|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMATOPOIESIS
From the Departments of Adult Oncology and Cancer
Biology, Dana-Farber Cancer Institute, and the Department of Medicine,
Brigham & Women's Hospital and Harvard Medical School, Boston, MA.
The cellular and molecular bases of platelet release by terminally
differentiated megakaryocytes represent important questions in cell
biology and hematopoiesis. Mice lacking the transcription factor NF-E2
show profound thrombocytopenia, and their megakaryocytes fail to
produce proplatelets, the microtubule-based precursors of blood
platelets. Using mRNA subtraction between normal and NF-E2-deficient
megakaryocytes, cDNA was isolated encoding Megakaryocyte differentiation culminates in the
release of hundreds of platelets by mechanisms that are poorly
understood.1 Use of thrombopoietin (TPO), the major
cytokine regulator of megakaryocyte growth and
differentiation,2 has allowed expansion and
differentiation of megakaryocytes in culture, leading to cellular and
molecular studies that were not previously possible.3-5
Concomitantly, targeted disruption of several transcription factor
genes in mice has revealed phenotypes of moderate to severe
thrombocytopenia and paved the way for dissection of the
transcriptional control of platelet biogenesis.6-9
The transcription factor NF-E2 binds AP-1-like sites within selected
erythroid-specific cis-elements, including the To explore the molecular basis of platelet production and release, we
identified candidate transcriptional targets of NF-E2 using mRNA
subtraction. The predominant cDNA in the subtracted library encodes
Here we show that the expression of Cell culture
Stably transfected L8057 cell lines were generated by electroporation
of linearized plasmid constructs carrying p45 or p18 NF-E2 cDNA under
control of the human elongation factor (EF)-1 Purification of primary megakaryocytes and hematopoietic
progenitors
Immunoblot analysis Immunoblot analysis was performed according to standard protocols.35 Cell extracts were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose, and incubated with 1:1000 dilution of either anti-p45 NF-E2, anti-Tal-1 (provided by Richard Baer, University of Texas), or anti- 1 tubulin36 (provided by Sally Lewis and Nick
Cowan, New York University) rabbit antisera for 1 hour at room
temperature. After 5 washes, incubation with 1:1000 dilution of
horseradish peroxidase (HRP)-conjugated donkey antirabbit IgG or
HRP-conjugated Protein A (Amersham Life Sciences, Buckinghamshire, UK)
for 1 hour, and 5 additional washes, bound antibodies were detected
using an enzymatic chemiluminescence kit (Amersham). Immunoblot
analyses with anti-pan tubulin (Sigma) and anti-GAPDH
(Biodesign International, Kennebunk, ME) monoclonal antibodies were
performed with 1:2500 dilution for the primary antibody and 1:5000
HRP-conjugated goat antimouse IgG (Amersham).
Indirect immunofluorescence Monoclonal antibodies specific for tubulin and fluorescein
isothiocyanate and tetramethylrhodamine isothiocyanate conjugates of
goat antirabbit and goat antimouse IgG were obtained from Sigma, and
anti-1 tubulin antiserum was obtained as above. Primary and secondary antibodies were used at 5 µg/mL and at 1:200 dilution, respectively, in PBS + 1% BSA. Cultured megakaryocytes were
cyto-centrifuged at 500g for 4 minutes onto
poly-L-lysine-coated coverslips, fixed in 4% formaldehyde
in Hanks' balanced salt solution (HBSS; Gibco BRL) for 20 minutes,
permeabilized with 0.5% Triton X-100 in HBSS containing 0.1 mmol/L
EGTA, and blocked with 0.5% BSA in PBS. Specimens were incubated in
primary antibody for 3 to 6 hours, washed, treated with appropriate
secondary antibodies for 1 hour, and washed again. Staining controls
were processed identically except for the omission of the primary
antibody. Preparations were observed with a Bio-Rad (Hercules,
CA) MRC 1024 laser scanning confocal microscope (100× differential
interference contrast-apochromatic oil immersion objective) equipped
with Lasersharp 3.1 software, or a Zeiss (Oberkochen, Germany) Axiovert
S100 microscope (40× phase-contrast objective) equipped with
appropriate filters for fluorescein isothiocyanate and
tetramethylrhodamine isothiocyanate fluorescence.
Subtractive hybridization The PCR-Select cDNA subtraction kit (Clontech, Palo Alto, CA) was used for cDNA synthesis and suppressive subtractive hybridization, according to the recommended protocol. Briefly, 1 µg poly-(A)+ RNA from wild-type and p45 NF-E2 / fetal livers cultured in the presence of TPO
were used to generate double-stranded cDNA. RsaI-digested
wild-type cDNA was used as the tester sample and ligated to 2 unique
adapters. RsaI-digested p45 NF-E2-null cDNA was used as the
driver sample without adapters. Hybridization of the tester population,
with an excess of driver and an amplification of subtracted species
with oligonucleotide primers corresponding to the 2 unique adapters in
the tester cDNA, produced a pool of polymerase chain reaction
(PCR)-amplified fragments enriched in the wild-type, but absent or
reduced in the p45 NF-E2/, megakaryocytes. The PCR
products were cloned and sequenced.
