| |
|
|
|
|
|
|
|||
|
HEMATOPOIESIS
From INSERM U.506 and INSERM U.268, Hôpital Paul
Brousse, Villejuif, France, and INSERM U.348, Hôpital
Lariboisière, Paris, France.
The human and the murine glycoprotein platelet IIb (GPIIb)
promoters are megakaryocyte specific in human and murine cell systems, respectively. Here we show that the murine promoter is, however, highly
active when transfected in K562 human cells in which the human promoter
is almost inactive. A murine promoter, in which the enhancer element
was replaced by the human, retrieves its megakaryocytic specificity in
human cell lines. The human and murine GATA-binding sites located in
the enhancer region display slight sequence divergence next to the
consensus GATA core sequence. Gel shift experiments show that, although
the murine and the human GATA sequences both bind GATA-1, the murine
sequence alone forms an additional complex (B) not detected with the
human sequence. When the murine GATA-containing region is replaced by
the human in the context of the murine GPIIb promoter, megakaryocyte
specificity is restored in the human cell lines. A G nucleotide 3' to
GATA appears crucial because its substitution abrogates B but not
GATA-1 binding and restores megakaryocyte specificity to the murine
promoter. Conversely, substitution of the human GATA-1 binding sequence by its murine homologue that binds both GATA-1 and complex B induces an
abnormal activity for the human promoter in K562 cells. Altogether, our
data suggest that limited changes in the GATA-containing enhancer of
the GPIIb promoter can induce the recruitment of accessory proteins
that could be involved in alteration of a megakaryocyte-restricted gene
activation program.
(Blood. 2000;96:1348-1357) The mechanism by which a lineage-specific pattern
of gene expression is progressively established during hematopoietic
differentiation is still not completely understood. Recent studies have
pointed to a growing number of transcription factors relevant to the
developmental program leading to hematopoietic stem cell expansion and
lineage determination. Gene targeting inactivation of SCL/Tal-1 and
Rbtn-2 transcription factors leads to similar defects in early
hematopoietic development.1-3 Other transcription factors
are also important regulators later in the hematopoietic process. For
example, GATA-1 is expressed in erythroid, megakaryocytic, mast, and
eosinophilic cells,4-7 and a number of genes expressed in
these cells contain GATA motifs in critical cis-regulatory
elements.8,9 Gene targeting experiments of GATA-1 have led
to a developmental arrest at the proerythroblastic stage and to
apoptosis, resulting in embryonic lethality by day 11.5 of
gestation.10-14 Megakaryocytes lacking GATA-1 by a
lineage-selective knockout also arrest their maturation, but undergo
proliferation rather than apoptosis.15,16 These results
underline the critical role of GATA-1 in both megakaryocytes and
erythroid lineage and show that the same transcription factor can be
recruited for different cellular functions and may act at different
stages in different lineages.
The combinatorial association of transcription factors may account for
modulation of lineage differentiation. For example FOG, for friend of
GATA, is a cofactor for GATA-1 that was shown to be crucial for normal
erythroid and megakaryocytic differentiation.17 FOG
inactivation revealed that FOG DNA cis-acting elements of gene promoters, the targets of these
transcription factors, represent the other central actors in promoter
activity regulation. It is probably the concerted differential
engagement of cis elements according to the lineage context that
regulate the fine-tuning of transcription. For example, most of the
megakaryocytic gene promoters contain GATA and Ets binding sites, the
association of which appears to be crucial for the control of the
transcription level and cell specificity of these
genes.19-22
Among them, the gene coding for glycoprotein platelet IIb (GPIIb,
In this paper, we show that the murine GPIIb promoter sequence and
organization is very similar to that of the human. However, when placed
in a heterologous context, ie, the murine promoter in human cell lines,
the balance between the repressor and the positive elements is
deregulated. We show that the sequences adjacent to the GATA binding
site of the enhancer region bind an unknown DNA binding protein and
play an important role in this imbalance. Whether the recruitment of an
additional DNA-binding protein next to the GATA site is involved in the
alteration of the regulation of the GPIIb promoter activity is discussed.
Plasmid constructions
Site-directed mutagenesis
Cell culture HEL, K562, LIN-175, and MEL cells were grown in RPMI-1640 medium (Gibco-BRL, Gaithersburg, MD) supplemented with 10% heat-inactivated fetal calf serum (FCS; ATGC, F), 2 mmol/L glutamine, and 100 U/mL penicillin/streptomycin (Gibco-BRL). Cells were grown at 37°C in a 5% CO2 incubator. HeLa and 3T3 cells were grown in DMEM medium (Gibco-BRL) in the same conditions. Human CD34+ progenitor cells were obtained from umbilical cord blood. Mononuclear cells were obtained by centrifugation on ficoll Lymphoprep (Nycomed Pharma, Gibco-BRL) and were then enriched for CD34+ cells by a 2-round separation procedure, using the CD34 magnetic cell isolation kit MiniMacs (Miltenyi-Biotech, Paris, France) (typically to greater than 95% purity). To obtain megakaryocytic differentiation, the CD34+ cells were cultured at a density of 3.105 cells/mL in Stem (Tebu,
France), with the following recombinant human (rH) cytokines
(Preprotech Tebu, France): 50 ng/mL rH Tpo, 6 U/mL rH interleukin-3
(IL-3), 10 U/mL rH IL-6, and 4 U/mL rH IL-11, and incubated in 5%
CO2 at 37°C. The erythroid differentiation of the
CD34+ cells was performed as previously
described.33 Megakaryocytic and erythroid cultures were
harvested after 12 days. Human cell surface phenotype was determined by
flow cytometry using PerCP-conjugated antihuman CD34 (Becton Dickinson,
Mountain View, CA), fluorescein isothiocyanate (FITC)-conjugated
antihuman glycophorin A (GPA) (Immunotech, France), and
phycoerythrin (PE)-conjugated antihuman CD41 (DAKO, France) antibodies,
according to the manufacturer's instructions.
