|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 96 No. 3 (August 1), 2000:
pp. 894-901
GENE THERAPY
Inactivation of a GFP retrovirus occurs at multiple levels in
long-term repopulating stem cells and their differentiated progeny
Christopher A. Klug,
Samuel Cheshier, and
Irving
L. Weissman
From the Department of Pathology and Developmental Biology, Stanford
University Medical Center, Stanford, CA.
 |
Abstract |
Hematopoietic stem cell gene therapy holds promise for the treatment
of many hematologic disorders. One major variable that has limited the
overall success of gene therapy to date is the lack of sustained gene
expression from viral vectors in transduced stem cell populations. To
understand the basis for reduced gene expression at a single-cell
level, we have used a murine retroviral vector, MFG, that expresses the
green fluorescent protein (GFP) to transduce purified populations of
long-term self-renewing hematopoietic stem cells (LT-HSC) isolated
using the fluorescence-activated cell sorter. Limiting dilution
reconstitution of lethally irradiated recipient mice with 100%
transduced, GFP+ LT-HSC showed that silencing of gene
expression occurred rapidly in most integration events at the LT-HSC
level, irrespective of the initial levels of GFP expression. When
inactivation occurred at the LT-HSC level, there was no GFP expression
in any hematopoietic lineage clonally derived from silenced LT-HSC.
Inactivation downstream of LT-HSC that stably expressed GFP
in long-term reconstituted animals was restricted primarily to lymphoid cells. These observations suggest at least 2 distinct mechanisms of silencing retrovirally expressed genes in hematopoietic cells.
(Blood. 2000;96:894-901)
© 2000 by The American Society of Hematology.
 |
Introduction |
Studies in mice over the last 15 years have shown that
pluripotential hematopoietic stem cells can be transduced with
retroviral vectors, thus establishing the experimental basis for
current gene therapy approaches in humans.1-3 To date, the
translation of experiments done in mice to larger animal models has
largely been unsuccessful, which has highlighted the need for more
basic research in the area of stem cell biology and in the development of better gene delivery systems.4 The poor success of gene therapy could be attributed to a number of factors, including the
refractory nature of human stem cells to retroviral
transduction,5-7 inefficient "seeding" of cells
following adoptive transfer to nonmyeloablated recipients, or the lack
of sustained gene expression from viral vectors.
The long-term maintenance of gene expression following bone marrow
reconstitution has frequently been evaluated in a nonquantitative manner. In mice, a number of reports document both the
maintenance8-11 and the lack of sustained gene
expression12-14 from murine retroviral vectors.
Complicating the interpretation of these results are differences in
vector design and the cell population being assayed for expression
(day-12 colony-forming units-spleen cells [CFU-S], in vitro
colonies, peripheral blood of reconstituted animals), the time
posttransduction when the assay was performed, and the means of
determining expression (bulk-cell polymerase chain reaction [PCR],
enzymatic assays, or fluorescence-activated cell sorter [FACS]-selectable markers). A perceived loss of expression may also
have to do with the limited half-life of all hematopoietic progenitors and differentiated progeny that are derived from long-term self-renewing hematopoietic stem cells (LT-HSC). Transduction of more
short-lived multipotential progenitors, typified by most day-12
CFU-S-forming cells or transiently reconstituting multipotent stem
cells,15 would be evidenced by sustained expression
for up to about 2 to 3 months, followed by a loss in
retrovirus-positive, short-lived cells.
To address the issue of gene expression from retroviral vectors in
LT-HSC, we have used a murine retrovirus expressing the green
fluorescent protein (MFG-GFP) to transduce a purified population of
LT-HSC isolated by FACS. The MFG retroviral backbone was chosen because
previous studies showed that MFG-derived vectors generate high-titer
virus and can result in significant long terminal repeat (LTR)-driven gene expression in reconstituted
animals.11,16,17 Transduction of purified LT-HSC followed
by transplantation of transduced cells at or near limiting dilution
allowed us to quantitatively determine the percentage of
donor stem cells that sustain retroviral gene expression in the
reconstituted animal. This approach eliminates the "noise"
associated with transplantation of transduced whole bone
marrow cells and greatly facilitates analysis of factors that may
influence gene expression from retroviral vectors.
 |
Materials and methods |
Generation of retrovirus
MFG-GFP retrovirus was produced by transient transfection of the
retroviral packaging cell line, BOSC 23,18 by calcium
phosphate coprecipitation. BOSC cells were seeded on 6-cm dishes at a
density of 2 × 106 cells per dish the day before
transfection. Ten minutes prior to transfection, the media was changed
to Dulbecco's modified Eagle's medium (DMEM) supplemented with
50-µM chloroquine diphosphate. A total of 8 to 10 µg of DNA was
used per transfection. Following the addition of DNA-calcium phosphate
precipitate, plates were incubated for 8 hours in a carbon dioxide
incubator at 37°C, the media were aspirated, and fresh DMEM was
gently added to the dishes. After an additional 16 hours, the media
were changed and the cells were then gently overlaid with a minimal
amount of media (2 mL) to collect virus. Viral supernatant was
collected after 24 hours and then centrifuged at 1200 rpm for 5 minutes
at 4°C to pellet any packaging cells. Supernatants were then
collected, aliquoted, and frozen. Titering was done using NIH
3T3 cells seeded on 6-cm dishes at 5 × 105 cells
per dish the day before transduction. Typical titers ranged between 1 × 106 to 2 × 106
IU/mL.
Isolation of hematopoietic stem cells
Bone marrow cells were obtained by flushing the tibias and femurs
with Hank's balanced salt solution (Gibco BRL, Grand Island, NY)
supplemented with 2% donor bovine serum (staining media). Collected
cells were stained with a cocktail of rat monoclonal antibodies to
antigens present on the surface of mature blood cell lineages: 6B2
(anti-B220), M1/70 (anti-Mac-1), 8C5 (anti-Gr-1), Ter-119
(anti-erythrocyte-specific antigen), KT31.1 (anti-CD3), 53-7.3 (anti-CD5), GK1.5 (anti-CD4), and 53-6.7 (anti-CD8). Stained cells were
washed with staining media and then incubated with goat antirat
phycoerythrin (PE). After washing, free sites on the antirat antibodies
were blocked using normal rat serum or rat immunoglobulin G (1 µg/mL
in phosphate-buffered saline). Stained cells were washed then incubated
with biotinylated E13-161-7 (anti-Sca-1), fluorescein
isothiocyanate-conjugated 19XE5 (anti-Thy-1.1), and allophycocyanin
(APC)-conjugated 2B8 (anti-c-kit). Washed cells were then incubated
with streptavidin microbeads (Miltenyi Biotec, Auburn, CA) for 10 minutes, followed by incubation with avidin-Texas Red (Caltag,
Burlingame, CA) for an additional 10 minutes. Sca-1+ cells
were enriched by running the sample through a mini-MACS column
(Miltenyi Biotec) and eluting the magnetic fraction according to the
manufacturer's instructions. All cell sorts were done using a dual
laser flow cytometer in the shared FACS facility at Stanford University. Dead cells were excluded by gating out
propidium-iodide positive cells. The LT-HSC phenotype was sorted
as
Sca-1+Lin Thy-1.1loc-kit+.