Immunohistochemistry Tissues were obtained from adult mice, fixed in 4% paraformaldehyde in PBS overnight at 4°C, and embedded in paraffin, and 5-µm sections were cut onto charged glass slides. Sections were cleared with xylene, rehydrated in graded ethanols, quenched in 40% methanol and 0.3% hydrogen peroxide for 30 minutes at room temperature, washed, and incubated with the1 tubulin or normal rabbit (control) sera at a dilution of 1:100 for 1 hour at room temperature. After washes in PBS, sections were further incubated with
donkey antirabbit-HRP antibody at 1:200 dilution for 30 minutes and
washed in PBS. Peroxidase activity was revealed using 0.02% 3,3'-diaminobenzidine (Vector, Burlingame, CA) and counterstained with
hematoxylin for 15 to 30 seconds. Sections were then dehydrated in
graded ethanols, recleared in xylene, and mounted for microscopy.
RNA isolation, Northern blot analysis, and semiquantitative RT-PCR Total cellular RNA was isolated using RNAzol B (Tel-Test, Friendswood, TX) as recommended by the manufacturer. Northern blot analysis was performed as described.37 RT-PCR analysis was conducted as described previously,6 using 0.1 µCi -[32P]dCTP as a radiotracer; the
reaction products were resolved by nondenaturing PAGE and detected by
autoradiography. Annealing temperature for PCR was 60°C for tubulin and 58°C for other reactions; all reactions were confirmed to
be in the linear range of amplification. Primer sequences and sizes of
the amplified fragments were as follows: p45
NF-E2 (529 bp) forward 5' AACTTGCCGGTAGATGACTTTAAT 3'
reverse 5' CACCAAATACTCCCAGGTGATATG 3' 1 tubulin
coding sequence (492 bp) forward 5' ATCAGGGAGGAGTACCCGGATCGGA
3' reverse 5' CCCGGAATATACAAGCCACAGTCAG 3' 1
tubulin 3'untranslated region (311 bp) forward 5'
GCATGATGCTGGATTCTCAAGTCCTGG 3' reverse 5'
CGGTGTTTCTCCGTCCACAGCAAAGT 3' 2 tubulin (465 bp) forward 5' CGAGCCCTGACGGTGCCCGAGCTG 3' reverse 5'
GAACTCTCCCTCTTCCTCAGCCTG 3' 4 tubulin (520 bp)
forward 5' CCAGGATTCGCACCCTTGACCAGC 3' reverse 5'
AGCCTCCTCTTCGAACTCGCCCTC 3' 5 tubulin (396 bp)
forward 5' CGCCACGGCCGGTACCTCACAGTT 3' reverse 5'
TCCGAAATCCTCTTCCTCTTCCGC 3' hypoxanthine
phosphoribosyl transferase (HPRT, 249 bp) forward 5'
CACAGGACTAGAACACCTGC 3' reverse 5' GCTGGTGAAAAFFACCTCT 3'
glyceraldehyde-3-phosphate dehydrogenase (GAPDH, 452 bp) forward 5' ACCACAGTCCATGCCATCAC 3' reverse 5'
TCCACCACCCTGTTGCTGTA 3' -globin (331 bp)
forward 5' CTCTCTGGGGAAGACAAAAGCAAC 3' reverse 5'
GGTGGCTAGCCAAGGTCACCAGCA 3'
Retrovirus production and infection of
Lin 1 tubulin cDNA were amplified by
PCR and inserted into the polylinker site. EBNA 293 cells (Invitrogen,
Carlsbad, CA) were plated at a density of 2 × 106
cells/10-cm dish in DMEM (Gibco BRL) containing 10% fetal calf serum 4 days before transfection and were fed 1 day before transfection. The
retroviral vector and 2 pN8 vectors (12 µg each) encoding the
gag/pol proteins from the murine Moloney leukemia virus and the G
glycoprotein from the vesicular stomatitis virus (VSV-G)39 (gift of Jay Morgenstern) were transfected using lipofectamine (Gibco
BRL), according to the manufacturer's instructions, and fresh medium
was added after 5 hours. Viral supernatants were collected 48, 72, and
96 hours after transfection, filtered through 0.45-µm filters, and
centrifuged at 50 000g at 4°C for 2 hours. Pellets were
resuspended in 1.5 mL DMEM + 10% FBS with agitation for 24 hours
at 4°C and frozen at  80°C until transduction.
E13.5 mouse fetal liver cells were depleted of erythrocytes by lysis in
0.15 mol/L NH4Cl and expanded in vitro by culturing for 20 hours in DMEM supplemented with 10% FBS, 1% tissue culture supernatant from the TPO producer cell line, as above, and 0.1 µg/mL
c-kit ligand (R&D Systems, Minneapolis, MN). The VSV-G pseudotyped viruses were then used for infection of Lin
Isolation of a candidate effector of NF-E2 function in megakaryocytes To identify putative transcriptional targets of NF-E2, we used suppressive subtractive hybridization40,41 to generate a cDNA library enriched for transcripts missing or reduced in the p45 NF-E2/ megakaryocytes. Approximately 10% of the
subtracted library contains a DNA fragment from the 3' untranslated
region of the gene encoding 1 tubulin. Expression of this mRNA is
reported to be restricted to hematopoietic tissues,20
including blood platelets,36 and 1 tubulin is the most
evolutionarily divergent murine tubulin isoform, sharing only 78%
amino acid homology with other tubulins.20 This raised
the possibility of cell-specific functions, and the absence of a
microtubule protein provides a plausible mechanism for the profound
thrombocytopenia and failure of proplatelet formation in p45
NF-E2/ mice. We examined levels of mRNA encoding each
of the known murine tubulin isotypes25 in
megakaryocytes purified from wild-type and p45 NF-E2/
cultures. Only 1 tubulin mRNA was down-regulated in p45
NF-E2/ cells (Figure 1A;
analysis of isoforms 2-4 not shown). Northern analysis confirmed
the virtual absence of 1 tubulin mRNA in p45 NF-E2/
megakaryocytes (Figure 1B).