Reverse transcription and PCR amplification of RNA Total RNA was prepared from different cell lines and primary culture from CD34+ cells, using the TRIzol reagent (Gibco-BRL), according to the manufacturer's protocol.34 Reverse transcription and PCR amplification was carried out as previously described.35 Oligonucleotide primers were synthesized by Eurobio (Les Ullis, France), according to the sequence information previously described for murine GPIIbM and HPRT,35 human GPIIbH,36 and GAPDH.37DNA transfection Plasmids were isolated by alkaline lysis and purified on anion exchange columns (Jetstar Genomed, Quantum Europe, France). Nonadherent cells were transfected by the electroporation method by using a gene pulser (BioRad Laboratories, Hercules, CA), as previously described.38 Adherent HeLa and 3T3 cells were transfected by the calcium phosphate method.39 The pRSV-luciferase plasmid (Promega Biotech) was used as an internal standard expressing firefly luciferase under the control of the Rous Sarcoma virus promoter.40Luciferase and CAT assays Cells were harvested 48 hours after transfection, and cell extracts were obtained by 3 cycles of freeze and thaw lysis. Luciferase activity of the extracts was measured using the Luciferase Assay system (Promega Biotech) and a luminometer (MicroLumat LB96P, EG&G Berthold) and expressed in arbitrary units. CAT assays were performed as described elsewhere.30 The amount of protein in the extract tested was normalized as a function of the luciferase activity. Acetylation of 14[C] chloramphenicol was determined by quantification of the radioactivity on thin-layer chromatography plates by phosphoImager analysis using the Image Quant software (Molecular Dynamics, Sunnyvale, CA). CAT activity corresponds to the percentage of conversion of chloramphenicol to acetylated forms. All assays were performed within the linear range of acetylation reaction.Nuclear protein extracts Nuclear protein extracts were prepared from the following cells: HEL, K562, LIN-175, MEL, human megakaryocytes, and erythroblasts obtained from CD34+ progenitor cells differentiation, according to the rapid method of Schreiber et al.41 They were quantified according to Bradford coloration protocol (BioRad) and stored at 80°C.
DNA probes The synthetic oligonucleotides used in electrophoretic mobility shift assay (EMSA) experiments were synthesized by Eurobio (Les Ullis). One strand was 5' end-labeled with T4 polynucleotide kinase and annealed with an excess of the nonlabeled complementary strand at a 1:4 ratio. All fragments were purified from unincorporated radioelements using Quick Spin Columns (Roche Molecular Biochemicals), and radioactivity incorporation was measured by scintillation counting (Beckton Dickinson LS-1800). The hGATA oligonucleotide containing the human 463 GATA site has already been described.8 Its
sequence was ( 451) 5' AGCTGCTGCCCCCGATAAAACCTGAGG
3'( 477). The mGATA oligonucleotide sequence containing the murine
456 GATA site was ( 443) 5' AGCTGTTCTCCCCTGATAAGACCAGAGG
3'( 470). Consensus sequences for transcription factor binding sites
are underlined. Other oligonucleotides were used to correspond mGATA and hGATA sequences with mutations (bold letters). Their corresponding sequences are reported in the figures of interest. The same
oligonucleotides were used as cold competitors. The consensus
Sp1-binding site from the SV40 early promoter was used as nonspecific
cold competitor control.42
Electrophoretic mobility shift assays The gel retardation assays were performed as already described,8 by a combination of the procedures of Halligan and Desiderio43 and of Singh et al.44 For competition studies, unlabeled competitors were added to the binding reaction and nuclear extracts, 5 minutes at room temperature, according to the ratio described in each experiment, prior to the addition of radioactive probes. Rat antimouse GATA-1 monoclonal and rabbit anti-human Stat6 polyclonal antibodies were purchased from Santa Cruz Biotechnology. For gel supershift assays, 2 µg of antibodies were added to the binding reaction and nuclear extracts, 2 hours at 4°C prior to the addition of radioactive probes.Scatchard analysis and determination of dissociation constants (Kd) EMSAs were performed with increasing known concentrations of the radiolabeled probes (0.02-6 ng), incubated with constant, nonsaturating amounts of nuclear proteins (10 µg). The amount of free and bound probes formed in binding reactions were quantified by phosphoImager (Molecular Dynamics) using the Image Quant software. Scatchard plot analyses were done as described.45 The ratio between Bound and Free DNA probe (B/F) versus specific DNA-protein binding concentration [Bound] (µmol/L) was plotted, and the straight lines were drawn by fitting the data using a linear regression, with the Scatchard equation: B/F = (1/Kd) × [Bound] + Bmax/Kd, where
Kd is the apparent equilibrium dissociation constant and Bmax is the
maximal number of binding sites. The Kd value corresponds to (as the
inverse of) the affinity of the probe for its protein-binding site,
because it is equal to the probe concentration that yields half-maximal
binding of protein. The Bmax value corresponds to the maximal number
(density) of specific binding sites and thus depends on the amount of
nuclear protein extract. They were calculated according to the
Scatchard equation for each DNA/protein complexes formed.