Hematopoietic stem cell transduction and bone marrow
reconstitution
Sorted stem cells were incubated in 200 µL of DMEM (Gibco BRL,
high glucose) supplemented with 10% fetal calf serum (tested for
growth of embryonic stem cells, Gibco BRL), sodium pyruvate, nonessential amino acids, and penicillin-streptomycin in a 96-well plate. The media also contained interleukin-6 (5 ng/mL), Steel factor
(50 ng/mL), and 1 × leukemia inhibitory factor
(ESGRO, Gibco BRL). Incubation with cytokines was carried out for 24 to 28 hours to induce stem cell cycling, after which time 150 µL of the
media was removed and replaced with 125 µL of viral supernatant, 4 µg/mL of polybrene, fresh cytokines, and media to 150 µL.
Infections proceeded for 20 to 24 hours before the cells were washed
and resorted for GFP expression using the FACS. C57BL/J (Ly-5.1,
Thy-1.2) mice were used as recipients for long-term reconstitution
assays. Mice were irradiated with 920 rad given in a split dose
separated by 3 hours. Cells were injected retroorbitally into
anesthetized (Metofane) mice that were maintained on antibiotics
(neomycin sulfate and polymyxin B sulfate) at least 1 month following reconstitution.
PCR of GFP provirus in single cells
Single cells from gated populations were sorted directly into PCR
buffer (supplied by Boehringer Mannheim; final concentration: 1.5-mM
MgCl2, 50-mM Tris [pH 8.3], 50-mM KCl) supplemented with 0.5% Triton X-100. Two rounds of nested PCR (30 cycles each) were done
using the outside and inside primer sets listed below. Cycle conditions
were 94°C for 1 minute, 55°C for 1 minute, and 72°C for 30 seconds. Five percent of the first-round reaction was used in
second-round PCR as template. Amplified products were resolved on
agarose gels and then blotted for Southern analysis using an internal,
random-primed GFP probe. All primers are written in 5' to
3' orientation. Outside primer set: ATGAGTAAAGGAGAAGAACTTTTC; ATGGCGTTACTTAAGCTAGC; inside primer set: CTGTCAGTGGAG- AGGGTGAA; TTTGTATAGTTCATCCATGCC.
Day 8, CFU-S assay
Bone marrow was isolated from primary transplant recipients and then
counted using Türk's solution. A total of 50 000
nucleated cells were retroorbitally injected into lethally irradiated
congenic mice. After 8 days, spleens were isolated from reconstituted
animals, and individual nodules were microdissected and placed in a
proteinase K lysis solution for overnight digestion. Genomic DNA was
purified, cut with BamHI, and then run on a gel for Southern
analysis using a random-primed (Pharmacia kit, Piscataway, NJ) GFP
probe that encompassed the entire GFP cDNA (a unique BamHI site
is located just 3' of the GFP coding sequences in
MFG-GFP).
 |
Results |
Repopulating potential of LT-HSC transduced with MFG-GFP retroviral
supernatants
In a recent study, we optimized conditions for the transduction of
FACS-sorted, LT-HSC using retroviral supernatants ("Materials and
methods"; Klug et al, submitted). Retroviral
transduction of FACS-purified LT-HSC ensures a high multiplicity of
infection (between 10 and 50) and minimizes potentially oncogenic
integration events into more differentiated hematopoietic cells that
have little utility in reconstitution assays. Transduced LT-HSC were marked by both an allelic marker, Ly-5.2, and the GFP reporter gene.
Inclusion of the GFP gene in the vector allowed us to perform the
repopulation assays using a pure population of transduced cells that
were resorted for GFP expression 20 to 24 hours posttransduction (Figure 1).

View larger version (34K):
[in this window]
[in a new window]
| Fig 1.
Competitive repopulation assay using GFP+,
Ly-5.2+ LT-HSC, and recipient whole bone marrow cells.
Increasing numbers of transduced (GFP+), donor LT-HSC
(Ly-5.2+) were mixed with 2 × 105
nucleated bone marrow cells of the recipient type
(Ly-5.1+). The recipient cells would statistically contain
20 LT-HSC, only 2 of which would home to bone marrow and contribute to
the host-derived hematopoiesis that is seen in each reconstituted
animal. Numbers in the upper right quadrant of each FACS plot represent
the percentage of donor cells in peripheral blood of the recipient
animal.
|
|
To address whether the in vitro transduction conditions had altered the
functional phenotype of transduced LT-HSC, a limit dilution dose of
transduced (GFP+) cells in reconstitution of lethally
irradiated (Ly-5.1+) recipient mice was established.
Titration of input GFP+ stem cells showed that as few as 30 cells were sufficient to detect donor-derived peripheral blood cells of
both lymphoid and myeloid origin for more than 5 months following
reconstitution (Figure 1). The normal limit dilution dose for
FACS-sorted LT-HSC freshly isolated from bone marrow is approximately
10 cells.15 Other studies have shown that actively dividing
HSC reconstitute at lower efficiencies,19,20 which
indicates that there was little loss of LT-HSC activity during the in
vitro transduction procedure. Figure 1 shows data from all
reconstituted animals used in the experiment for 30, 60, and 120 cells.
Significantly, at all cell doses tested, there was an almost complete
absence of donor-derived cells that remained GFP+. In an
independent experiment, 2 of 3 animals were donor-reconstituted with 30 GFP+ cells at 26 weeks, although the percentage of donor
hematopoiesis was only about 1% in the competitive assay (data not
shown). A total of 3 of 3 mice were donor-reconstituted using 60 GFP+ cells, with a mean donor reconstitution of 27%. In
all experiments, the percentage of donor-derived peripheral blood cells
increased with the increase in number of injected donor stem cells
(Figure 1), consistent with data that virtually all LT-HSC contribute over time to hematopoiesis.21,22 Strikingly, in almost
every case, there was an almost complete absence of
Ly-5.2+/GFP+ cells when low numbers of
transduced cells were transplanted. The limit dilution dose for
Ly-5.2+/GFP+ cells that persisted beyond 6 months post-reconstitution was approximately 300 input cells.