Restricted expression of 1 tubulin mRNA in adult mice is reported to be
restricted to the spleen and, to a lesser extent, to the developing lung and liver.20 Using a cDNA probe derived from the
unique 3' untranslated region of the murine 1 tubulin gene, we
confirmed this finding on Northern blot analysis (data not shown). We
also used an isoform-specific 1 tubulin antibody36 to
establish that the expression of 1 tubulin protein is restricted to
the spleen in adult mice, with lower levels in the lung (Figure
2A). Among all hematopoietic cells
cultured from the fetal liver in the presence of TPO, this protein was
detected exclusively in the megakaryocyte fraction isolated by
density-gradient separation from other cell types (Figure 2B).
Furthermore, immunohistochemistry on bone marrow and spleen from normal
adult mice showed the 1 tubulin protein to be remarkably confined to
megakaryocytes (Figure 2C). However, we detected only a weak immunoblot
signal in bone marrow compared to that found in the spleen (Figure 2A),
despite the known presence of megakaryocytes in both tissues, which
suggested a significant contribution toward the spleen signal
from sequestered blood platelets. This was confirmed by
immunohistochemical analysis of the spleen (Figure 2C,D), in which
extramegakaryocytic staining was restricted to platelet-sized particles
found interspersed with fully differentiated erythrocytes within
sinusoids in the red pulp. Significantly, only large cells
morphologically identifiable as mature megakaryocytes showed detectable
levels of 1 tubulin; immature megakaryocytes expressed little, if
any, 1 tubulin. This finding strongly suggests that the 1 isoform
appears in late stages of megakaryocyte differentiation. We failed to
detect distinct cellular staining within bronchi, pneumocytes, or
connective tissue in the lung; instead, immunostaining was confined to
platelets within the vasculature (Figure 2C). Thus, 1 tubulin was
detected exclusively in a subpopulation of mature megakaryocytes and in platelets observed in largest numbers in the spleen and lung.
Absence of tubulin mRNA and protein are regulated
at 2 levels. First, there is transcriptional control that limits the
expression of selected isoforms to specific cell types.30 Second, a posttranslational mechanism sets the quantitative level of
tubulin through an autoregulatory pathway in which mRNA stability is governed by the concentration of the tubulin
polypeptide.42,43 Hence, the reduction of 1 tubulin
mRNA in p45 NF-E2/ megakaryocytes could in principle
reflect the presence of excess free tubulin monomers. However, the
1 isoform was undetectable in purified megakaryocytes cultured from
p45 NF-E2/ mice, and the total amount of tubulin
protein was significantly reduced (Figure
3A). Thus, in the absence of NF-E2
function there is selective and profound down-regulation of the
transcription of 1 tubulin, the most abundant tubulin isoform in
mature megakaryocytes. Reduced 1 tubulin expression was observed not
only in cultured megakaryocytes but also in the spleen and blood of
adult p45 NF-E2/ mice (Figure 3B). Immunohistochemical
analysis of the spleen and bone marrow further highlighted the absence
of 1 tubulin protein in p45 NF-E2/ mice, despite an
abundance of megakaryocytes (data not shown).
1 tubulin is an excellent candidate
mediator of thrombopoiesis. In cultures of wild-type hematopoietic
cells, 1 tubulin expression was restricted to cells producing
proplatelets (Figure 4A). Immature megakaryocytes and other blood lineages, including granulocytes and
monocytes recognized by morphologic criteria (arrows in Figure 4A), did
not express 1 tubulin. This finding complemented the in situ
immunohistochemical analysis (Figure 2C) in which 1 tubulin is
detected only in a subset of megakaryocytes, and it was consistent with
our observations17 that megakaryocytes cultured from fetal livers are functional and fundamentally similar to bone
marrow-derived cells.
We further cultured megakaryocyte colonies in methylcellulose and
carefully picked, under microscopic observation, 2 classes: colonies
clearly producing proplatelets and those of equal size and apparently
equal cellular maturity but not producing proplatelets. The One characteristic feature of resting mammalian platelets is the
presence of a prominent peripheral microtubule coil positioned along
the long axis, called the marginal band.45 Emerging
evidence strongly suggests that the platelet marginal band is assembled within developing proplatelets as an integral aspect of
thrombopoiesis,44 and Lewis et al36 have
shown the platelet marginal band to contain Expression of the 1 tubulin mRNA levels in the absence
of NF-E2 may reflect either direct transcriptional regulation by
NF-E2 or simply the late differentiation block in NF-E2-null megakaryocytes. The mouse megakaryoblastic cell line
L805746 shows complete lack of p45 NF-E2 protein (Figure
5A) and mRNA (data not shown),
whereas expression of other megakaryocyte-associated transcription
factors, including Tal-1,47 is detected readily; these
cells also fail to express 1 tubulin. In transfected L8057 cells
showing stable expression of p45 NF-E2, however, 1 tubulin expression was restored (Figure 5A). Although the small-Maf (18 kd)
component of the NF-E2 heterodimer was present in L8057 cells (data not
shown), its availability might have been limiting for optimal formation
of the functional transcription factor complex. Indeed, overexpression
of p18/MafK in p45 NF-E2-expressing L8057 cells further increased the
level of 1 tubulin protein (Figure 5A). These studies in a
megakaryocyte cell line suggest a critical requirement for NF-E2 in the
expression of 1 tubulin. Interestingly, a small fraction of
NF-E2-expressing L8057 cells also went on to generate proplatelets in
culture (K.S.W., R.A.S., unpublished data).
