c-terminal mutation containing the amino acid cysteine that would form
intermolecular disulfide bridges. The presence of c-terminal cysteine
facilitates the creation of bivalent homodimers by site specific
dimerization in vitro. Other groups have used this modification related
to Fab' fragments26-28 and sFv29 and have
shown that bivalent antibodies have increased avidity and have a longer
biological half-life as compared to sFv. Thus, introduction of
c-terminal cysteine might affect localization and reduce IT toxicity,
particularly to the kidney. The goal of this study was to mutate
DT390 anti-CD3sFv gene to express a bivalent recombinant IT, thereby increasing its size and reducing its kidney infiltration. We reasoned that this modification might increase the narrow
therapeutic window, permitting the administration of higher IT dosages
in an attempt to induce an anti-GVHD effect.
| |
Materials and methods |
Construction and expression of SS2
A 1.9-kb hybrid gene encoding an ATG initiation codon, the first 389 amino acids of diphtheria toxin, a 5 ASGGP amino acid connector, and a
sFv gene derived from the murine anti-CD3 hybridoma 145-2C11, kindly
provided by Dr Carolina Jost (NIH, Bethesda, MD),8 was
constructed by the method of gene splicing by overlap extension. The
gene was cloned into the pET21d bacterial expression vector
(Invitrogen, Carlsbad, CA) to create the plasmid
pDTmCD3sFv. The plasmid was mutated by polymerase chain reaction (PCR)
using a forward primer 5'AGATATTCCATGGGCGCTGATGATGTTGTTGAT to
introduce an Nco1 site and a back primer
3'AA- GCTTTTACTAACAGGAGACGGT to introduce C-terminal cysteine.
DNA sequencing analysis (University of Minnesota Microchemical
Facility) was used to verify that the gene had been cloned in frame and
correct in its desired sequence (data not shown). The resulting
1914-base pair (bp) Nco1/HindIII fragment hybrid gene was
spliced into the pET21d expression vector under the control of the IPTG
inducible T7 promoter creating plasmid pDTmCD3.cys.pET21d (Figure
1).
View larger version (27K):
[in this window]
[in a new window]
| Fig 1.
Construct encoding the SS2 fusion toxin gene fragment
used in these studies.
A Nco 1/HindIII gene fragment was cloned by PCR and splice
overlap extension encoding DT390, a 5 amino acid connector,
the downstream anti-CD3 sFv derived from the 11452C11 hybridoma, and a
cysteine residue on the c-terminus. The gene was cloned into the pET21d
expression vector forming the plasmid pDTmCD3sFv.CYS.pET21d.
|
|
Plasmid pDTmCD3.cys.pET21d was transformed into the Escherichia
coli strain BL21(DE3) (Novagen, Madison, WI) and protein expressed and purified from inclusion bodies as previously
described.17 To ensure proper tertiary structure,
renaturation was initiated by a rapid 100-fold dilution of the
denatured and reduced protein into refolding buffer consisting of 0.1 mol/L Tris, pH 8.0, 0.5 mol/L L-arginine, 0.9 mmol/L oxidized
glutathione (GSSG), and 2 mmol/L EDTA. The samples were incubated at
10°C for 48 hours. The refolded protein was diluted 10-fold in
distilled water and loaded on a Q- Sepharose ion exchange (Sigma, St
Louis, MO) column and eluted with 0.2 mol/L NaCl in 20 mmol/L Tris, pH
7.8. The protein was then further purified and measured30
by size-exclusion chromatography on a TSK GS3000SW column (TosoHass,
Philadelphia, PA). Two fractions were collected representing the
monomeric and dimeric forms of IT. The dimeric DT390
anti-CD3.cys protein was called SS2.
Sodium dodecylsulfate-polyacrylamide gel electrophoresis
Purified fusion proteins were analyzed using 10% SDS-PAGE gels
(Bio-Rad, Richmond, CA) and a Mini-Protein II gel apparatus (Bio-Rad,
Richmond, CA).31 Proteins were stained with Coomassie brilliant blue.
Monoclonal antibodies and biochemical immunotoxins
Monoclonal antibodies included: 145-2C11, a hamster IgG reactive
with the -chain of the CD3 component of the T-cell receptor (TCR)32 that was used on the blocking studies and
anti-Ly5.2, a rat IgG2a from clone A20-1.7, generously provided by Dr
Uli Hammerling, Sloan Kettering Cancer Research Center, New York, NY.
Anti-Ly5.2 was used as a control because it recognized CD45.1, a
hematopoietic cell surface marker not expressed in the mice used in
these studies.