The lack of Ly-5.2+/GFP+ cells is not
due to deletion of the provirus
To test whether the lack of Ly-5.2+/GFP+
peripheral blood cells was due to loss of the provirus or to silencing
of retroviral gene expression, single-cell PCR was done using cells
isolated from peripheral blood of animals reconstituted for 4 months.
Single cells were sorted from Ly-5.2+/GFP+,
Ly-5.2+/GFP , and
Ly-5.2 /GFP populations (Figure
2). Two rounds of PCR were done using
nested primers that hybridize to GFP coding sequences. Products were resolved on a gel and then blotted for Southern analysis using an
internal GFP probe. Virtually all donor-derived cells contained at
least one copy of an integrated provirus (populations A, B, and D)
whereas host-derived (Ly-5.1+) cells (population C) showed
no evidence of a retrovirus even after prolonged exposures of the
Southern blot. A repeat experiment with an additional reconstituted
mouse showed 9 of 10 positive PCR reactions for both populations A and
B, respectively, and 0 of 8 positive for population C (data not shown).
In addition, 16 of 16 long-term reconstituted mice were positive for
the presence of an intact provirus based on DNA Southern blotting of
purified B, T, and myeloid cell populations, irrespective of the
presence of Ly-5.2+/GFP+ cells (for example,
see Figure 10 below). This indicates that the lack of GFP expression in
donor-derived peripheral blood cells is due to transcriptional or
translational silencing and that the silencing mechanism acts at early
times post-reconstitution, usually within the first 6 weeks (Figures 1
and 5). Proviral integrants that were not silenced early continued to
express GFP in a significant fraction of Ly-5.2+
(donor-derived) peripheral blood cell populations for at least 6 to 10 months post-reconstitution (Figure 3). This
was seen in 13 of 13 animals. There was never evidence of complete
inactivation of expression at later time points in any reconstituted
animal.

View larger version (31K):
[in this window]
[in a new window]
| Fig 2.
Donor-derived cells in long-term reconstituted animals
contain integrated provirus.
Single, Ly-5.2+ peripheral blood cells were isolated from
animals reconstituted for 4 months and assayed for the presence of an
integrated provirus using nested PCR. Single cells would predominantly
be B, T, and myeloid cell types, which represent the major, circulating
Ly-5.2+ cell populations.
|
|

View larger version (58K):
[in this window]
[in a new window]
| Fig 3.
Sustained expression of the GFP reporter gene in
long-term reconstituted mice.
Peripheral blood of 4 long-term reconstituted animals from 2 independent experiments was assayed at the indicated time points for
the persistence of GFP expression over 5 to 6 months. A total of 13 of
13 animals showed sustained long-term expression with little change
in the percentage of GFP-expressing cells. The number of transplanted,
GFP+ donor cells per animal are indicated. All donor cells
were mixed with 2 × 105 recipient-type (Ly-5.1)
marrow cells prior to transplantation.
|
|
Secondary bone marrow transfer into irradiated recipient mice never
resulted in reexpression of a silenced GFP reporter gene in a total of
15 animals examined although, in some cases, silencing of stably
expressing proviruses may have occurred (Figure
4, secondary recipients from mouse 9). It
remains possible that GFP+ stem cell clones were not
represented at a high enough frequency in the bone marrow inoculum used
for secondary transplantation, so that apparent "silencing" in
secondary recipients was really due to a lack of reconstitution by
GFP+ stem cells. A limit dilution dose of whole bone marrow
cells is approximately 1 × 105 to
2 × 105 cells, which indicates that a significant
amount of self-renewal had to have occurred in stem cells that
contributed to primary reconstitution of mouse 9.

View larger version (45K):
[in this window]
[in a new window]
| Fig 4.
Expression patterns seen in primary transplant recipients
are generally maintained in long-term reconstituted secondary
transplant recipients.
Increasing numbers of whole bone marrow cells from long-term
reconstituted primary recipient mice were transplanted into lethally
irradiated secondary recipients of the Ly-5.1 genotype. Peripheral
blood was analyzed from 3 animals representing mouse 7/11 and 5 animals
from mouse 9.
|
|
Silencing is independent of initial levels of GFP expression
We next tested whether sites of retroviral integration that allowed
for high-level GFP expression in LT-HSC might be predictive of
integrants that would be buffered from inactivation. Immediately following in vitro transduction, cells that expressed low or extremely high levels of GFP were sorted for reconstitution into lethally irradiated recipient mice (Figure 5). A
total of 350 GFP+ LT-HSC were injected into each
reconstituted animal. Peripheral blood analysis showed that silencing
occurred in both groups of animals regardless of the initial level of
GFP expression in LT-HSC. Integrants that sustained expression could be
found among animals that received low or high GFP-expressing cells.

View larger version (38K):
[in this window]
[in a new window]
| Fig 5.
Maintenance of gene expression is not predictable based
on initial levels of GFP expression.
Recipient animals were reconstituted with 350 GFP+, LT-HSC
that initially expressed either low (2 animals) or high levels (3 animals) of GFP 24 hours after stem cell transduction. Peripheral
blood was analyzed at 3.5 weeks and 11.5 weeks
post-reconstitution.
|
|
GFP expression is silenced in lymphoid progeny that differentiate
from GFP+ LT-HSC
To begin addressing the mechanisms for inactivation of GFP
expression, stem cells were isolated from bone marrow of animals that
had been reconstituted for more than 10 months. In one animal (L1, the
first mouse in the GFP/low group from Figure 5), where the percentage
of donor-derived GFP+ cells to donor-derived
GFP cells (about 50%) was similar in blood and
unfractionated bone marrow, donor-derived stem cells
(Ly-5.2+Sca-1+Lin c-kit+)
were almost entirely GFP+ (Figure
6). The LT-HSC surface phenotype in
long-term reconstituted primary recipients is similar to that found in
normal (unreconstituted) bone marrow.23 In the absence of
Thy-1.1 staining, this population is approximately 50% pure for LT-HSC
activity. Thy-1.1 staining could not be done because of an inability to
do 6-color analysis with the antibody combination used. In a second
animal (L2, second animal in the low group from Figure 5), which had a
very low percentage of GFP+ cells remaining in bone marrow
10 months after reconstitution, about 50% of the cells within stem
cell gates were GFP+ (Figure 6). Given that approximately
50% of the cells within these gates are non-stem cells in the absence
of Thy-1.1 staining, there could well be a similar majority of LT-HSC
that remain GFP+ long after the primary reconstitution.