Murine, human, and rat GPIIb promoters display strong sequence homology and conservation of cis-acting elements Alignment of the human 880/+3246 and murine
901/+32 GPIIb promoters yielded an overall identity score of 64%
(data not shown). The previously described human 598/ 406 enhancer
region displays 71% homology with the murine 588/ 396 region. As
previously reported, the 456 GATA and 505 Ets sequences are well
aligned with the 463 GATA and 515 Ets sites of the human
promoter.31 We have previously demonstrated that these
human sites bind GATA-1 and PU.1, respectively,8,47 and
are responsible for the erythro-megakaryocytic activity of the human
GPIIb enhancer.19 These sites have also been shown to be
important for the rat GPIIb promoter function.28 The
murine 174/ 74 region is 60% homologous to the human 198/ 81 region, containing a repressor element that was shown to be crucial for
megakaryocyte specificity of the human promoter.23,48 A repressor element was also described on the 183/ 70 region of the
rat GPIIb promoter.49 The 56/+32 proximal domain of the murine promoter appeared highly conserved when compared with the human
corresponding region (75% homology). This region contains the 54
GATA/ 40 Ets tandem sites, which are active in the human and the rat
promoters.8,49,50 Figure 1
illustrates the similar organization between the murine and the
human promoters.
Murine GPIIb promoter loses its megakaryocyte specificity in human cell lines The cell-specificity of the murine 899/+33 GPIIb
promoter fragment was analyzed in several cell lines (Figure
2). The
murine LIN-175 and human HEL cells were used as megakaryocytic cell
lines that express GPIIb,51 murine MEL cells display
erythroid features and do not express GPIIb,52 whereas
human K562 cells display erythro-megakaryocytic features but with low
GPIIb expression53 (Figure
4B). Murine NIH-3T3 and human HeLa cells
were used as nonhematopoietic controls. To make the results comparable
between the different cell lines, the CAT activities of the promoter
fragments were normalized by using the pBLCAT2 control vector activity
as reference, arbitrarily taken as 100%.
In murine megakaryocytic LIN-175 cells (Figure 2A), transfection
of the 899 construct yielded 252% CAT activity, suggesting that this
fragment contains all the elements essential for the transcriptional
activity of the promoter. This fragment bears the
Because of strong conservation of cis-acting elements between the murine and the human GPIIb promoters and parallel tissue-specific regulation, we asked if the murine promoter would behave in a manner similar to the human promoter in human cell lines context. The murine 899 construct was transfected in the human HEL, K562, and HeLa cells and compared with the human 813 construct (Figure 2B). In HEL cells, the murine construct yielded an activity of 195%, standing within the same range than the human promoter (360%), confirming the activity of positive elements in the enhancer region. Interestingly, the murine 899 construct was highly active in K562 cells (438%), as opposed to the almost inactive human constructs (16%) (Figure 2B).32,23 The same murine promoter fragment was much weaker in MEL cells (55%). The murine GPIIb promoter is thus deregulated in the human K562 cell context. This deregulation appears to be a specific feature of the erythro-megakaryocytic system, because, when transfected in HeLa cells, the murine 899 construct is inactive (1%). Conversely, we noted that the human 813 promoter was much more active in LIN-175 cells than in HEL cells (1640% versus 360%). However, this transcriptional activity remained megakaryocyte specific because its activity was low in mouse erythroid MEL cells and in nonhematopoietic NIH-3T3 cells, strongly suggesting that the megakaryocytic human promoter is adequately regulated in the murine context. This result contrasted with the deregulation of the murine promoter in human cell lines, which we decided to focus on. Fusion of the human enhancer to the proximal murine promoter restores megakaryocyte specificity of the murine GPIIb promoter in K562 cells Deletion analysis pointed to the 538/ 396 region as an
important regulatory element of the murine promoter (Figure 3A). Indeed the CAT activity decrease of the enhancer-deleted 396 construct, in HEL
(2-fold) and in LIN-175 cells (7-fold), suggested that the murine
538/ 396 sequence is active in human as well as in murine
megakaryocytic contexts. Of more interest, when transfected in K562
cells, the murine 396 construct was almost inactive, suggesting that,
in this cell line, the negative control of the enhancer strength is
altered. To confirm this hypothesis, we then substituted the murine
enhancer element by its human homologue (Figure 3A). The human enhancer
was inserted either in direct or reverse orientations. When transfected
in HEL or LIN-175 cells, both chimeric promoters displayed activities
comparable to that of the wild-type murine GPIIb promoter. In LIN-175
cells, addition of the human enhancer to the enhancer-less construct
induced a 4-fold increase of the CAT activity. These results confirm
that the human enhancer is functional in the murine promoter context.