Mitogen bioassays
T-cell mitogens such as phytohemagglutinin (PHA) and concanavalin A
(conA) selectively induce all T cells to proliferate. Mitogenesis was
measured as previously described.20 Cells (105)
were plated in a 96-well flat-bottom plate in DMEM, supplemented with
10% fetal bovine serum, 2-mercaptoethanol, and then stimulated with 12 µg/mL PHA (Sigma, St Louis, MO) or conA 10 µg/ml (Sigma) to induce
T-cell expansion. To measure B-cell proliferation, cells were similarly
prepared, but stimulated with 50 µg/mL lipopolysaccharide (LPS)
(Difco Laboratories, Detroit, MI). Immunotoxin in varying concentrations was added to triplicate wells containing cells. The
plates were incubated at 37°C, 10% CO2 for 48 hours
and then labeled with 0.037 Mbq (1 µCi) tritiated
thymidine per well for 24 hours. Cells were harvested onto glass fiber
filters, washed, dried, and counted using standard scintillation methods.
In vitro viability assays
The 2B4 cell line is a T-cell hybridoma expressing the T-cell
receptor and the associated CD3 complex.33 Two hundred
thousand 2B4 cells were plated into individual wells (24-well
flat-bottom plate, Costar, Cambridge, MA) in RPMI 1640 plus 10% fetal
bovine serum (Hyclone, Logan, UT) in the presence of varying
concentrations of SS2. Time points were performed in triplicate. At 24, 48, and 72 hours, a small sample was removed and stained with trypan
blue dye to quantitate the number of cells remaining in the well and their viability. The C1498 is a CD3 spontaneously
occurring myeloid leukemia cell line obtained from the American Type
Culture Collection (Rockville, MD).
Flow cytometry
Flow cytometry was used for analysis of the purity of the donor
T-cell fraction. The following mAb were used: anti-CD4 (clone GK 1.5 provided by Dr Frank Fitch, University of Chicago, Chicago, IL),34 anti-CD8 (clone 53-6.72, rat IgG2a provided by Dr
Jeffrey Ledbetter, Bristol-Myers-Squibb, Seattle, WA),35
anti-T-cell receptor  / ,36 and an irrelevant rat
IgG2 antihuman antibody (3A1E)37 (used as a
negative control). Monoclonal antibodies were purified38
and directly labeled with fluorescein isothiocyanate (FITC) and
phycoerythrin (PE) as described.39 Two-color cytometry studies were performed on single cell suspensions of lymph nodes, spleens, and thymi from toxin-treated mice. The cells were washed and
resuspended in FACS buffer (phosphate-buffered saline [PBS] supplemented with 2.5% newborn calf serum and 0.01% sodium azide). One million pelleted cells were incubated for 10 minutes at 4°C with 0.4 µg of an anti-Fc receptor mAb40 to prevent Fc
binding. Optimal concentrations of PE- and FITC-labeled mAb were added to a total volume of 100 µL and incubated 1 hour at 4°C. Cells were washed 3 times with FACS buffer and, after the final washing, were
fixed in 1% formaldehyde. All samples were analyzed on a FACScalibur
using CellQuest Software (Becton Dickinson, Palo Alto, CA). A minimum of 20 000 events was examined. Background subtraction using directly conjugated irrelevant antibody control was performed for
each sample.
Mice
C57BL/6 (H2b)mice (termed B6) were purchased from NIH
(Bethesda, MD). B6 congenic mice containing mutation at MHC class II B6.C-H2(bm12), (termed bm12) were purchased from the Jackson Laboratory (Bar Harbor, ME). Donors were 4 to 6 weeks of age and recipients were 8 to 10 weeks of age at the time of bone marrow transplant (BMT). All
mice were housed in specific pathogen-free facility in microisolator cages.
Graft-versus-host disease model
To induce lethal GVHD, bm12 recipients were irradiated sublethally
(6.0 Gy total body irradiation from a 137Cs source at a
dose rate of 85 cGy/min), and injected with enriched lymph node T
cells, as previously described.41 To purify lymph node (LN)
cells, single-cell suspensions of axillary, mesenteric, and inguinal LN
cells were obtained (as a source of GVHD-causing effector cells) by
passing minced LN through a wire mesh and collecting them into PBS per
2% fetal calf serum. Cell preparations were depleted of B cells by
passage through a goat antimouse immunoglobulin-coated column (Biotex,
Edmonton, Canada). One million enriched C57BL/6 (termed B6) lymph node
T cells were administered via caudal vein in 0.5 mL volume. The
development of GVHD was assessed by survival and weight loss.
Pathologic examination of tissues
Mice were killed, autopsied, and tissues were taken for
histopathologic analysis as described.42 All samples were
embedded in OCT compound (Miles, Elkhark, IN), snap frozen in liquid
nitrogen, and stored at  80°C until sectioned. To ensure
maximum quality of frozen specimens, this was achieved in under 10 minutes per mouse. Serial 4 µm sections were cut, thaw mounted onto
glass slides, and fixed for 5 minutes in acetone. Slides were stained with hematoxylin and eosin (H&E) for histopathologic assessment.