View larger version (37K):
[in this window]
[in a new window]
| Fig 6.
LT-HSC remain GFP+ in significantly higher
proportion than developing bone marrow cells.
Two mice reconstituted for 10 months were analyzed for GFP expression
in developing bone marrow cells and within the hematopoietic stem cell
population using 5-color FACS analysis. Cells were stained for the
donor marker (Ly-5.2, allophycocyanin), lineage markers (Cy5-PE), c-kit
(PE), Sca-1 (Texas Red), and GFP (fluorescence in the fluorescein
isothiocyanate channel). The numbers in parentheses indicate gating of
lineage-marker negative-to-low cells according to the numeric scale
given on the top of the lineage-marker histogram. Donor-derived, LT-HSC
will be present at high purity in the Ly-5.2+,
Sca-1+, c-kit+, Lin (0-80) gated population.
The entire hematopoietic stem cell pool, which includes short-term
reconstituting stem cells, will be present in the Lin (0-100)
fraction.
|
|
Southern blot analysis of purified B cells (B220+ cells
from spleen), myeloid cells (Gr-1 and Mac-1+ cells from
spleen), and developing T cells (whole thymus) from mouse L1 showed
that there were 2 independent retroviral integrants that contributed
most of the hematopoiesis seen in the bone marrow and peripheral
lymphoid tissues (Figure 7). To determine
whether 2 proviral integration events occurred in the same stem cell or in 2 independent stem cell clones, DNA from day 8 CFU-S was isolated following secondary transplantation of 50 000 nucleated bone marrow cells from long-term reconstituted mouse L1. Clonal analysis indicated that 2 independent stem cell clones (both of which remained
GFP+, Figure 6) were responsible for most of the
hematopoiesis seen in DNA samples isolated from mouse L1 and that other
stem cells were also contributing to hematopoiesis at 10 months
post-reconstitution at very low levels (samples 1 and 8). These rare
clones can be seen in longer exposures of the Southern blot in the B,
T, and myeloid cell lanes (data not shown).

View larger version (35K):
[in this window]
[in a new window]
| Fig 7.
Two independent LT-HSC clones contribute most of the
hematopoiesis seen in mouse L1.
A portion of the bone marrow used for FACS analysis shown in Figure 6
was used to inject secondary lethally irradiated mice for day-8 CFU-S.
A total of 50 000 nucleated bone marrow cells were used per injection.
Macroscopic spleen colonies were individually dissected 8 days
post-reconstitution, and then genomic DNA isolated from each colony was
used in Southern analysis to determine each proviral integration site.
Whole B, T, and myeloid cell samples were obtained by positive magnetic
bead selection (Miltenyi Biotech) using single cell suspensions of
spleen (B and myeloid cells) and thymus (T cells).
|
|
Even though the 2 major stem cell clones have remained GFP+
(Figure 6), a significant percentage (31.6%) of donor-derived
hematopoiesis is GFP within the bone marrow of mouse
L1. This suggests that silencing occurs early in the development of
cell lineages that mature in bone marrow, which would primarily be
erythrocytes, progenitor B cells, and myeloid cells. FACS analysis of
donor-derived cells within bone marrow of mouse L1 (Figure
8) shows that no inactivation occurred as
LT-HSC differentiated into cells of the erythroid (Ter-119) or myeloid
lineages (Mac-1 or Gr-1). Inactivation was only seen in progenitor B
cells (B220+), T cells (CD3+), and natural
killer cells (NK-1.1+). Notably, a small percentage of each
of these populations remained GFP+. The data suggest that
silencing can occur at a very early stage in lymphoid cell development,
perhaps before the acquisition of B220 surface expression on progenitor
B cells. Although we have no data for the number of stem cell clones
contributing to hematopoiesis in mouse L2, there was clearly a large
change in the ratio of GFP+ to GFP cells
within stem cell gates (Figure 6) versus whole bone marrow. This
difference within bone marrow of mouse L2 indicates that inactivation
can also occur as LT-HSC differentiate into myeloid cells, although it
appears to be much less frequent than inactivation in lymphoid cells.
Analysis of another independent animal reconstituted with 300 GFP+
LT-HSC for 6.5 months showed a very similar GFP expression
pattern in the peripheral blood cell lineages (compare GFP expression in myeloid and lymphoid cells at 26 weeks, Figure
9). The molarity of the Southern blot bands
indicates that at least 4 to 5 independent stem cell clones were
contributing all of the hematopoiesis in the animal. This animal was
nearly 100% GFP+ in the myeloid lineages, yet showed
significant inactivation in peripheral B- and T-cell populations. This
is in agreement with in vitro data showing that single GFP+
LT-HSC sorted into 7-factor methylcellulose culture conditions favoring
myeloid cell development do not inactivate GFP expression over the
10-day time of culture (Samuel Cheshier and Irving L. Weissman, data not shown).

View larger version (38K):
[in this window]
[in a new window]
| Fig 8.
Inactivation of GFP expression occurs primarily as stem
cells differentiate into lymphoid cell populations.
Bone marrow cells were stained with antibodies directed against markers
that define specific blood cell lineages, including B cells (B220),
monocytes and neutrophils (Mac-1 and Gr-1), primitive erythrocytes
(Ter-119), natural killer cells (NK-1.1), and T cells (CD3). Contour
plots showing mature lineage marker expression are gated for all
donor-derived (Ly-5.2) cells.
|
|

View larger version (40K):
[in this window]
[in a new window]
| Fig 9.
GFP expression is largely maintained during myeloid
differentiation from stem cells.
T, myeloid, and B cells were isolated from the bone marrow and spleen
of a mouse reconstituted for 26 weeks using positive selection with
magnetic beads. The molarity of the Southern bands indicates that at
least 5 independent stem cell clones contribute most of the
hematopoiesis in the animal (arrows a-e). The purity of column-enriched
cells was generally 80% to 95% based on reanalysis of enriched cells.
Nearly all donor-derived myeloid cells (monocytes and neutrophils) were
GFP+ in the long-term reconstituted animal.
|
|
Silencing can occur at the level of the LT-HSC
The previous observations show that inactivation of
retroviral-mediated gene expression can occur as LT-HSC commit to
differentiate along lymphoid cell pathways in vivo. However, a very
significant number of all proviral integration events that initially
express GFP (which permits resorting of cells following retroviral
transduction) go on to inactivate expression from the integrated
provirus (Figure 1). To assess whether LT-HSC remained GFP+
in animals with no sustained GFP expression in peripheral blood, we
analyzed stem cells in a GFP , long-term
reconstituted recipient that was highly donor-reconstituted (Figure
10). Even though 46% of bone marrow was
donor-derived, no GFP+ LT-HSC was detected in bone marrow.