Furthermore, when transfected in K562 cells, the chimeric constructs
were almost inactive, indicating restoration of promoter tissue
specificity by the human enhancer. Altogether these data suggest that
deregulation of the murine GPIIb promoter in K562 cells involved the
murine 538/ 396 enhancer region.
GATA binding site located at position 538/ 396 fragment
revealed a consensus sequence for a GATA binding site at position
456. In addition, the corresponding GATA sites of the human and rat GPIIb promoters were also shown to be potent cis-acting
elements.19,28 Consequently, this site was examined for
its potential transcriptional activity (Figure 3A). We introduced the
mutation of two nucleotides (GA/TC) on murine 456 GATA site in the
murine 899 construct (mG*). The same mutation on the hGATA site is
known to abolish its enhancer activity.19 It also induced
a decrease of the murine GPIIb promoter activity in LIN-175 cells (52%
versus 252%) and in HEL cells (20% versus 195%). This mutation
abolished the promoter activity in K562 cells (10% versus 438%),
suggesting that transcriptional activity of the murine enhancer in the
human K562 context involved the enhancer GATA sequence. The effect of
this GATA mutation was comparable to that observed after deletion of
the 538/ 396 enhancer region.
Swapping of the murine Comparative EMSAs of the human 463 or the murine 456 GATA
sites (Figure 4C). The hGATA probe was previously shown to act as a
specific binding sequence for GATA-1 protein.8 Indeed, one
single band designated as A shifted with megakaryocyte extracts and in
particular in erythroblasts known to produce high amounts of GATA-1.
The same band was also detected with the mGATA probe. In addition, a
slower migrating band designated as B and yielding a strong signal was
observed with the murine probe but was not detected with the
human probe.
By using erythroblast extracts, we showed that the A band obtained with
hGATA was supershifted by anti-GATA-1 antibodies, confirming that A
complex involves GATA-1 protein (Figure 4D). When the mGATA probe was
used, a band comigrating with A complex was detected with extracts from
HEL, K562, LIN-175, and MEL cells, but not with HeLa cell extracts,
suggesting that the murine From our results, we can hypothesize that the abnormal activity of the murine promoter in K562 cells (1) is associated with the ability of the mGATA sequence to form B complex or (2) is linked to differences in affinity of GATA-1 binding to the murine and human GATA sequences. These hypotheses are not mutually exclusive. In the next experiments, we tested these 2 possibilities. Demonstration of differential affinity of the murine 456 GATA site may have a higher affinity than the hGATA site for human GATA-1, a possible explanation for the
escape from megakaryocytic-specific restriction of the murine GPIIb
promoter in the human K562 cell line. To test this hypothesis, we
carried out EMSA experiments with cross-cold competition and Scatchard
plot analysis to determine and compare the affinity of GATA-1 for the
murine 456 and human 463 GATA sequences (Figure 5). Cold
competition experiments were performed with the labeled human probe in
the presence of an excess of either homologous or murine cold sequences
(Figure 5A). Both cold sequences competed away the band A, confirming
it corresponds to GATA-1, but competition with the murine sequence
appeared to be slightly more effective than that observed with the
human sequence. Competition was specific because it was not
observed with a 200-fold excess of SP1 sequence. Similarly, the binding
of GATA-1 to the labeled mGATA probe was competed away by an excess of
both the human and murine cold sequences (Figure 5A). When comparing
both competitors, we again observed a more effective decrease of the
band intensity with the murine competitor. These results suggest that
the murine sequence has a greater affinity for hGATA-1 than the human
sequences. Interestingly, the B band, observed only with the murine
probe, began to be competed away by a 20-fold excess of the murine
competitor and was washed off with an 100-fold excess. Moreover,
neither the hGATA-containing nor the SP1 sequences were able to compete
this B band away, even at a 200-fold excess. This finding confirms that
B interaction with the murine probe is specific, and not related
to GATA-1.
Because of the differences observed in relative DNA-binding
activity between the mGATA and the hGATA probes, we determined the
dissociation rate constants (Kd) of each probe by Scatchard plot
analysis. After separation of bound and free DNA molecules by EMSA
(Figure 5B), the amount of DNA in each band was quantified, and the
fraction of bound DNA (B/F) expressed as a function of the retarded DNA
concentration (B µmol/L) was represented on a Scatchard plot (Figure
5C). Experimental values obtained yielded 3 straight lines,
corresponding to the 3 specific DNA-protein complexes, hGATA, mGATA,
and B complex. Kd values were calculated for each complex, according to
the Scatchard equation. These Kd values were
1.75 × 10 Comparative mutational analysis of the hGATAand mGATA-core sequences We first substituted the T located 5' to the mGATA sequence by a C (mGATA*C probe, Figure 6A). We observed that GATA-1 binding was not affected by this substitution, whereas the intensity of the B complex binding decreased. Conversely, when the C located 5' to the hGATA site was substituted by a T (hGATA*T probe), GATA-1 binding remained clearly detectable, and no B complex was detected. The T nucleotide 5' to the mGATA site is thus involved in B complex interaction but is not sufficient per se.