Immunohistochemistry
Sections were stained for cell surface antigen determinants. After
blocking with 10% normal horse serum, sections were incubated with
biotinylated mAb (purchased from PharMingen) specific for CD4 (GK1.5),
CD8(53-6.7), CD19(1D3), or Mac-1+ macrophages/neutrophils
(M1/70). Detection with alkaline phosphatase-conjugated avidin-biotin
complex and BCIP/NBT as chromogen was performed essentially as
described43 with reagents purchased from Vector Laboratories, Inc (Burlingame, CA).
Blood urea nitrogen and alanine transferase assays
As previously described,23 both assays were performed on
Kodak EKTACHEM clinical chemistry slides on a Kodak ETACHEM 950 by the
Clinical Chemistry Laboratory, Fairview University Medical Center-University Campus (Minneapolis, MN). Mice were killed, individual serum samples collected, and analysis was performed in a
coded fashion on the undiluted samples. Minimum specimen volume was 11 µL for each assay. The blood urea nitrogen (BUN) assay is read
spectrophotometrically at 670 nm. In the alanine transferase (ALT)
assay, the oxidation of NADH is used to measure ALT activity at 340 nm.
Fusion toxin administration
Fusion toxin was given intraperitoneally (ip) in a 0.2-mL volume in
the morning and then again 6 to 8 hours later. Doses mentioned in this
paper are total daily doses administered twice daily (BID).
Radiolabeling of SS2 and monomer and biodistribution
SS2 and monomer were radiolabeled with 125I using the
[N-succinimidyl-3-(tri-n-butylstannyl) benzoate] method of Zalutsky
and Narula.44 The radiolabeled products were analyzed by
polyacrylamide gel electrophoresis and demonstrated the same protein
bands observed with unlabeled SS2 and monomer. Autoradiography of the
gel showed that the radioactivity was associated with the protein
bands. The 125I-mIP-SS2 and 125I-mIP-monomer
were active as demonstrated by their specific binding to 2B4 cells and
their cytotoxicity against EL4 cells. The 125I-mIP-SS2 and
125I-mIP-monomer were then evaluated for biodistribution in
normal C57BL/6 mice (National Cancer Institute Frederick Research
Laboratory, Frederick, MD). Then 0.074 Mbq (2 µCi)
125I-mIP-SS2 or 125I-mIP-monomer were injected
intravenously into the mice and they were killed 30 minutes later. The
kidney, liver, and heart were removed and weighed, and the
radioactivity counted in a gamma counter. The percentage injected dose
per gram for each tissue was calculated.
Statistical analyses
Groupwise comparisons of continuous data were made by
Student t test. Survival data were analyzed by Mantel-Peto-Cox
summary of chi square.45 Probability (P) values
less than or equal to .05 were considered significant.
| |
Results |
Purity of SS2
To assess the fractions collected from our chromatography
procedure, SDS-PAGE analysis was performed. The isoelectric point of
SS2 was 5.64 and determined using ISOELECTRIC (Genetics Computer Group,
Wisconsin Package version 10.0-UNIX, Madison, WI). Figure 2, lane 1, shows that the SS2 fraction
consisted of about 65% dimer/23% monomer. Densitometry was performed
using NIH Image 1.61 software. Lane 2 shows that the monomeric fraction
contained 63% monomer/20% dimer with the remainder of the fraction
contaminants. Lane 3 shows mw standards with the upper 2 bands
representing 66 and 97.4 kd.
View larger version (61K):
[in this window]
[in a new window]
| Fig 2.
SDS-PAGE analysis of SS2.
Gel showing the purity of the SS2 and monomeric HPLC fractions of the
DT390sFv modified by introducing a c-terminal cysteine.
(Lane 1) SS2 fraction; (lane 2) monomeric fraction; (lane 3) mw
standards.
|
|
In vitro activity of SS2 measured against mitogen stimulated T
cells
To measure the activity and selectivity of SS2 against T-cells, 2 different mitogenic assays were used. In the first assay, murine
splenocytes were activated with the T-cell mitogen PHA. Figure
3, panel A, shows that T-cell proliferation
was inhibited in a dose-dependent manner by SS2. The IC50
was about 10 nmol/L. Inhibition was selective because the addition of
the parental 1452C11 mAb entirely blocked IT activity. The addition of
control anti-Ly5.2 mAb (which was not reactive with either SS2 or the splenocytes) had no blocking effect, indicating that binding of the SS2
molecule was mediated entirely through the sFv moiety of the engineered
protein. Panel B indicates that the monomer had comparable activity.
View larger version (15K):
[in this window]
[in a new window]
| Fig 3.
Activity of SS2 against PHA stimulated T cells.