Mice lacking p45 NF-E2 show only mild red blood cell
abnormalities.48 If reduced In the absence of NF-E2, 1 tubulin as a specific and possibly essential component of the
cellular machinery for platelet formation and release. To investigate
the possibility that the absence of 1 tubulin alone might account for profound thrombocytopenia in p45 NF-E2/ mice, we
attempted to rescue the cellular phenotype of failure of proplatelet
formation in vitro. Hematopoietic progenitors (Lin cells)
from wild-type or p45 NF-E2/ fetal liver cells were
induced to proliferate in the presence of TPO and the c-kit ligand,
infected with retroviruses encoding p45 NF-E2 or 1 tubulin, then
cultured in TPO alone and monitored for proplatelet formation. Despite
a predictably low (5%-10%) efficiency of retroviral transduction, as
judged by immunofluorescence, this experimental design permitted
analysis at the level of single cells in culture. Restoration of p45
NF-E2 expression in p45 NF-E2/ cells induced readily
detectable proplatelets (Figure 6) in up to half of the p45 NF-E2-expressing cells, similar to the fraction of
all mature megakaryocytes producing proplatelet in
vitro.17 This result formally proves that the phenotype of
p45 NF-E2 knockout megakaryocytes is a direct result of inactivation of
the targeted gene rather than of inadvertent silencing of a neighboring
gene locus, as has been observed in rare cases.51
Reintroduction of p45 NF-E2 also restored 1 tubulin expression
(Figure 6), underscoring the requirement for NF-E2 in the expression of
the 1 tubulin gene. In contrast, cells transduced with 1 tubulin
alone failed to produce proplatelets, despite detectable expression of
the protein by immunofluorescence. p45 NF-E2+/+ cells
infected with 1 tubulin-encoding virus showed no compromise in the
ability to produce proplatelets, thus excluding the possibility that
the 1 tubulin retrovirus is toxic to cells.
Among cDNAs isolated in the mRNA subtraction between wild-type and p45
NF-E2
Investigating the molecular mechanisms of platelet release Cellular and molecular regulation of platelet release by terminally differentiated megakaryocytes remain poorly understood, in part because the rarity of megakaryocytes in vivo limits the identification of cells in the act of releasing platelets. Nevertheless, many independent studies have converged on a model of thrombopoiesis that recognizes that megakaryocyte differentiation culminates in the extension of long cytoplasmic processes, designated proplatelets.18 These structures are comprised of arrays of nascent blood platelets that fragment into particles with functional properties of circulating platelets.3,19,44 The internal membranes of mature megakaryocytes are believed to provide the lipid surface necessary to produce numerous proplatelets and blood platelets,52 and experimental evidence points to a central role for microtubules. Proplatelet ultrastructure reveals the presence of microtubule bundles in the shaft,3,19,53 proplatelet formation is disrupted by drugs that interfere with microtubule function,52,54,55 and the platelet marginal band is assembled by the coiling of microtubules within proplatelets.44 Megakaryocytes from genetically thrombocytopenic mice lacking NF-E2 or GATA-1 function are defective in generating proplatelets in vitro,17 underscoring the correlation with thrombopoiesis in vivo.To identify genes required for late megakaryocyte maturation and
platelet release, we took advantage of the ability to culture large
numbers of normal and p45 NF-E2 Here we report that the absence of NF-E2 function is associated with a
lack of Role of and . Because isotypes within these families share considerable amino acid sequence identity (greater
than 95%; 1 tubulin is the most divergent, with 78% homology), it
has been difficult to demonstrate specific functions for individual
isoforms. Only the testis-specific tubulin isotype in
Drosophila is known to fulfill a specific and unique
role56; 1 tubulin is predominantly incorporated
into a microtubule structure called the marginal band, which functions
to maintain platelet discoid shape,57 and into microtubule
bundles that traverse the length of proplatelet filaments in
megakaryocytes (Figure 4). This cellular localization particularly
suggests the possibility of a role for 1 tubulin in the genesis and
stability of mammalian blood platelets. In contrast to the usual
rigidity of microtubules, the platelet marginal band is remarkably
flexible and is composed of a single microtubule coiled tightly within
a confined space.45 Microtubules in maturing proplatelets
likely also function as the conduit for rapid transport and
compartmentalization of platelet organelles, another specialized
function. One possibility is that the carboxyl terminus of 1
tubulin, the region of maximum sequence diversity20 and a
putative mediator of protein-protein interactions,28,29 associates with other megakaryocyte-specific proteins involved in
organelle transport and creation or stabilization of the marginal band.
Despite these considerations, tubulin is capable of assembling into
functional mitotic spindles when expressed ectopically in HeLa
cells.36 This finding does not, however, preclude the
possibility of additional cell-specific functions in megakaryocytes.
One is thus left with 2 broad possibilities: either
1 tubulin mRNA in p45 NF-E2-null
megakaryocytes is compatible with 2 distinct modes of regulation. The
1 tubulin gene could be a direct transcriptional target of NF-E2; alternatively, it may be regulated in a stage-specific manner that
precludes expression in cells with arrested terminal differentiation. Either possibility places the 1 tubulin gene within an
NF-E2-dependent pathway of transcriptional regulation. Transduction of
p45 NF-E2 into the mutant megakaryocytes induces 1 tubulin
expression (Figure 6), and expression of 1 tubulin in a
megakaryoblastic cell line is dependent on NF-E2 function (Figure 5A).