Next we showed that cold mGATA*C probe was less effective than the wild-type mGATA probe (mGATA WT) in competing B complex away (Figure 6B). Neither the wild-type hGATA (hGATA WT) nor the hGATA*T probes were able to compete B complex away. All cold GATA probes washed the GATA-1 complex out. However, the Kd values of the complexes obtained with the mutated and wild-type probes are in the same range. This finding indicated that C/T substitution only slightly affects GATA-1 or B, protein affinity for these probes. We then introduced these mutations into the human and the murine promoters, respectively (Figure 6D). In the murine promoter, the T/C substitution slightly lowered its high promoter activity in K562 cells (307% versus 438%) but did not affect it in HEL or LIN-175 cells. The C/T substitution also slightly increased the activity of the human promoter in K562 cells and induced a 2-fold increase (360% versus 611%) in HEL cells, maybe because of increased GATA-1 binding. Finally, the C/T mutation in the human promoter induced a drop of activity in the murine LIN-175 cells when compared with the wild-type human promoter (450% versus 1640%). Taken together, our results may indicate that the slight differences in GATA-1 affinity for the GPIIb promoters as induced by the T/C substitutions may be responsible for altering promoter activity and cell specificity in K562 cells. However, because these mutations also affected B affinity, a role for B appears equally likely. Correlation between B complex interaction with GATA sequence and GPIIb promoter activity The major difference between the hGATA and the mGATA sequences is the specific interaction of B complex with the murine sequence. We thus tried to identify the nucleotides essential for this complex formation. Interestingly, the rat GPIIb promoter sequence exhibits only 3 nucleotide mismatches with the murine sequence in the GATA region (Figure 7A). Thus, we explored its DNA-binding activity by EMSA, using the rGATA probe, along with mouse and human probes (Figure 7B). Nine nucleotides upstream from the GATA sequence, the murine sequence contains a T instead of a C in the human or the rat sequences (Figure 7A). When this T was substituted by a C in the murine sequence (mGATA*1), B complex was enhanced in EMSA analysis (Figure 7B). In the next probe (mGATA*2), the T in position 6 was substituted by a G, as in the human sequence. This mutation had
no effect on both GATA-1 and B complex formation. As already observed,
the mutation of the upstream flanking nucleotide of the GATA sequence
(T/C substitution, mGATA*C) affected B complex, that was, however,
still visible. The next 2 mutations (mGATA*3 and *4) were located
inside the GATA core sequence. As expected, GATA-1 did not bind to
these sequences. These mutants were also unable to support B complex,
suggesting that GATA is part of the B binding site. Finally, in mutant
mGATA*5, the G downstream from the GATAA sequence was substituted by an
A, as in the human and the rat sequences. Interestingly, this mutant
was able to form a complex with GATA-1, whereas B complex was barely
visible. Therefore, these mutation scanning experiments show that,
although overlapping, GATA-1 and B binding sites are distinct.
The mGATA*5 mutation was then introduced in the murine GPIIb promoter (Figure 7C). This mutation, which prevents B complex formation while GATA-1 binding remains unaffected, induced an important decrease of the CAT activity in K562 cells (44% versus 438% for the murine wild-type promoter). This mutation did not affect the murine promoter activity in HEL and LIN-175 cells. Thus, the correlation between B-binding inhibition by mGATA*5 mutation and restoration of specificity of the murine GPIIb promoter in K562 strongly suggests involvement of B complex in the abnormal activity of the murine promoter in human K562 cells.
Our goal is to characterize the general features of transcriptional control by megakaryocytes. An important body of evidence on the control mechanisms of tissue-specific transcription in megakaryocytes was brought about by studies of the GPIIb promoter in human cell lines23 or in rat bone marrow primary culture.49 In particular, it was shown that, although transcription of the GPIIb gene is under the control of erythro-megakaryocytic transcription factors, its expression is restricted to megakaryocytes.23 In this paper, we confirm that the murine GPIIb promoter is also megakaryocyte specific in murine cellular context. When compared, the human and murine GPIIb promoters display an overall 64% homology, suggesting a high conservation through evolution, presumably because of highly functionally relevant sequence domains. However, they exhibit some differences as well. We thus addressed the question of whether these differences could lead to transcriptional control alterations, which could provide us with clues for a better understanding of the underlying transcription control mechanism of a megakaryocytic specific promoter. We thus checked the activity of the human promoter in murine cell context and conversely of the murine promoter in human context. When transfected in murine context, the human promoter preserved its
megakaryocytic cell specificity because it is much more active in
LIN-175 cells than in MEL or NIH-3T3 cell lines. We observed a high
activity of the human enhancer in the murine megakaryocytic context
that we have found to be linked to the human By progressive deletion analysis of the murine GPIIb promoter, we
localized an enhancer region (not shown), homologous to the
erythro-megakaryocytic human enhancer. Deletion of this enhancer from
the murine promoter led to a drop in activity in K562 to a level
comparable to the human. The same drop in activity in K562 cells was
also obtained when this murine enhancer region was replaced by its
human counterpart, whereas, in LIN-175 or HEL megakaryocytic context,
this chimeric promoter essentially behaved like the wild-type murine
promoter. These data thus confirmed the involvement of the murine