Splenocytes were stimulated with PHA to induce T-cell proliferation,
and then cultured in triplicate with IT. Three days later thymidine
incorporation was assayed as a measure of T-cell activation. (A) SS2
added to PHA stimulated T-cells; (B) monomeric IT added to T cells.
Background counts were determined by measuring incorporation of
splenocytes without PHA stimulation (mean 254 ± SD 58). The counts
of PHA-stimulated cells without the addition of any IT were mean
22 416 ± SD 4 229. Data are expressed as activity versus
concentration. Activity was calculated by averaging triplicates and
subtracting the spontaneous background.
|
|
In a different experiment, splenocytes were stimulated with conA.
Figure 4A shows more than 95% of T-cell
proliferation was inhibited by 10 nmol/L SS2. In contrast, B-cell
proliferation measured by stimulating splenocytes with the B-cell
mitogen LPS was only partly affected, even at a dosage of
100 nmol/L SS2. Figure 4B shows that a similar pattern of activity was
observed for monomer. In this assay, SS2 was slightly more effective.
View larger version (23K):
[in this window]
[in a new window]
| Fig 4.
SS2 selectively kills T cells and not B cells.
Splenocytes were stimulated with conA to induce T-cell proliferation or
with LPS to induce B-cell proliferation, and then cultured in
triplicate with IT. Three days later thymidine incorporation was
assayed. (A) SS2 added to T cells and to B cells as control; (B)
monomeric IT added in an identical manner. Spontaneous counts were
determined for LPS stimulation (mean 864 ± SD 345) and conA
stimulation (mean 1 587 ± SD 630). Maximum counts for LPS (mean
11 501 ± SD 2 228) and conA (mean 19 364 ± SD 2 660) were
determined. Data are expressed as percentage (%) control response
(experimental counts-spontaneous counts per maximum counts-spontaneous
counts) × 100.
|
|
Together, all our in vitro studies indicated that SS2 was potent and
highly selective in its activity against CD3-expressing cells. Because
SS2 and monomer had nearly identical activity, intermolecular disulfide
bonding did not sterically obstruct the binding or the catalytic
activity of SS2.
In vitro activity of SS2 measured against a T-cell line
As another indicator of the in vitro cytotoxic activity of SS2,
activity was measured against the murine CD3-expressing T-cell hybridoma 2B4 in a trypan blue viability assay. Figure
5A shows that SS2 activity was dose
dependent and all the 2 × 105 2B4 cells plated were
eliminated at 10 nmol/L. Thus, IT appears to kill more than 5 logs of
cells at this dose. Figure 5B shows that monomer activity was similar.
SS2 had no inhibitory activity against control C1498 cells that did not
express CD3 (not shown).
View larger version (15K):
[in this window]
[in a new window]
| Fig 5.
Activity and selectivity of SS2.
(A) Triplicate cultures of CD3 + 2B4 cells were incubated
with various concentrations of SS2 for up to 72 hours. At 24-hour
intervals, individual wells were sampled and aliquots stained with
trypan blue and counted. Standard deviations of the mean for each data
point did not exceed 29% of mean values. (B) Cells were cultured with
monomeric ITs.
|
|
Determination of the maximum tolerated dose of SS2
To study the toxicity of SS2, it was first injected into B6 mice
(n = 4-5 per group) over a 4-day course BID. Administration of
anti-CD3 recombinant17 and conventional18
anti-CD3 IT by this schedule was previously shown to induce a
significant anti-GVHD effect. Table 1 shows
that all mice tolerated either 20 or 40 µg/d SS2. When the dose was
increased to 80 µg/d, one mouse died on day 18. In contrast, all mice
given 20 or 40 µg/d monomer died, whereas one mouse died in the group
given 10 µg/d. There was a significant (P < .01)
difference between groups given 10 µg/d and 20 to 40 µg/d of
monomer. Because findings were identical in the 80 µg/d SS2 group and
in the 10 µg/d monomer group, SS2 was 8-fold less toxic than monomer.
Survivors were monitored for an additional 30 days with no signs of
delayed toxic effects.
Toxicity was also studied in a separate experiment, giving only a
single day's treatment (2 injections). Groups of mice given 40 µg/d,
80 µg/d, or 160 µg/d SS2 all survived. For monomer, groups given a
single day's treatment at 10 or 20 µg survived, but mice given 40 or
80 µg all died. Because the maximum tolerated dose (MTD) for a single
day's treatment was 20 µg/d for the monomer and at least 160 µg/d
for SS2, there was again at least an 8-fold toxicity difference (4-fold
molar difference). Together, independent studies of 1-day treatment and
4-day treatment schedules both confirmed the same 8-fold toxicity
difference between monomer and SS2.
In vivo activity of SS2
A different experiment was performed to determine whether SS2 had an
effect on T cells in vivo. Splenocytes were removed from mice given 80 µg/d SS2 BID for 4 days and stimulated with the T-cell mitogen conA.