Although the expression of 1 tubulin is largely restricted to
megakaryocytes and platelets, it has also been detected in primitive
embryonic erythrocytes in mammals and in the nucleated mature
erythrocytes of nonmammalian species.58-60 This expression
pattern is remarkably concordant with that of p45 NF-E2, and 1
tubulin mRNA levels are decreased in red cells isolated from p45
NF-E2/ yolk sacs (Figure 5B). Although the physiologic
significance of this finding is uncertain because protein levels are
low in this cell lineage, even in wild-type mice (data not shown), the result is informative with respect to the regulation of gene
expression. Our initial characterization of genomic clones of murine
1 tubulin indicates the absence of a canonical TATA box and the
presence of 2 consensus NF-E2-binding sites in the 5' flanking region
of the gene (P.L., R.A.S., unpublished data); experiments are in progress to determine the functional relevance of these sites in
transcriptional regulation.
Perhaps not surprisingly, the expression of
We thank Sally Lewis and Nick Cowan for generously
providing
Submitted December 20, 1999; accepted April 7, 2000.
Supported by a fellowship from the American Society of Hematology (P.L.), a National Institutes of Health training grant (J.E.I.), the Asian Life Science Institute, Korea (S.W.K.), and awards from the Cancer Research Fund of the Damon Runyon-Walter Winchell Foundation (R.A.S.) and the National Institutes of Health (R.A.S.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Ramesh A. Shivdasani, Dana-Farber Cancer Institute, 44 Binney St, Boston, MA 02115; e-mail: ramesh_shivdasani{at}dfci.harvard.edu.
1. Jackson CW, Arnold JT, Pestina TI, Stenberg PE. Megakaryocyte biology. In: Kuter DJ,Hunt P,Sheridan W,Zucker-Franklin D, eds. Thrombopoiesis and Thrombopoietins. Totowa, NJ: Humana Press; 1997:4-39.
2.
Kaushansky K.
Thrombopoietin: the primary regulator of platelet production.
Blood.
1995;86:419-431
3.
Choi ES, Nichol JL, Hokom MM, Hornkohl AC, Hunt P.
Platelets generated in vitro from proplatelet-displaying human megakaryocytes are functional.
Blood.
1995;85:402-413
4.
Drachman JG, Sabath DF, Fox NE, Kaushansky K.
Thrombopoietin signal transduction in purified murine megakaryocytes.
Blood.
1997;89:483-492
5.
Lecine P, Blank V, Shivdasani R.
Characterization of the hematopoietic transcription factor NF-E2 in primary murine megakaryocytes.
J Biol Chem.
1998;273:7572-7578 6. Shivdasani RA, Rosenblatt MF, Zucker-Franklin D, et al. Transcription factor NF-E2 is required for platelet formation independent of the actions of thrombopoietin/MGDF in megakaryocyte development. Cell. 1995;81:695-704[Medline] [Order article via Infotrieve]. 7. Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH. A lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development. EMBO J. 1997;16:3965-3973[Medline] [Order article via Infotrieve].
8.
Tsang AP, Fujiwara Y, Hom DB, Orkin SH.
Failure of megakaryopoiesis and arrested erythropoiesis in mice lacking the GATA-1 transcriptional cofactor FOG.
Genes Dev.
1998;12:1176-1188
9.
Shavit JA, Motohashi H, Onodera K, Akasaka J, Yamamoto M, Engel JD.
Impaired megakaryopoiesis and behavioral defects in mafG-null mutant mice.
Genes Dev.
1998;12:2164-2174
10.
Mignotte V, Wall L, deBoer E, Grosveld F, Romeo P-H.
Two tissue-specific factors bind the erythroid promoter of the human porphobilinogen deaminase gene.
Nucleic Acids Res.
1989;17:37-54
11.
Ney PA, Sorrentino BP, Lowrey CH, Nienhuis AW.
Inducibility of the HS II enhancer depends on binding of an erythroid specific nuclear protein.
Nucleic Acids Res.
1990;18:6011-6017 12. Talbot D, Grosveld F. The 5' HS 2 of the globin locus control region enhances transcription through the interaction of a multimeric complex binding at two functionally distinct NF-E2 binding sites. EMBO J. 1991;10:1391-1398[Medline] [Order article via Infotrieve]. 13. Andrews NC, Erdjument-Bromage H, Davidson MB, Tempst P, Orkin SH. Erythroid transcription factor NF-E2 is a haematopoietic-specific basic-leucine zipper protein. Nature. 1993;362:722-728[Medline] [Order article via Infotrieve].
14.
Ney PA, Andrews NC, Jane SM, et al.
Purification of the human NF-E2 complex: cDNA cloning of the hematopoietic cell-specific subunit and evidence for an associated partner.
Mol Cell Biol.
1993;13:5604-5612
15.
Andrews NC, Kotkow KJ, Ney PA, Erdjument-Bromage H, Tempst P, Orkin SH.
The ubiquitous subunit of erythroid transcription factor NF-E2 is a small basic-leucine zipper protein related to the v-maf oncogene.
Proc Natl Acad Sci U S A.
1993;90:11488-11492 16. Igarashi K, Kataoka K, Itoh K, Hayashi N, Nishizawa M, Yamamoto M. Regulation of transcription by dimerization of erythroid factor NF-E2 p45 with small Maf proteins. Nature. 1994;367:568-572[Medline] [Order article via Infotrieve].
17.
Lecine P, Villeval J-L, Vyas P, Swencki B, Xu Y, Shivdasani RA.
Mice lacking transcription factor NF-E2 validate the proplatelet model of thrombocytopoiesis and show a platelet production defect that is intrinsic to megakaryocytes.
Blood.