Based on Southern blot analysis, one major stem cell clone was
contributing almost all of the donor blood cells in the primary
transplant recipient (Figure 11). This indicates that inactivation occurring at the LT-HSC level is maintained in myeloid cell progeny that normally have the potential to express genes from the MFG vector (Figures 8 and 9).

View larger version (24K):
[in this window]
[in a new window]
| Fig 10.
Silencing occurs at the LT-HSC level.
LT-HSC were analyzed in an animal that showed no evidence of sustained
GFP expression after long-term reconstitution even though the animal
was highly donor-reconstituted. Donor hematopoietic stem cells were
analyzed for being Ly-5.2+ (APC), Sca-1+ (Texas
Red), lineage marker-negative (Cy5-PE), c-kit+ (PE), and
GFP+ or GFP .
|
|

View larger version (83K):
[in this window]
[in a new window]
| Fig 11.
Donor (Ly-5.2+) bone marrow cells contain
integrated provirus based on Southern analysis.
Clonal assays to determine the number of proviral integrants per cell
were done on isolated day 8 CFU-S colonies and from single stem cells
FACS-sorted onto a stromal feeder layer (AC-6) that supports cell
growth and expansion so that sufficient amounts of DNA could be
isolated for analysis. B, T, and myeloid cell populations were purified
by magnetic bead enrichment as described previously. The Southern blot
was probed with a randomly primed GFP fragment.
|
|
 |
Discussion |
The studies reported here illustrate at least 2 levels of control
that determine the active state of gene expression from the MFG
retroviral vector in hematopoietic cells. Transplantation of limited
numbers of transduced GFP+ stem cells shows that most
retroviral integrants are silenced within the first 6 weeks following
reconstitution (Figure 1). Silencing at the LT-HSC level may be much
more rapid than 6 weeks due to the half-life of differentiated cells
that are initially GFP+ following reconstitution. Proviral
integrants that are completely silenced cease to express GFP at the
LT-HSC level (Figure 10) and do not show evidence of GFP reexpression
upon differentiation or upon transplantation into secondary irradiated
recipient animals (Figure 4).
Others have demonstrated that a mechanism for retroviral inactivation
could involve de novo methylation of viral sequences leading to stable
propagation of the inactive state.12,24-27 Silencing of
virally expressed genes has been observed in primary
fibroblasts28,29 and in cultured cell
lines.26,30 This points out that inactivation does not have
to correlate with differentiation but, rather, may be a consequence of
stochastic processes influenced by DNA replication. This could explain
why some integrants, which were stably expressing GFP in long-term
reconstituted primary recipients, were silenced upon secondary transfer
(Figure 4). In the context of a reconstitution, presumably all stem
cells would be stimulated to cycle rapidly in response to the
hematopoietic needs of the animal. Understanding how chromatin
conformation is reestablished following replication may shed light on
why certain proviral integrants would remain active over successive
rounds of replication while others are silenced. Silencing may occur
more slowly in LT-HSC in primary transplant recipients because of the
slower rate at which this population of cells is cycling in
vivo.21,22
The second level of gene inactivation occurs downstream of LT-HSC and
probably involves at least 2 mechanisms. In all primary transplant
recipients that continued to express GFP 8 to 10 weeks after
reconstitution (a total of 13 animals), expression remained stable for
long periods. LT-HSC in these animals had a much higher ratio of
GFP+ to GFP cells than seen in whole
bone marrow (Figure 6), with the most silencing occurring as LT-HSC
differentiate into lymphoid cells (Figure 8). The early stage at which
silencing was evident in progenitor B cells might suggest that
silencing occurs as part of chromatin remodeling that accompanies
lymphoid cell (or B cell) commitment. Assuming that retroviruses
integrate into "open" chromatin present in hematopoietic stem
cells,31-34 one consequence of differentiation along the
lymphoid cell pathway might be the shutdown of open chromatin around
stem cell genes and the emergence of new open chromatin domains that
mark the unique set of genes defining a particular lymphoid cell type.
Such a mechanism of inactivation would not be biased toward
retroviruses but, rather, would affect all DNA that preferentially
integrates into particular regions of open chromatin. The involvement
of chromatin structure in silencing is strongly suggested by
experiments that showed that completely silenced genes expressed from
an adeno-associated viral backbone could be fully reactivated using
chemical inhibitors of histone deacetylases.30
Deacetylation of histones H3 and H4 is associated with the condensed,
transcriptionally inactive state of chromatin.35
Another explanation for the lack of retroviral gene expression in most
lymphoid cells could be the absence of positively acting transcription
factors, or the presence of silencing factors, that control expression
from the retroviral LTR. This is apparently the case for peripheral T
lymphocytes, where only a few percent of GFP+ cells were
also CD3+ in all animals tested, as has been in cases
reported for human T cells.36-38 It is unlikely that this
explanation is true for developing B lymphocytes in bone marrow or in
the periphery in that some animals showed at least 50% positive
B-lineage cells at early time points following reconstitution. This
indicates that a high percentage of B cells have the potential for
expressing a gene from the retroviral promoter. Another possibility is
that lymphoid cell populations may express higher levels of de novo methylase activity than myeloid cells and are therefore more sensitive to silencing by a methylation-dependent mechanism.
Our observations are in agreement with a number of studies that
document stable expression of retrovirally driven genes in myeloid cell
populations such as day-12 CFU-S or peripheral blood monocytes and
neutrophils.10,12,13 In some cases, we suspect that
silencing would not be as readily observed in
experiments done by coculturing stem cells with retroviral producer
cells (which historically has been the most commonly used transduction approach) because of a higher number of integration events per stem
cell. Multiple integrants would mask the actual frequency of silencing
that we observe using a viral supernatant transduction protocol that,
in general, leads to single integration events (13 of 15 single
integrations based on clonal analyses). Although silencing at the
LT-HSC level might be overcome through means that promote multiple
integration events per cell, this has the disadvantage of increased
potential for oncogenic integration events in long-lived cells that
could accumulate additional mutations over time. Improvements in vector
design, like murine stem cell virus (MSCV)39 and
MND,40 may overcome the inactivation mechanism operating at the LT-HSC level that is independent of differentiation status. These vectors seem promising based on a number of recent studies,41-44 although the number of proviral integrants
per cell were not evaluated at a clonal level. In one
study,44 there were an estimated 2.5 proviral copies (using
MSCV) per haploid genome based on Southern analysis of hematopoietic
tissues from transplanted animals. If silencing did occur at
frequencies of less than 50% of all integration events, this would be
masked by the amount of provirus in each cell. Silencing at a very
early stage in the development of lymphoid cells points out the need for further experiments to understand the nature of the inactivation process in this arm of the hematopoietic system. Vectors
may need to have modifications designed to buffer integrated genes from chromatin effects or vectors that have modified LTR sequences that are
permissive for expression in lymphoid cells. This will be critical for
targeting a host of lymphoid deficiencies. Our preliminary experiments
suggest that erythroid cell progenitors that express the Ter-119
antigen will behave similar to myeloid cells with respect to
retrovirally mediated gene expression (Figure 8). Experiments
addressing sustained gene expression in megakaryocytes and in dendritic
cell populations have not yet been done.