Table 2 shows greater than 77% reduction (P = .002) in activity compared with control untreated mice.
In contrast, there was no significant reduction in B-cell activity measured by stimulating the same splenocytes with LPS. Flow cytometry studies were performed on splenocytes from these same mice. Table 2
shows that spleens were comprised of 22% CD4+ T cells plus
15% CD8+ T cells, totaling 35%. SS2 significantly
(P = .001) reduced CD4+ cells by 95.6% and
CD8+ cells by 78.9%. The CD19+ B cells were
not reduced. The percentage of myeloid cells (Mac-1+) was
not reduced (not shown).
To further study the cells inhibited by SS2 treatment, frozen tissue
sections from 80 µg/d SS2-treated mice were studied in a different
experiment for the expression of surface markers in situ. Figure
6 is a series of panels showing the same
splenic follicle after immunohistochemistry (IHC) analysis. Panel A
shows the follicle stained by H&E. A large number of mononuclear cells are congregated around the central arteriole in the perivascular area
of the white pulp. Panel B shows that the majority of these cells stain
in a positive fashion for CD19, a well-studied B-cell specific marker,
indicating that the majority of these cells are B cells. Panel C shows
positive staining for the Mac-1 myeloid marker. As expected the
majority of myeloid cells are localized in the red pulp region. Panel D
shows that the majority of CD4 expressing T cells have been eliminated
by SS2 and only a few are still present. The same is true of CD8
expressing T cells. These data provide visual evidence that T cells are
killed in situ by the administration of SS2.
View larger version (97K):
[in this window]
[in a new window]
| Fig 6.
Sections of spleen (objective lens 40×) from a
mouse given ip injections SS2 at 80 µg/d.
Cryosections were stained by immunoperoxidase using biotinylated
monoclonal antibodies.
|
|
Together, Figures 3 through 6 and Table 2 indicate that SS2 is
selective in vivo, inducing a dramatic reduction in T cells and their
activity, but not in B cells.
Toxicity of SS2
In our previous studies, monomeric DT390anti-CD3sFv had
unacceptable kidney toxicity.23 To determine whether
modification had altered renal toxicity, tissue for histologic analysis
and serum for functional analysis were collected from the same mice. Extra mice had been injected in the experiment shown in Table 1 for
histologic studies. Visual examination of mice given SS2 confirms that
at 80 µg/d SS2 was far less destructive to the kidney than monomer at
40 µg/d (Figure 7). Panel D shows that
after 80 µg/d SS2 treatment, kidney tissue looked nearly normal with
glomeruli, distal tubules, and proximal tubules intact. There was some
minor infiltration with polymorphonuclear cells. All mice given
this dosage were alive at 10 days. In contrast, panel B shows that monomer treatment severely damaged the kidney to the point that glomeruli disintegrated. Proximal tubules were destroyed, and there
were large areas of necrosis and infiltration of predominantly mononuclear cells with fewer polymorphonuclear cells. Damage at this
level has been associated with a complete loss of function in our
previous studies.23 As expected, these mice all died within
10 days. Panel C shows only minor hepatic damage in SS2-treated mice
with minor mononuclear cell infiltration. The same is true for
monomer-treated mice (panel A).
View larger version (160K):
[in this window]
[in a new window]
| Fig 7.
C57BL/6 mice were randomly grouped and injected with SS2
or monomer.
Kidney and liver were removed, sectioned, and stained with H&E to
visualize organ damage. Two animals per group were examined with
identical results.
|
|
To determine whether SS2 had an effect on renal function,
serum levels of BUN were measured (n = 3-4 per group) the day after SS2 was given at 80 µg/d on days 0 to 3. There was no significant difference in the average BUN levels measured in mice given SS2 (23.3 ± 5.7 mg/dL) compared with untreated mice (19.3 ± 1.5
mg/dL), indicating that SS2 did not significantly impair renal
function. Precipitous increases in BUN levels induced by monomer
administration have been previously reported.23 All values
were in the normal range and there was no difference in ALT levels with
SS2 treatment (treated = 54.0 ± 31.3 U/L,
untreated = 54.7 ± 14.6 U/L), indicating that hepatic activity
also was unaffected. Histology studies also indicated that IT did not
damage the brain or heart muscle.
Biodistribution of SS2 in the kidney
To determine whether there was a correlation between the decreased
toxicity of SS2 and its localization into the kidney, SS2 was
radiolabeled, injected into normal mice and then studied for its
biodistribution into the kidney and liver. Table
3 shows that, when SS2 and monomer were
injected at similar doses (0.074 Mbq [2 µCi]), significantly
(P < .002) less SS2 (20.8% ± 2.3% injected dose per
gram) accumulated in the kidney than did monomer (34.5% ± 6.4%). Regarding the liver, there was some increase in the accumulation of SS2, compared with monomer. As a control, there was no difference in the amount of SS2 distributed in heart, compared with monomer. Thus, biodistribution data correlated with histology results and data from the functional studies reported above.