1998;92:1608-1616 18. Becker RP, de Bruyn PP. The transmural passage of blood cells into myeloid sinusoids and the entry of platelets into the sinusoidal circulation: a scanning electron microscopic investigation. Am J Anat. 1976;145:183-205[Medline] [Order article via Infotrieve].
19.
Radley JM, Scurfield G.
The mechanism of platelet release.
Blood.
1980;56:996-999
20.
Wang D, Villasante A, Lewis SA, Cowan NJ.
The mammalian b-tubulin repertoire: hematopoietic expression of a novel b-tubulin isotype.
J Cell Biol.
1986;103:1903-1910 21. Sullivan KF. Structure and utilization of tubulin isotypes. Annu Rev Cell Biol. 1988;4:687-716. 22. Downing KH, Nogales E. Tubulin and microtubule structure. Curr Opin Cell Biol. 1998;10:16-22[Medline] [Order article via Infotrieve]. 23. Inoue S, Salmon ED. Force generation by microtubule assembly/disassembly in mitosis and related movements. Mol Biol Cell. 1995;6:1619-1640[Medline] [Order article via Infotrieve].
24.
Villasante A, Wang D, Dobner P, Dolph P, Lewis SA, Cowan NJ.
Six mouse alpha-tubulin mRNAs encode five distinct isotypes: testis-specific expression of two sister genes.
Mol Cell Biol.
1986;6:2409-2419 25. Luduena RF. Are tubulin isotypes functionally significant. Mol Biol Cell. 1993;4:445-457[Medline] [Order article via Infotrieve]. 26. Little M, Seehaus T. Comparative analysis of tubulin sequences. Comp Biochem Physiol. 1988;90:655-670. 27. Breitling F, Little M. Carboxy-terminal regions on the surface of tubulin and microtubules. J Mol Biol. 1986;189:367-370[Medline] [Order article via Infotrieve]. 28. Mandelkow E, Mandelkow EM. Microtubules and microtubule-associated proteins. Curr Opin Cell Biol. 1995;7:72-81[Medline] [Order article via Infotrieve]. 29. Nogales E, Wolf SG, Downing KH. Structure of the alpha beta tubulin dimer by electron crystallography. Nature. 1998;391:199-203[Medline] [Order article via Infotrieve].
30.
Lewis SA, Lee MG, Cowan NJ.
Five mouse tubulin isotypes and their regulated expression during development.
J Cell Biol.
1985;101:852-861 31. Raff EC. The role of multiple tubulin isoforms in cellular microtubule function. In: Hyams JS,Lloyd CW, eds. Microtubules. New York: Wiley-Liss; 1994:85-109. 32. Luduena RF. Multiple forms of tubulin: different gene products and covalent modifications. Int Rev Cytol. 1998;178:207-275[Medline] [Order article via Infotrieve].
33.
Villeval J-L, Cohen-Solal K, Tulliez M, et al.
High thrombopoietin production by hemopoietic cells induces a fatal myeloproliferative syndrome in mice.
Blood.
1997;90:4369-4383
34.
Mizushima S, Nagata S.
pEF-BOS, a powerful mammalian expression vector.
Nucleic Acids Res.
1990;18:5322-5327 35. Harlow E, Lane D. Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Press; 1988. 36. Lewis SA, Gu W, Cowan NJ. Free intermingling of mammalian b-tubulin isotypes among functionally distinct microtubules. Cell. 1987;49:539-548[Medline] [Order article via Infotrieve]. 37. Ausubel FM, Brent R, Kingston RE, et al. Current Protocols in Molecular Biology. New York: John Wiley; 1987. 38. Johnson GR, Gonda TJ, Metcalf D, Hariharan IK, Cory S. A lethal myeloproliferative syndrome in mice transplanted with bone marrow cells infected with a retrovirus expressing granulocyte-macrophage colony stimulating factor. EMBO J. 1989;8:441-448[Medline] [Order article via Infotrieve].
39.
Ory DS, Neugeboren BA, Mulligan RC.
A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes.
Proc Natl Acad Sci U S A.
1996;93:11400-11406
40.
Diatchenko L, Lau YF, Campbell AP, et al.
Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries.
Proc Natl Acad Sci U S A.
1996;93:6025-6030 41. Diatchenko L, Lukyanov S, Lau YF, Siebert PD. Suppression subtractive hybridization: a versatile method for identifying differentially expressed genes. Methods Enzymol. 1999;303:349-380[Medline] [Order article via Infotrieve]. 42. Cleveland DW, Pittenger MF, Feramisco JR. Elevation of tubulin levels by microinjection suppresses new tubulin synthesis. Nature. 1983;305:738-740[Medline] [Order article via Infotrieve].
43.
Theodorakis NG, Cleveland DW.
Physical evidence for cotranslational regulation of beta-tubulin mRNA degradation.
Mol Cell Biol.
1992;12:791-799
44.
Italiano JE, Lecine P, Shivdasani RA, Hartwig JH.
Blood platelets are assembled principally at the ends of proplatelet processes produced by differentiated megakaryocytes.
J Cell Biol.
1999;147:1299-1312
45.
White JG, Krivit W.
An ultrastructural basis for the shape changes induced in platelets by chilling.
Blood.
1967;30:625-635 46. Ishida Y, Levin J, Baker G, et al. Biological and biochemical characteristics of murine megakaryoblastic cell line L8057. Exp Hematol. 1993;21:289-298[Medline] [Order article via Infotrieve].
47.
Mouthon M-A, Bernard O, Mitjavila M-T, Romeo P-H, Vainchenker W, Mathieu-Mahul D.