enhancer in cross-species erythroid deregulation. The activity of the
human GPIIb promoter is dependent on 2 essential GATA and Ets
elements.19,50 In the murine promoter, point mutation
disruption analysis showed that the erythro-megakaryocytic enhancer
activity was dependent on the To confirm the role of the GATA site per se in the deregulation, we
substituted the 19 nucleotide-long region centered around the murine
To compare the DNA binding activities of the murine This high activity of the mGATA sequence can either be due to a greater
affinity for GATA-1 or linked to the B complex formation. EMSA
experiments followed by Scatchard plot analysis showed that, although
standing within the same range, the human probe exhibited a 2.5-fold
higher Kd and, therefore, lower affinity for GATA-1 than the murine
probe using K562 nuclear extracts. Interestingly, the murine Another effect of the T to C substitution in the mGATA sequence was a reduction in binding affinity of the B complex. To test its potential involvement in deregulation, we identified the nucleotides necessary for B complex formation. Among several positions, the G nucleotide located two bases downstream from GATA appeared unique in that its mutation into an A (the conserved nucleotide in the non-B binding human and rat sequences) disrupted B but not GATA-1 binding. Moreover, when introduced in the murine promoter, deregulation of this promoter in K562 cells was fully corrected, without affecting activity in HEL and LIN-175 cells. This finding provides strong evidence for involvement of B complex formation in the loss of specificity of the murine promoter in K562 cells. Interestingly, K562 and HEL cells exhibit a very similar phenotype, because they both display erythrocytic and myeloid markers.53,54 Undifferentiated K562 cells also express megakaryocytic markers but at a low level. This level is, however, significantly increased when these cells are treated with phorbol esters, while simultaneously the expression of the erythroid and other myeloid markers decrease.55 In these conditions of induction, the expression of endogenous GPIIb gene and of a reporter gene driven by GPIIb promoter increases, confirming that K562 cells undergo megakaryocytic differentiation under phorbol ester treatment. Moreover, without any differentiating treatment, HEL cells express a high level of GPIIb, suggesting that these cells display more megakaryocytic features than undifferentiated K562 cells. Whether K562 cells have a more immature phenotype than HEL cells or whether they are more engaged into the erythroid lineage is not clear. In this context, the fact that the homologous murine and human GPIIb promoters behave differently in 2 very similar cell lines confirms that the transcriptional control of the megakaryocyte specific expression is tightly regulated. Our results suggest that the human and the murine promoters share canonical functional features, namely GATA-1 as a major transactivating factor. However, they also differ significantly in that they probably use different GATA-1 partners. Supporting this hypothesis is our observation that the enhancer Ets binding site shown to be crucial for the human enhancer activity47,50 was inactive in the murine enhancer (Albanese et al, unpublished data). From our experiments, it is tempting to speculate that in the case of the mouse GPIIb promoter GATA-1/B complex interactions may be an alternative to GATA-1/ETS cooperation for the human GPIIb promoter in human cell lines. FOG is another important GATA partner that has been shown to be required for both erythroid and megakaryocytic gene activation programs.17,18 Whether FOG is part of B complex remains to be assessed, as well as the molecular interplay between B complex, GATA-1, and FOG in murine and human megakaryocytes. Interestingly, although apparently not required for human GPIIb transcriptional regulation in human cell lines, B complex is present and active in these cells, suggesting that it could regulate other sets of human genes. It would thus be of interest to identify the protein(s) that is (are) included in B complex, to gain access to its (their) potential target(s) and its (their) exact role(s) in transcription machinery. B complex may be a new transcription factor because GATA-1 was the only DNA binding factor that scored significantly when data banks were searched using the B-specific TGATAAGAC sequence. Moreover, because this factor is abundantly expressed in different cell lines, it should be amenable to purification and further characterization.
We are indebted to Dr M. Poncz (Philadelphia, PA) for providing us with the rat promoter genomic sequence.
Submitted August 16, 1999; accepted April 3, 2000.
Supported by an ARC fellowship to P.A.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Georges Uzan, INSERM U. 506, Hôpital Paul BROUSSE, 14 Avenue Paul Vaillant Couturier, F-94800 Villejuif Cedex 08, France; e-mail: guzan{at}infobiogen.fr.
1. Shivdasani RA, Mayer EL, Orkin SH. Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL. Nature. 1995;373:432[Medline] [Order article via Infotrieve]. 2. Warren AJ, Colledge WH, Carlton MB, Evans MJ, Smith AJ, Rabbitts TH. The oncogenic cysteine-rich LIM domain protein rbtn2 is essential for erythroid development. Cell. 1994;78:45[Medline] [Order article via Infotrieve].
3.
Shivdasani RA, Orkin SH.
The transcriptional control of hematopoiesis.
Blood.
1996;87:4025 4. Tsai SF, Martin DI, Zon LI, D'Andrea AD, Wong GG, Orkin SH. Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells. Nature. 1989;339:446[Medline] [Order article via Infotrieve]. 5. Martin DIK, Zon L, Mutter G, Orkin SH. Expression of an erythroid transcription factor in megakaryocytic and mast lineages. Nature. 1990;344:444[Medline] [Order article via Infotrieve]. 6. Romeo PH, Prandini MH, Joulin V, et al. Megakaryocytic and erythrocytic lineages share specific transcription factors. Nature. 1990;344:447[Medline] [Order article via Infotrieve].
7.
Zon LI, Yamaguchi Y, Yee K, et al.