 |
Acknowledgments |
We express our appreciation to Libuse Jerabek for laboratory
management, Veronica Braunstein for antibody preparation, Tim Knaak for
FACS operation, and Lucino Hidalgo for animal care. We also thank
Michael Anderson and members of the Weissman laboratory for helpful and stimulating discussion.
 |
Footnotes |
Submitted February 1, 1999; accepted April 4, 2000.
Supported by grants from the National Cancer Institute (CA
42551), the National Institute of Diabetes and Digestive and
Kidney Diseases (DK 54766-01), and from SyStemix/Sandoz.
Reprints: Christopher A. Klug, University of Alabama at
Birmingham, Comprehensive Cancer Center, Room 387, Birmingham, AL
35294-3300; e-mail: chris.klug{at}ccc.uab.edu.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
 |
References |
1.
Havenga M, Hoogerbrugge P, Valerio D, van Es HH.
Retroviral stem cell gene therapy.
Stem Cells.
1997;15:162-179[Abstract/Free Full Text].
2.
Mulligan RC.
The basic science of gene therapy.
Science.
1993;260:926-932[Abstract/Free Full Text].
3.
Miller AD.
Human gene therapy comes of age.
Nature.
1992;357:455-460[Medline]
[Order article via Infotrieve].
4.
Orkin SH, Motulsky AG.
Report and recommendations of the panel to assess the NIH investment in research on gene therapy. Bethesda, MD: NIH; 1995.
5.
Brenner MK, Rill DR, Holladay MS, et al.
Gene marking to determine whether autologous marrow infusion restores long-term haemopoiesis in cancer patients.
Lancet.
1993;342:1134-1137[Medline]
[Order article via Infotrieve].
6.
Dunbar CE, Cottler-Fox M, O'Shaughnessy JA, et al.
Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation.
Blood.
1995;85:3048-3057[Abstract/Free Full Text].
7.
Kohn DB, Bauer G, Rice CR, et al.
A clinical trial of retroviral-mediated transfer of a rev-responsive element decoy gene into CD34+ cells from the bone marrow of human immunodeficiency virus-1infected children.
Blood.
1999;94:368-371[Abstract/Free Full Text].
8.
Bender MA, Gelinas RE, Miller AD.
A majority of mice show long-term expression of a human -globin gene after retrovirus transfer into hematopoietic stem cells.
Mol Cell Biol.
1989;9:1426-1434[Abstract/Free Full Text].
9.
Einerhand MPW, Bakx TA, Kukler A, Valerio D.
Factors affecting the transduction of pluripotent hematopoietic stem cells: long-term expression of a human adenosine deaminase gene in mice.
Blood.
1993;81:254-263[Abstract/Free Full Text].
10.
Correll PH, Colilla S, Dave HPG, Karlsson S.
High levels of human glucocerebrosidase activity in macrophages of long-term reconstituted mice after retroviral infection of hematopoietic stem cells.
Blood.
1992;80:331-336[Abstract/Free Full Text].
11.
Ohashi T, Boggs S, Robbins P, et al.
Efficient transfer and sustained high expression of the human glucocerebrosidase gene in mice and their functional macrophages following transplantation of bone marrow transduced by a retroviral vector.
Proc Natl Acad Sci U S A.
1992;89:11332-11336[Abstract/Free Full Text].
12.
Challita P, Kohn DB.
Lack of expression from a retroviral vector after transduction of murine hematopoietic stem cells is associated with methylation in vivo.
Proc Natl Acad Sci U S A.
1994;91:2567-2571[Abstract/Free Full Text].
13.
Pawliuk R, Kay R, Lansdorp P, Humphries RK.
Selection of retrovirally transduced hematopoietic cells using CD24 as a marker of gene transfer.
Blood.
1994;84:2868-2877[Abstract/Free Full Text].
14.
Tumas DB, Spangrude GJ, Brooks DM, Williams CD, Chesebro B.
High-frequency cell surface expression of a foreign protein in murine hematopoietic stem cells using a new retroviral vector.
Blood.
1996;87:509-517[Abstract/Free Full Text].
15.
Morrison SJ, Weissman IL.
The long-term repopulating subset of hematopoietic stem cells is deterministic and isolatable by phenotype.
Immunity.
1994;1:661-673[Medline]
[Order article via Infotrieve].
16.
Dranoff G, Jaffee E, Lazenby A, et al.
Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific, and long-lasting anti-tumor immunity.
Proc Natl Acad Sci U S A.
1993;90:3539-3543[Abstract/Free Full Text].
17.
Riviere I, Brose K, Mulligan RC.
Effects of retroviral vector design on expression of human adenosine deaminase in murine bone marrow transplant recipients engrafted with genetically modified cells.
Proc Natl Acad Sci U S A.
1995;92:6733-6737[Abstract/Free Full Text].
18.
Pear WS, Nolan GP, Scott ML, Baltimore D.
Production of high-titer helper-free retroviruses by transient transfection.
Proc Natl Acad Sci U S A.
1993;90:8392-8396[Abstract/Free Full Text].
19.
Fleming WH, Alpern EJ, Uchida N, Ikuta K, Spangrude GJ, Weissman IL.
Functional heterogeneity is associated with the cell cycle status of murine hematopoietic stem cells.
J Cell Biol.
1993;122:897-902[Abstract/Free Full Text].
20.
Habibian HK, Peters SO, Hsieh CC, et al.
The fluctuating phenotype of the lymphohematopoietic stem cell with cell cycle transit.
J Exp Med.
1998;188:393-398[Abstract/Free Full Text].
21.
Bradford GB, Williams B, Rossi R, Bertoncello I.
Quiescence, cycling, and turnover in the primitive hematopoietic stem cell compartment.
Exp Hematol.
1997;25:445-453[Medline]
[Order article via Infotrieve].
22.
Cheshier SH, Morrison SJ, Liao X, Weissman IL.