Expression of tal-1 and GATA-binding proteins during human hematopoiesis.
Blood.
1993;81:647-655
48.
Shivdasani RA, Orkin SH.
Erythropoiesis and globin gene expression in mice lacking the transcription factor NF-E2.
Proc Natl Acad Sci U S A.
1995;92:8690-8694
49.
Murphy DB, Wallis KT.
Isolation of microtubule protein from chicken erythrocytes and determination of the critical concentration for tubulin polymerization in vitro and in vivo.
J Biol Chem.
1983;258:8357-8364
50.
Murphy DB, Wallis KT, Machlin PS, Ratrie H, Cleveland DW.
The sequence and expression of the divergent b-tubulin in chicken erythrocytes.
J Biol Chem.
1987;262:14305-14312 51. Olson EN, Arnold H-H, Rigby PWJ, Wold BJ. Know your neighbors: three phenotypes in null mutants of the myogenic bHLH gene MRF4. Cell. 1996;85:1-4[Medline] [Order article via Infotrieve].
52.
Radley JM, Haller CJ.
The demarcation membrane system of the megakaryocyte: a misnomer.
Blood.
1982;60:213-219
53.
Cramer EM, Norol F, Guichard J, et al.
Ultrastructure of platelet formation by human megakaryocytes cultured with the Mpl ligand.
Blood.
1997;89:2336-2346 54. Handagama PJ, Feldman BF, Jain NC, Farver TB, Kono CS. In vitro platelet release by rat megakaryocytes: effect of metabolic inhibitors and cytoskeletal disrupting agents. Am J Vet Res. 1987;48:1142-1146[Medline] [Order article via Infotrieve].
55.
Tablin F, Castro M, Leven RM.
Blood platelet formation in vitro: the role of the cytoskeleton in megakaryocyte fragmentation.
J Cell Sci.
1990;97:59-70
56.
Hoyle HD, Raff EC.
Two Drosophila beta tubulin isoforms are not functionally equivalent.
J Cell Biol.
1990;111:1009-1026 57. White JG, Rao GH. Microtubule coils versus the surface membrane cytoskeleton in maintenance and restoration of platelet discoid shape. Am J Pathol. 1998;152:597-609[Abstract].
58.
Murphy DB, Wallis KT.
Erythrocyte microtubule assembly in vitro: tubulin oligomers limit the rate of microtubule self-assembly.
J Biol Chem.
1986;261:2319-2324
59.
Murphy DB, Grasser WA, Wallis KT.
Immunofluorescence examination of beta tubulin expression and marginal band formation in developing chicken erythroblasts.
J Cell Biol.
1986;102:628-635
60.
Winckler B, Solomon F.
A role for microtubule bundles in the morphogenesis of chicken erythrocytes.
Proc Natl Acad Sci U S A.
1991;88:6033-6037 61. Deveaux S, Cohen-Kaminsky S, Shivdasani RA, et al. p45 NF-E2 regulates the expression of thromboxane synthase in megakaryocytes. EMBO J. 1997;16:5654-5661[Medline] [Order article via Infotrieve]. 62. Zhang L, Xiao H, Schultz RA, Shen RF. Genomic organization, chromosomal localization, and expression of the murine thromboxane synthase gene. Genomics. 1997;45:519-528[Medline] [Order article via Infotrieve].
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  S. Kunishima, R. Kobayashi, T. J. Itoh, M. Hamaguchi, and H. Saito Mutation of the {beta}1-tubulin gene associated with congenital macrothrombocytopenia affecting microtubule assembly Blood, January 8, 2009; 113(2): 458 - 461. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Schulze, M. Dose, M. Korpal, I. Meyer, J. E. Italiano Jr., and R. A. Shivdasani RanBP10 Is a Cytoplasmic Guanine Nucleotide Exchange Factor That Modulates Noncentrosomal Microtubules J. Biol. Chem., May 16, 2008; 283(20): 14109 - 14119. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Patel-Hett, J. L. Richardson, H. Schulze, K. Drabek, N. A. Isaac, K. Hoffmeister, R. A. Shivdasani, J. C. Bulinski, N. Galjart, J. H. Hartwig, et al. Visualization of microtubule growth in living platelets reveals a dynamic marginal band with multiple microtubules Blood, May 1, 2008; 111(9): 4605 - 4616. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Junt, H. Schulze, Z. Chen, S. Massberg, T. Goerge, A. Krueger, D. D. Wagner, T. Graf, J. E. Italiano Jr., R. A. Shivdasani, et al. Dynamic Visualization of Thrombopoiesis Within Bone Marrow Science, September 21, 2007; 317(5845): 1767 - 1770. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Chang, F. Aurade, F. Larbret, Y. Zhang, J.-P. Le Couedic, L. Momeux, J. Larghero, J. Bertoglio, F. Louache, E. Cramer, et al. Proplatelet formation is regulated by the Rho/ROCK pathway Blood, May 15, 2007; 109(10): 4229 - 4236. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Matsumura-Takeda, S. Sogo, Y. Isakari, Y. Harada, K. Nishioka, T. Kawakami, T. Ono, and T. Taki CD41+/CD45+ Cells Without Acetylcholinesterase Activity Are Immature and a Major Megakaryocytic Population in Murine Bone Marrow Stem Cells, April 1, 2007; 25(4): 862 - 870. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Chen, M. Hu, and R. A. Shivdasani Expression analysis of primary mouse megakaryocyte differentiation and its application in identifying stage-specific molecular markers and a novel transcriptional target of NF-E2 Blood, February 15, 2007; 109(4): 1451 - 1459. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. P. McCormack, M. A. Hall, S. M. Schoenwaelder, Q. Zhao, S. Ellis, J. A. Prentice, A. J. Clarke, N. J. Slater, J. M. Salmon, S. P. Jackson, et al. A critical role for the transcription factor Scl in platelet production during stress thrombopoiesis Blood, October 1, 2006; 108(7): 2248 - 2256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. K. Larson and S. P. Watson Regulation of proplatelet formation and platelet release by integrin {alpha}IIbbeta3 Blood, September 1, 2006; 108(5): 1509 - 1514. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. K. Moss, V. M. Betin, S. D. Malesinski, and J. D. Lane A novel role for microtubules in apoptotic chromatin dynamics and cellular fragmentation J. Cell Sci., June 1, 2006; 119(11): 2362 - 2374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Freson, R. De Vos, C. Wittevrongel, C. Thys, J. Defoor, L. Vanhees, J. Vermylen, K. Peerlinck, and C. Van Geet The TUBB1 Q43P functional polymorphism reduces the risk of cardiovascular disease in men by modulating platelet function and structure Blood, October 1, 2005; 106(7): 2356 - 2362. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Toki, F. Katsuoka, R. Kanezaki, G. Xu, H. Kurotaki, J. Sun, T. Kamio, S. Watanabe, S. Tandai, K. Terui, et al. Transgenic expression of BACH1 transcription factor results in megakaryocytic impairment Blood, April 15, 2005; 105(8): 3100 - 3108. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Schulze, M. Korpal, W. Bergmeier, J. E. Italiano Jr, S. M. Wahl, and R. A. Shivdasani Interactions between the megakaryocyte/platelet-specific {beta}1 tubulin and the secretory leukocyte protease inhibitor SLPI suggest a role for regulated proteolysis in platelet functions Blood, December 15, 2004; 104(13): 3949 - 3957. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Nagata, J. Yoshikawa, A. Hashimoto, M. Yamamoto, A. H. Payne, and K. Todokoro Proplatelet formation of megakaryocytes is triggered by autocrine-synthesized estradiol Genes & Dev., December 1, 2003; 17(23): 2864 - 2869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Tiwari, J. E. Italiano Jr, D. C. Barral, E. H. Mules, E. K. Novak, R. T. Swank, M. C. Seabra, and R. A. Shivdasani A role for Rab27b in NF-E2-dependent pathways of platelet formation Blood, December 1, 2003; 102(12): 3970 - 3979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Italiano Jr, W. Bergmeier, S. Tiwari, H. Falet, J. H. Hartwig, K. M. Hoffmeister, P. Andre, D. D. Wagner, and R. A. Shivdasani Mechanisms and implications of platelet discoid shape Blood, June 15, 2003; 101(12): 4789 - 4796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Pratt, A. Drejer, H. Foott, B. Barut, A. Brownlie, J. Postlethwait, Y. Kato, M. Yamamoto, and L. I. Zon Isolation and characterization of zebrafish NFE2 Physiol Genomics, October 29, 2002; 11(2): 91 - 98. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Eto, R. Murphy, S. W. Kerrigan, A. Bertoni, H. Stuhlmann, T. Nakano, A. D. Leavitt, and S. J. Shattil Megakaryocytes derived from embryonic stem cells implicate CalDAG-GEFI in integrin signaling PNAS, October 1, 2002; 99(20): 12819 - 12824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. de Botton, S. Sabri, E. Daugas, Y. Zermati, J. E. Guidotti, O. Hermine, G. Kroemer, W. Vainchenker, and N. Debili Platelet formation is the consequence of caspase activation within megakaryocytes Blood, July 30, 2002; 100(4): 1310 - 1317. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. K. Novak, R. Gautam, M. Reddington, L. M. Collinson, N. G. Copeland, N. A. Jenkins, M. P. McGarry, and R. T. Swank The regulation of platelet-dense granules by Rab27a in the ashen mouse, a model of Hermansky-Pudlak and Griscelli syndromes, is granule-specific and dependent on genetic background Blood, June 17, 2002; 100(1): 128 - 135. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. F. Mao, V. R. Vaidyula, S. P. Kunapuli, and A. K. Rao Lineage-specific defect in gene expression in human platelet phospholipase C-beta 2 deficiency Blood, February 1, 2002; 99(3): 905 - 911. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Shivdasani Molecular and Transcriptional Regulation of Megakaryocyte Differentiation Stem Cells, September 1, 2001; 19(5): 397 - 407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Catani, M. Amabile, S. Luatti, L. Valdre, N. Vianelli, G. Martinelli, and S. Tura Interleukin-4 Downregulates Nuclear Factor-Erythroid 2 (NF-E2) Expression in Primary Megakaryocytes and in Megakaryoblastic Cell Lines Stem Cells, July 1, 2001; 19(4): 339 - 347. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Rojnuckarin and K. Kaushansky Actin reorganization and proplatelet formation in murine megakaryocytes: the role of protein kinase C{alpha} Blood, January 1, 2001; 97(1): 154 - 161. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-H. Lagrue-Lak-Hal, N. Debili, G. Kingbury, C. Lecut, J.-P. Le Couedic, J.-L. Villeval, M. Jandrot-Perrus, and W. Vainchenker Expression and Function of the Collagen Receptor GPVI during Megakaryocyte Maturation J. Biol. Chem., April 27, 2001; 276(18): 15316 - 15325. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
1 tubulin participates in a pathway of
platelet biogenesis dependent on the transcription factor
NF-E2
Top
Abstract
Introduction