Expression of mRNA for the GATA-binding proteins in human eosinophils and basophils: potential role in gene transcription.
Blood.
1993;81:3234
8.
Martin F, Prandini MH, Thevenon D, Marguerie G, Uzan G.
The transcription factor GATA-1 regulates the promoter activity of the platelet glycoprotein IIb gene.
J Biol Chem.
1993;268:21606
9.
Mignotte V, Eleouet JF, Raich N, Romeo PH.
Cis- and trans-acting elements involved in the regulation of the erythroid promoter of the human porphobilinogen deaminase gene.
Proc Natl Acad Sci U S A.
1989;86:6548 10. Pevny L, Simon MC, Robertson E, et al. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature. 1991;349:257[Medline] [Order article via Infotrieve]. 11. Pevny L, Lin CS, D'Agati V, Simon MC, Orkin SH, Costantini F. Development of hematopoietic cells lacking transcription factor GATA-1. Development. 1995;121:163[Abstract].
12.
Weiss MJ, Keller G, Orkin SH.
Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 embryonic stem cells.
Genes Dev.
1994;8:1184
13.
Weiss MJ, Orkin SH.
Transcription factor GATA-1 permits survival and maturation of erythroid precursors by preventing apoptosis.
Proc Natl Acad Sci U S A.
1995;92:9623
14.
Fujiwara Y, Browne CP, Cunniff K, Goff SC, Orkin SH.
Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1.
Proc Natl Acad Sci U S A.
1996;93:12355 15. Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH. A lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development. EMBO J. 1997;16:3965[Medline] [Order article via Infotrieve].
16.
Vyas P, Ault K, Jackson CW, Orkin SH, Shivdasani RA.
Consequences of GATA-1 deficiency in megakaryocytes and platelets.
Blood.
1999;93:2867 17. Tsang AP, Visvader JE, Turner CA, et al. FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation. Cell. 1997;90:109[Medline] [Order article via Infotrieve].
18.
Tsang AP, Fujiwara Y, Hom DB, Orkin SH.
Failure of megakaryopoiesis and arrested erythropoiesis in mice lacking the GATA-1 transcriptional cofactor FOG.
Genes Dev.
1998;12:1176
19.
Prandini MH, Uzan G, Martin F, Thevenon D, Marguerie G.
Characterization of a specific erythromegakaryocytic enhancer within the glycoprotein IIb promoter.
J Biol Chem.
1992;267:10370
20.
Bastian LS, Yagi M, Chan C, Roth GJ.
Analysis of the megakaryocyte glycoprotein IX promoter identifies positive and negative regulatory domains and functional GATA and Ets sites.
J Biol Chem.
1996;271:18554
21.
Deveaux S, Filipe A, Lemarchandel V, Ghysdael J, Romeo PH, Mignotte V.
Analysis of the thrombopoietin receptor (MPL) promoter implicates GATA and Ets proteins in the coregulation of megakaryocyte-specific genes.
Blood.
1996;87:4678 22. Minami T, Tachibana K, Imanishi T, Doi T. Both Ets-1 and GATA-1 are essential for positive regulation of platelet factor 4 gene expression. Eur J Biochem. 1998;258:879[Medline] [Order article via Infotrieve].
23.
Prandini MH, Martin F, Thevenon D, Uzan G.
The tissue-specific transcriptional regulation of the megakaryocytic glycoprotein IIb gene is controlled by interactions between a repressor and positive cis-acting elements.
Blood.
1996;88:2062 24. Marguerie G, Troesch A, Frachet P, et al. Platelet GPIIb as a marker for megakaryocytopoiesis. Prog Clin Biol Res. 1990;356:55[Medline] [Order article via Infotrieve].
25.
Debili N, Coulombel L, Croisille L, et al.
Characterization of a bipotent erythro-megakaryocytic progenitor in human bone marrow.
Blood.
1996;88:1284
26.
Ody C, Vaigot P, Quere P, Imhof BA, Corbel C.
Glycoprotein IIb-IIIa is expressed on avian multilineage hematopoietic progenitor cells.
Blood.
1999;93:2898 27. Uzan G, Prandini MH, Berthier R. Regulation of gene transcription during the differentiation of megakaryocytes. Thromb Haemost. 1995;74:210[Medline] [Order article via Infotrieve]. 28. Block KL, Poncz M. Platelet glycoprotein IIb gene expression as a model of megakaryocyte-specific expression. Stem Cells. 1995;13:135[Abstract].
29.
Luckow B, Schutz G.
CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements.
Nucleic Acids Res.
1987;15:5490
30.
Gorman CM, Moffat LF, Howard BH.
Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells.
Mol Cell Biol.
1982;2:1044 31. Denarier E, Martin F, Martineau S, Marguerie G. PCR cloning and sequence of the murine GPIIb gene promoter. Biochem Biophys Res Commun. 1993;195:1360[Medline] [Order article via Infotrieve].
32.
Uzan G, Prenant M, Prandini MH, Martin F, Marguerie G.
Tissue-specific expression of the platelet GPIIb gene.
J Biol Chem.
1991;266:8932
33.
Malik P, Fisher TC, Barsky LL, et al.
An in vitro model of human red blood cell production from hematopoietic progenitor cells.
Blood.