In vivo proliferation and cell cycle kinetics of long-term self-renewing hematopoietic stem cells.
Proc Natl Acad Sci U S A.
1999;96:3120-3125[Abstract/Free Full Text].
23.
Morrison SJ, Wandycz AM, Hemmati HD, Wright DE, Weissman IL.
Identification of a lineage of multipotent hematopoietic progenitors.
Development.
1997;124:1929-1939[Abstract].
24.
Stewart CL, Stuhlmann H, Jahner D, Jaenisch R.
De novo methylation, expression, and infectivity of retroviral genomes introduced into embryonal carcinoma cells.
Proc Natl Acad Sci U S A.
1982;79:4098-4102[Abstract/Free Full Text].
25.
Jahner D, Stuhlmann H, Stewart CL, et al.
De novo methylation and expression of retroviral genomes during mouse embryogenesis.
Nature.
1982;298:623-628[Medline]
[Order article via Infotrieve].
26.
Hoeben RC, Migchielsen AAJ, van der Jagt RCM, van Ormondt H, van der Eb AJ.
Inactivation of the Moloney murine leukemia virus long terminal repeat in murine fibroblast cell lines is associated with methylation and dependent on its chromosomal position.
J Virol.
1991;65:904-912[Abstract/Free Full Text].
27.
Yoder JA, Walsh CP, Bestor TH.
Cytosine methylation and the ecology of intragenomic parasites.
Trends Genet.
1997;13:335-340[Medline]
[Order article via Infotrieve].
28.
Dwarki VJ, Belloni P, Nijjar T, et al.
Gene therapy for hemophilia A: production of therapeutic levels of human factor VIII in vivo in mice.
Proc Natl Acad Sci U S A.
1995;92:1023-1027[Abstract/Free Full Text].
29.
Palmer TD, Rosman GJ, Osborne WRA, Miller AD.
Genetically modified skin fibroblasts persist long after transplantation but gradually inactivate introduced genes.
Proc Natl Acad Sci U S A.
1991;88:1330-1334[Abstract/Free Full Text].
30.
Chen WY, Bailey EC, McCune SL, Dong J-Y, Townes TM.
Reactivation of silenced, virally transduced genes by inhibitors of histone deacetylase.
Proc Natl Acad Sci U S A.
1997;94:5798-5803[Abstract/Free Full Text].
31.
Vijaya S, Steffen DL, Robinson HL.
Acceptor sites for retroviral integration map near DNase I-hypersensitive sites in chromatin.
J Virol.
1986;60:683-692[Abstract/Free Full Text].
32.
Rohdewohld H, Weiher W, Reik R, Jaenisch R, Breindl M.
Retrovirus integration and chromatin structure: Moloney murine leukemia virus integration sites map near DNase I-hypersensitive sites.
J Virol.
1987;63:336-343.
33.
Scherdin U, Rhodes K, Breindl M.
Transcriptionally active genome regions are preferred integration sites for retrovirus integration.
J Virol.
1990;64:907-912[Abstract/Free Full Text].
34.
Mooslehner K, Karls U, Harbers K.
Retroviral integration sites in transgenic Mov mice frequently map in the vicinity of transcribed DNA regions.
J Virol.
1990;64:3056-3058[Abstract/Free Full Text].
35.
Grunstein M.
Histone acetylation in chromatin structure and transcription.
Nature.
1997;389:349-352[Medline]
[Order article via Infotrieve].
36.
Plavec I, Agarwal M, Ho KE, et al.
High transdominant RevM10 protein levels are required to inhibit replication in cell lines and primary T cells: implication for gene therapy of AIDS.
Gene Ther.
1997;4:128-139[Medline]
[Order article via Infotrieve].
37.
Quinn ER, Lum LG, Trevor KT.
T cell activation modulates retrovirus-mediated gene expression.
Hum Gene Ther.
1998;9:1457-1467[Medline]
[Order article via Infotrieve].
38.
Kohn DB, Hershfield MS, Carbonaro D, et al.
T lymphocytes with a normal ADA gene accumulate after transplantation of transduced autologous umbilical cord blood CD34+ cells in ADA-deficient SCID neonates.
Nat Med.
1998;4:775-780[Medline]
[Order article via Infotrieve].
39.
Hawley RG, Lieu FHL, Fong AZC, Hawley TS.
Versatile retroviral vectors for potential use in gene therapy.
Gene Ther.
1994;1:136-138[Medline]
[Order article via Infotrieve].
40.
Robbins PB, Yu X-J, Skelton DM, et al.
Increased probability of expression from modified retroviral vectors in embryonal stem cells and embryonal carcinoma cells.
J Virol.
1997;71:9466-9474[Abstract].
41.
Cheng L, Du C, Lavau C, et al.
Sustained gene expression in retrovirally transduced, engrafting human hematopoietic stem cells and their lympho-myeloid progeny.
Blood.
1998;92:83-92[Abstract/Free Full Text].
42.
Robbins PB, Skelton DC, Yu XJ, Halene S, Leonard EH, Kohn DB.
Consistent, persistent expression from modified retroviral vectors in murine hematopoietic stem cells.
Proc Natl Acad Sci U S A.
1998;95:10182-10187[Abstract/Free Full Text].
43.
Persons DA, Allay JA, Riberdy JM, et al.
Use of the green fluorescent protein as a marker to identify and track genetically modified hematopoietic cells.
Nat Med.
1998;4:1201-1204[Medline]
[Order article via Infotrieve].
44.
Pawliuk R, Eaves CJ, Humphries RK.
Sustained high-level reconstitution of the hematopoietic system by preselected hematopoietic cells expressing a transduced cell-surface antigen.
Hum Gene Ther.
1997;8:1595-1604[Medline]
[Order article via Infotrieve].