SS2 administration prevents lethal GVHD in vivo
To determine whether SS2 was able to protect against lethal GVHD, LN
T cells from B6 mice were given to MHC class II disparate bm12
irradiated (6 Gy) recipients to induce GVHD (Figure
8A). A total of 106 highly
purifed LN T cells were given to each recipient. This dose was selected
because it is about 50 to 100 times greater than the minimal lethal
dose in this system. In a separate experiment, 104 cells
killed 75% recipients in about 45 days. In preparing the T-cell
fraction, passage over an Ig-column removed the contaminating 34%
surface Ig-expressing cells so that only 0.1% contaminating Ig-expressing cells remained. All but 4% of the remaining cells expressed the T-cell receptor. This highly enriched T-cell fraction composed of 54% CD4+ cells and 37% CD8+
cells killed a control group of bm 12 recipients in 20 days.
View larger version (22K):
[in this window]
[in a new window]
| Fig 8.
The in vivo effect of SS2 administration on GVHD induced
across the MHC class II barrier in bm12 recipients of C57BL/6 T cells.
Irradiated (6 Gy) recipients were given enriched LN T cells. Groups of
mice (n = 6 per group) received BID ip injections of SS2 at 40 µg/d
administered for 1 day, monomer at its MTD of 10 µg/d for 4 days, or
were untreated. (A) Data are represented as actuarial survival versus
time in days. Statistical analysis indicated that the SS2 group
differed significantly (P = .009) from the monomer group, the
SS2 group differed significantly (P = .00062)) from the
untreated group, and the monomer group differed significantly
(P = .015) from the untreated group. (B) For these same mice,
mean weights were plotted versus time. Standard deviation did not
exceed 29% of the mean. On days 14 to 25, mean weights for the SS2
group differed significantly (P < .008) from the monomer
group.  Untreated mice all died by day 18.
|
|
A cohort of mice were given 10 µg/d monomeric DT390
anti-CD3sFv for 4 days, a dose based on the MTD determined from the
data in Table 1. Of these 6 mice, 4 (66%) died (Figure 8A). The weight data for mice in Figure 8B showed that all these animals had
precipitous weight loss (over 25% of pretransplant body weight) and
death occurred late on days 19 to 26. In contrast to the monomer, the administration of only 2 injections of SS2 over the course of 1 day
totaling 40 µg was sufficient to protect 100% of the mice from
lethal GVHD. This dose was well below the MTD.
As previously discussed in the section "Determination of the maximum
tolerated dose," a cohort of untransplanted normal bm12 mice given
160 µg/d SS2 for a single day, all lived, indicating that the MTD was
at least 160 µg/d. The GVHD studies described above also administered
SS2 for a single day and showed that 40 µg/d was an efficacious dose,
fully inhibiting GVHD. These studies with the same lot, dose schedule,
and recipient strain demonstrated the presence of a therapeutic
window in which the efficacious dose was at least 4-fold lower than the
toxic dose. Thus, the therapeutic window for SS2 was 40 to 160 µg/d.
The presence of a therapeutic window for SS2 was in contrast to the
absence of a window for monomeric IT that has less of an anti-GVHD
effect in the B6 into bm12 model at its MTD of 10 µg/d BID given over the course of 4 days.
| |
Discussion |
This is the first report, to our knowledge, using terminal cysteine
disulfide bonding to establish an intermolecular bridge between
engineered ITs. The major contribution of this work was the finding
that rendering a sFv fusion toxin bivalent, so as to double its
molecular size and raise it above the filtration threshold for the
kidneys, markedly reduced its toxicity. In reducing its toxicity, its
efficacy was increased so that 100% of all treated mice were protected
from lethal GVHD with a single day's treatment, so a therapeutic
window was created where none existed before.
The kidney plays the major homeostatic role of maintaining the volume
and composition of the body fluids largely through glomerular filtration and tubular reabsorption and secretion. Small proteins readily enter the kidneys and in a previous study,23 the
monomeric form of the same DT390 anti-CD3sFv fusion toxin
at 58 kd was filtered into the kidney and caused severe and
irreversible renal damage. Similar renal effects have been noted by
other investigators with other fusion toxins of a similar size. Kirkman
and coworkers24 evaluated an IL-2 fusion toxin and reported
that toxicity was largely limited to the renal system. In a different
study,25 an IL-4 IT, consisting of IL-4 and
DT389 (similar to our DT390) given to mice
subcutaneously, showed a MTD similar to that of monomeric
DT390 anti-CD3sFv (10 µg/d). Mice given doses exceeding the MTD died with markedly elevated BUN and creatinine and extensive necrosis of proximal renal tubular cells.