1998;91:2664 34. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction. Anal Biochem. 1987;162:156[Medline] [Order article via Infotrieve]. 35. Berthier R, Prandini MH, Schweitzer A, Thevenon D, Martin-Sisteron H, Uzan G. The MS-5 murine stromal cell line and hematopoietic growth factors synergize to support the megakaryocytic differentiation of embryonic stem cells. Exp Hematol. 1997;25:481[Medline] [Order article via Infotrieve]. 36. Frachet P, Uzan G, Thevenon D, Denarier E, Prandini MH, Marguerie G. GPIIb and GPIIIa amino acid sequences deduced from human megakaryocyte cDNAs. Mol Biol Rep. 1990;14:27[Medline] [Order article via Infotrieve].
37.
Arcari P, Martinelli R, Salvatore F.
The complete sequence of a full length cDNA for human liver glyceraldehyde-3-phosphate dehydrogenase: evidence for multiple mRNA species.
Nucleic Acids Res.
1984;12:9179
38.
Chu G, Hayakawa H, Berg P.
Electroporation for the efficient transfection of mammalian cells with DNA.
Nucleic Acids Res.
1987;15:1311 39. Wigler M, Silverstein S, Lee LS, Pellicer A, Cheng Y, Axel R. Transfer of purified herpes virus thymidine kinase gene to cultured mouse cells. Cell. 1977;11:223[Medline] [Order article via Infotrieve].
40.
de Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S.
Firefly luciferase gene: structure and expression in mammalian cells.
Mol Cell Biol.
1987;7:725
41.
Schreiber E, Matthias P, Muller MM, Schaffner W.
Rapid detection of octamer binding proteins with `mini-extracts', prepared from a small number of cells.
Nucleic Acids Res.
1989;17:6419 42. Gidoni D, Dynan WS, Tjian R. Multiple specific contacts between a mammalian transcription factor and its cognate promoters. Nature. 1984;312:409[Medline] [Order article via Infotrieve].
43.
Halligan BD, Desiderio SV.
Identification of a DNA binding protein that recognizes the nonamer recombinational signal sequence of immunoglobulin genes.
Proc Natl Acad Sci U S A.
1987;84:7019 44. Singh H, Sen R, Baltimore D, Sharp PA. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 1986;319:154[Medline] [Order article via Infotrieve].
45.
Baker RE, Gabrielsen O, Hall BD.
Effects of tRNATyr point mutations on the binding of yeast RNA polymerase III transcription factor C.
J Biol Chem.
1986;261:5275 46. Prandini MH, Denarier E, Frachet P, Uzan G, Marguerie G. Isolation of the human platelet glycoprotein IIb gene and characterization of the 5' flanking region. Biochem Biophys Res Commun. 1988;156:595[Medline] [Order article via Infotrieve].
47.
Doubeikovski A, Uzan G, Doubeikovski Z, et al.
Thrombopoietin-induced expression of the glycoprotein IIb gene involves the transcription factor PU.1/Spi-1 in UT7-Mpl cells.
J Biol Chem.
1997;272:24300
48.
Fong AM, Santoro SA.
Transcriptional regulation of
49.
Block KL, Ravid K, Phung QH, Poncz M.
Characterization of regulatory elements in the 5'-flanking region of the rat GPIIb gene by studies in a primary rat marrow culture system.
Blood.
1994;84:3385
50.
Lemarchandel V, Ghysdael J, Mignotte V, Rahuel C, Romeo PH.
GATA and Ets cis-acting sequences mediate megakaryocyte-specific expression.
Mol Cell Biol.
1993;13:668 51. Fischer S, Wendling F, Boulet I, et al. Elevated level of p60c-src in virus-transformed murine megakaryocytic cell lines. Oncogene. 1989;4:901[Medline] [Order article via Infotrieve]. 52. Friend C, Preisler HD, Scher W. Studies on the control of differentiation of murine virus-induced erythroleukemic cells. Curr Top Dev Biol. 1974;8:81[Medline] [Order article via Infotrieve]. 53. Tani T, Ylanne J, Virtanen I. Expression of megakaryocytic and erythroid properties in human leukemic cells. Exp Hematol. 1996;24:158[Medline] [Order article via Infotrieve].
54.
Tabilio A, Pelicci PG, Vinci G, et al.
Myeloid and megakaryocytic properties of K-562 cell lines.
Cancer Res.
1983;43:4569 55. Leary JF, Ohlsson-Wilhelm BM, Giuliano R, LaBella S, Farley B, Rowley PT. Multipotent human hematopoietic cell line K562: lineage-specific constitutive and inducible antigens. Leuk Res. 1987;11:807[Medline] [Order article via Infotrieve].
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
S. C. Hughan, Y. Senis, D. Best, A. Thomas, J. Frampton, P. Vyas, and S. P. Watson Selective impairment of platelet activation to collagen in the absence of GATA1 Blood, June 1, 2005; 105(11): 4369 - 4376. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Furihata and T. J. Kunicki Characterization of Human Glycoprotein VI Gene 5' Regulatory and Promoter Regions Arterioscler. Thromb. Vasc. Biol., October 1, 2002; 22(10): 1733 - 1739. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Graf Differentiation plasticity of hematopoietic cells Blood, May 1, 2002; 99(9): 3089 - 3101. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||