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Gonzalez-Murillo, M. L. Lozano, E. Montini, J. A. Bueren, and G. Guenechea
Unaltered repopulation properties of mouse hematopoietic stem cells transduced with lentiviral vectors
Blood,
October 15, 2008;
112(8):
3138 - 3147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Coccoris, E. Swart, M. A. de Witte, J. W. J. van Heijst, J. B. A. G. Haanen, K. Schepers, and T. N. M. Schumacher
Long-Term Functionality of TCR-Transduced T Cells In Vivo
J. Immunol.,
May 15, 2008;
180(10):
6536 - 6543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Ide, B. Gangadharan, K.-Y. Chiang, C. B. Doering, and H. T. Spencer
Hematopoietic stem-cell gene therapy of hemophilia A incorporating a porcine factor VIII transgene and nonmyeloablative conditioning regimens
Blood,
October 15, 2007;
110(8):
2855 - 2863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Wan, J. H. Pomerantz, L. J. Brunet, J.-B. Kim, Y.-F. Chou, B. M. Wu, R. Harland, H. M. Blau, and M. T. Longaker
Noggin Suppression Enhances in Vitro Osteogenesis and Accelerates in Vivo Bone Formation
J. Biol. Chem.,
September 7, 2007;
282(36):
26450 - 26459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Zhang, S. I. Thornhill, S. J. Howe, M. Ulaganathan, A. Schambach, J. Sinclair, C. Kinnon, H. B. Gaspar, M. Antoniou, and A. J. Thrasher
Lentiviral vectors containing an enhancer-less ubiquitously acting chromatin opening element (UCOE) provide highly reproducible and stable transgene expression in hematopoietic cells
Blood,
September 1, 2007;
110(5):
1448 - 1457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Yu, J. K. Alder, J. H. Chun, A. D. Friedman, S. Heimfeld, L. Cheng, and C. I. Civin
HES1 Inhibits Cycling of Hematopoietic Progenitor Cells via DNA Binding
Stem Cells,
April 1, 2006;
24(4):
876 - 888.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Lagresle-Peyrou, F. Yates, M. Malassis-Seris, C. Hue, E. Morillon, A. Garrigue, A. Liu, P. Hajdari, D. Stockholm, O. Danos, et al.
Long-term immune reconstitution in RAG-1-deficient mice treated by retroviral gene therapy: a balance between efficiency and toxicity
Blood,
January 1, 2006;
107(1):
63 - 72.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Fang, K. Hodivala-Dilke, B. D. Johnson, L. M. Du, R. O. Hynes, G. C. White II, and D. A. Wilcox
Therapeutic expression of the platelet-specific integrin, {alpha}IIb{beta}3, in a murine model for Glanzmann thrombasthenia
Blood,
October 15, 2005;
106(8):
2671 - 2679.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. M. Alajez, J. Schmielau, M. D. Alter, M. Cascio, and O. J. Finn
Therapeutic potential of a tumor-specific, MHC-unrestricted T-cell receptor expressed on effector cells of the innate and the adaptive immune system through bone marrow transduction and immune reconstitution
Blood,
June 15, 2005;
105(12):
4583 - 4589.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Anderson, Y. Wu, S. Jiang, X. Zhang, P. R. Streeter, G. J. Spangrude, D. R. Archer, and W. H. Fleming
Donor Marker Infidelity in Transgenic Hematopoietic Stem Cells
Stem Cells,
May 1, 2005;
23(5):
638 - 643.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. L. McGaha, B. Sorrentino, and J. V. Ravetch
Restoration of Tolerance in Lupus by Targeted Inhibitory Receptor Expression
Science,
January 28, 2005;
307(5709):
590 - 593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. W. Yu, R. S. Tabuchi, R. M. Kato, A. Astrakhan, S. Humblet-Baron, K. Kipp, K. Chae, W. Ellmeier, O. N. Witte, and D. J. Rawlings
Sustained correction of B-cell development and function in a murine model of X-linked agammaglobulinemia (XLA) using retroviral-mediated gene transfer
Blood,
September 1, 2004;
104(5):
1281 - 1290.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Swindle, H. G. Kim, and C. A. Klug
Mutation of CpGs in the Murine Stem Cell Virus Retroviral Vector Long Terminal Repeat Represses Silencing in Embryonic Stem Cells
J. Biol. Chem.,
January 2, 2004;
279(1):
34 - 41.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Marodon, E. Mouly, E. J. Blair, C. Frisen, F. M. Lemoine, and D. Klatzmann
Specific transgene expression in human and mouse CD4+ cells using lentiviral vectors with regulatory sequences from the CD4 gene
Blood,
May 1, 2003;
101(9):
3416 - 3423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Gough and E. W. Raines
Gene therapy of apolipoprotein E-deficient mice using a novel macrophage-specific retroviral vector
Blood,
January 15, 2003;
101(2):
485 - 491.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Edinger, Y.-A. Cao, M. R. Verneris, M. H. Bachmann, C. H. Contag, and R. S. Negrin
Revealing lymphoma growth and the efficacy of immune cell therapies using in vivo bioluminescence imaging
Blood,
January 15, 2003;
101(2):
640 - 648.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Horn, M. S. Topp, J. C. Morris, S. R. Riddell, and H.-P. Kiem
Highly efficient gene transfer into baboon marrow repopulating cells using GALV-pseudotype oncoretroviral vectors produced by human packaging cells
Blood,
December 1, 2002;
100(12):
3960 - 3967.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. H. Shah, W. B. Tabayoyong, S. Y. Kimm, S.-J. Kim, L. van Parijs, and C. Lee
Reconstitution of Lethally Irradiated Adult Mice with Dominant Negative TGF-{beta} Type II Receptor-Transduced Bone Marrow Leads to Myeloid Expansion and Inflammatory Disease
J. Immunol.,
October 1, 2002;
169(7):
3485 - 3491.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. G. de Guzman, A. J. Warren, Z. Zhang, L. Gartland, P. Erickson, H. Drabkin, S. W. Hiebert, and C. A. Klug
Hematopoietic Stem Cell Expansion and Distinct Myeloid Developmental Abnormalities in a Murine Model of the AML1-ETO Translocation
Mol. Cell. Biol.,
August 1, 2002;
22(15):
5506 - 5517.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Cui, J. Golob, E. Kelleher, Z. Ye, D. Pardoll, and L. Cheng
Targeting transgene expression to antigen-presenting cells derived from lentivirus-transduced engrafting human hematopoietic stem/progenitor cells
Blood,
January 15, 2002;
99(2):
399 - 408.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Nagano, C. J. Brinster, K. E. Orwig, B.-Y. Ryu, M. R. Avarbock, and R. L. Brinster
Transgenic mice produced by retroviral transduction of male germ-line stem cells
PNAS,
October 16, 2001;
(2001)
231473498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Neff and C. A. Blau
Pharmacologically regulated cell therapy
Blood,
May 1, 2001;
97(9):
2535 - 2540.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Hanazono, K. Terao, and K. Ozawa
Gene Transfer into Nonhuman Primate Hematopoietic Stem Cells: Implications for Gene Therapy
Stem Cells,
January 1, 2001;
19(1):
12 - 23.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Nagano, C. J. Brinster, K. E. Orwig, B.-Y. Ryu, M. R. Avarbock, and R. L. Brinster
From the Cover: Transgenic mice produced by retroviral transduction of male germ-line stem cells
PNAS,
November 6, 2001;
98(23):
13090 - 13095.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|