In contrast to findings with these smaller proteins ranging in size
from 58 to 90 kd, our data with 120 kd bivalent SS2 showed a dramatic
shift in toxicity. SS2 was at least 8-fold less toxic to mice than
monomer with a visible reduction in the amount of kidney toxicity.
Also, radiolabeling studies showed that SS2 did not localize as readily
in kidney as did monomer and mice readily tolerated much higher doses
of SS2.
Another major finding was that SS2 demonstrated a therapeutic window in
a lethal and aggressive GVHD model, whereas monomeric DT390
anti-CD3sFv did not. The window was defined by giving SS2 at 40 µg/d
for a single day and demonstrating that the mice did not develop GVHD.
The same strain of mice tolerates at least 160 µg in a single day,
indicating at least a 4-fold difference between the toxic dose and
efficacious therapeutic dose. In contrast, monomeric IT showed no such
window when tested under similar conditions. Four of 6 mice that
received the MTD of 10 µg/d given for 4 days succumbed of GVHD or
toxicity, whereas the remaining 2 mice demonstrated symptoms of
subclinical GVHD as evidenced by histologic examination. Monomer was
administered on a 4-day schedule because, unlike SS2, administration of
monomer for a single day at a dose of 10 µg/d does not result in an
anti-GVHD effect.
Our design was influenced by other studies. For example, Luo et
al46 placed a fragment with cysteine residues on the
c-terminus and found that binding was greatly reduced. Although the
exact reason for the decreased binding was not known, a loop structure in the c-extension might be formed through a disulfide bridge between
the cysteines, which might interfere with the overall binding
conformation. After considering this and other methods used to fuse sFv
to protein domains capable of dimerization, including leucine
zippers,47 amphipathic helices,48 the k
constant domain, or CH3 in the form of a
minibody,49 we decided that the c-terminal modification
would be the most straightforward.
On the basis of the literature, a sFv dimer formed with a covalent bond
might have increased activity as a result of increased binding
activity. For example, Kipriyanov et al50 showed that a sFv
recognizing RNA polymerase and modified to express a cysteine near the
c-terminus demonstrated a 4-fold higher binding affinity in its
bivalent form, compared with its monomeric form. Adams et
al12 using a sFv recognizing c-erbB-2 showed improved
retention of specific bivalent sFv dimers by tumors in vivo compared
with monovalent fragments. However, direct comparisons of the
bivalent and monomeric forms of our DT390 anti-CD3sFv
revealed no difference in in vitro activity when measured in thymidine
incorporation assays (PHA or conA) or bioassays designed to directly
measure killing of CD3+ cells in viability assays. This
suggests that the advantage of SS2 in vivo may not
necessarily be related to its binding.
In addition to its size and binding, disulfide bonding may provide
advantages to the in vivo activity of ITs by increasing their
stability. Cumber et al29 chemically cross-linked 2 sFv fragments with a single cysteine residue at the c-terminus. The bivalent conjugate was completely stable to incubation in solution at
37°C for 24 hours, whereas only 60% of the monomeric fragment remained. Disulfide bonding may also have the advantage of increasing circulation time because these studies showed that after intravenous administration to normal rats, the bivalent agent was cleared with an
alpha-phase half-life significantly longer than that of the monomeric
agent. It is possible that dimerization increased the stability of the protein.
Bera et al51 made a bivalent IT using a truncated form of
Pseudomonas toxin linked to a stable bivalent Fv molecule of
the anti-erb2 antibody. This molecule showed a large increase in
avidity and in vitro cytotoxicity, compared with monomeric IT. Whereas our in vivo findings demonstrated superiority of SS2 over monomeric IT,
their in vivo findings showed that bivalent IT was inferior to
monomeric IT in inhibiting solid tumors in scid mice. The agents in the
2 studies were prepared differently, but the difference in findings
also might be explained by the fact that GVHD-causing T cells might be
more accessible as targets than solid tumors. Many issues still need to
be addressed regarding this class of agent.
There are several reasons to pursue the targeting of CD3 for destroying
GVHD-causing T cells. GVHD can readily be studied in experimental mouse
models and is extremely difficult to control once the disease
begins.3 In these models, anti-CD3 ITs have shown
superiority over other approaches such as drugs, antibodies alone,
antibody fragments, or radiolabeled immunoconjugates (reviewed in
Vallera3). Also, in in vitro studies, direct comparison showed that anti-CD3 ITs were superior to anti-CD5 ITs, more completely and rapidly internalizing than other IT.52-54 Anti-CD5 IT
has been the most widely studied IT for clinical GVHD use. Our
preclinical data20 show that anti-CD5 produced only
transient, even marginal protection in the mouse. In clinical studies,
Martin et al55 showed in 243 patients given CD5-specific
IT, significant control of GVHD in the first 5 weeks, but no long-term
effect. In an aggressive murine model of established GVHD, CD5 IT
extended survival only a few weeks, anti-CD3 IT extended it
months.18 Anti-CD3 ITs may be useful for treatment of other
diseases and are currently being studied in experimental models for the
prevention of lymphoproliferative disease56 and prevention
of organ rejection.57 Studies examining the use of
nonmitogenic CD3 antibodies58 and anti-interleukin-2 receptor alpha chain59 for GVHD therapy also show promise.
It is possible that they permit facilitated immunologic recovery, but
whether these approaches will be superior to the use of IT remains to
be determined.
In conclusion, the gene of a previously reported recombinant IT was
mutated to generate a novel bivalent IT that markedly reduced its renal
toxicity. The new divalent form of the DT390 anti-CD3sFv IT
showed an expanded therapeutic window that allowed for enhanced
anti-GVHD efficacy in a lethal model of murine GVHD. It will be
important to determine in future studies whether this modification
allows for improvement of other recombinant sFv ITs in other disease models.
| |
Acknowledgments |
We thank Dr S. Ramakrishnan for their helpful comments and John
Hermanson and Kim Laffoon for expert technical assistance.
| |
Footnotes |
Submitted October 22, 1999; accepted March 30, 2000.
Supported in part by US Public Health Service Grants
RO1-CA36725 and AI34495 awarded by the NCI and the NIAID, DHHS, by DOE grant DE-FG02-96ER62181, and by the Children's Cancer Research Fund
and the Minnesota Medical Foundation.
Reprints: Daniel A. Vallera, Box 367 Mayo Building,
Harvard St at East River Rd, Minneapolis, MN 55455; email:
valle001{at}tc.umn.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Waldmann H, Cobbold S, Hale G.
What can be done to prevent graft versus host disease?
Curr Opin Immunol.
1994;6:777-783[Medline]
[Order article via Infotrieve].
2.
Bron D.
Graft-versus-host-disease.
Curr Opin Oncol.
1994;6:358-364[Medline]
[Order article via Infotrieve].
3.
Vallera DA.
Targeting T-cells for GVHD therapy.
Semin Cancer Biol.
1996;7:57-64[Medline]
[Order article via Infotrieve].
4.
Blazar BR, Taylor PA, Vallera DA.
In vivo or in vitro anti-CD3 chain monoclonal antibody therapy for the prevention of lethal murine graft-versus-host disease across the major histocompatibility barrier in mice.
J Immunol.
1994;152:36653674.
5.
Hirsch R, Gress RE, Plutnik DH, Eckhaus M, Bluestone JA.
Effects of in vivo administration of anti-CD3 monoclonal antibody on T-cell function in mice: in vivo activation of T-cells.
J Immunol.
1989;142:737-743[Abstract].
6.
Abramowicz D, Schandene L, Goldman M, et al.
Release of tumor necrosis factor, interleukin-2, and gamma-interferon in serum after injection of OKT3 monoclonal antibody in kidney transplant recipients.
Transplantation.
1989;47:606608.
7.
Blazar BR, Taylor PA, Snover DC, Bluestone JA, Vallera DA.
Non-mitogenic anti-CD3F(ab')2 fragments inhibit lethal murine graft-versus-host disease induced across the major histocompatibility barrier.
J Immunol.
1993;150:265-277[Abstract].
8.
Jost CR, Kurucz I, Jacobus CM, Titus JA, George AJT, Segal DM.
Mammalian expression and secretion of functional single-chain Fv molecules.
J Biol Chem.
1994;269:26267-26273[Abstract/Free Full Text].
9.
Huston JS, Levinson D, Mudgett-Hunter M, et al.
Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in E coli.
Proc Natl Acad Sci U S A.
1988;85:5879-5883[Abstract/Free Full Text].
10.
Milenic DE, Yokota T, Filpula DR, et al.
Construction, binding properties, metabolism, and tumor targeting of a single-chain Fv derived from the pancarcinoma monoclonal antibody CC49.
Cancer Res.
1991;51:6363-6371.
11.
Yokota T, Milenic DE, Whitlow M, Schlom J.
Rapid tumor penetration of a single-chain Fv and comparison with other immunoglobulin forms.
Cancer Res.
1992;52:3402-3408[Abstract/Free Full Text].
12.
Adams GP, McCartney JE, Tai MS, et al.
Highly specific in vivo tumor targeting by monovalent and divalent forms of 741F8 anti-c-erb B-2 single-chain Fv.
Cancer Res.
1993;53:4026-4034[Abstract/Free Full Text].
13.
Yamaizumi M, Mekada E, Uchida T, Okada Y.
One molecule of diphtheria toxin fragment A introduced into a cell can kill the cell.
Cell.
1978;15:245-250[Medline]
[Order article via |
Top
Abstract
Introduction