Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roux, D. T.-L.
Right arrow Articles by Marguerie, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roux, D. T.-L.
Right arrow Articles by Marguerie, G.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 August 2000, Vol. 96, No. 4, pp. 1399-1408

HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY

Thrombasthenic mice generated by replacement of the integrin alpha IIb gene: demonstration that transcriptional activation of this megakaryocytic locus precedes lineage commitment

Diana Tronik-Le Roux, Valérie Roullot, Christel Poujol, Thierry Kortulewski, Paquita Nurden, and Gérard Marguerie

From the Département de Radiobiologie et Radiopathologie, Commissariat à l'Energie Atomique, Evry Cedex, and the Laboratoire d'Hemobiologie, Hôpital Cardiologique, Pessac, France.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

To analyze the transcriptional activity of the gene encoding the alpha  subunit of the platelet integrin alpha IIbbeta 3 during the hematopoietic differentiation, mice were produced in which the herpes virus thymidine kinase (tk) was introduced in this megakaryocytic specific locus using homologous recombination technology. This provided a convenient manner in which to induce the eradication of particular hematopoietic cells expressing the targeted gene. Results of progenitor cell cultures and long-term bone marrow (BM) assays showed that the growth of a subset of stem cells was reduced in the presence of the antiherpetic drug ganciclovir, demonstrating that the activation of the toxic gene occurs before the commitment to the megakaryocytic lineage. Furthermore the knock-in of the tk gene into the alpha IIb locus resulted in the knock-out of the alpha IIb gene in homozygous mice. Cultures of BM cells of these animals, combined with ultrastructural analysis, established that the alpha IIb glycoprotein is dispensable for lineage commitment and megakaryocytic maturation. Platelets collected from alpha IIb-deficient mice failed to bind fibrinogen, to aggregate, and to retract a fibrin clot. Moreover, platelet alpha -granules did not contain fibrinogen. Consistent with these characteristics, the mice displayed bleeding disorders similar to those in humans with Glanzmann thrombasthenia. (Blood. 2000;96:1399-1408)

© 2000 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Circulating blood cells arise from a limited number of pluripotent cells that have the capacity to self-renew and to differentiate into the various hematopoietic lineages. The proliferation and differentiation of pluripotent hematopoietic cells requires a highly complex series of cellular events that are not fully elucidated. Megakaryocytopoiesis starts with the commitment of pluripotent stem cells, continues with a series of mitotic divisions, endomitotic replication, and cytoplasmic maturation of cells, and culminates with the release of platelets into the circulation.1 Each of these phases is controlled by different hematopoietic growth factors and cytokines2,3; the molecular regulation of these events, however, is largely unknown.

Toxins encoded by genes expressed under the control of tissue-specific promoters represent a remarkable tool to analyze complex eukaryotic systems. In particular, the thymidine kinase (tk) gene of the herpes simplex virus, which encodes a protein that is not harmful for eukaryotic cells but could produce a toxic effect when ganciclovir is present, has been successfully used to eradicate selected cell populations.4-9 This has allowed the identification of cells in which specific genes are activated in a given developmental process.

Targeting the expression of an exogenous gene into the entire megakaryocytic pathway requires the use of cis-acting regulatory elements of a lineage-specific gene expressed at an early stage of the differentiation process. The gene encoding the alpha  subunit of the platelet integrin alpha IIbbeta 3 fulfills this criterion.10 Although the beta 3 subunit is synthesized in tissues other than megakaryocytes and platelets and can be associated with the alpha v subunit, the distribution of the alpha IIb subunit appears to be restricted to the megakaryocytic lineage. After the stimulation of platelets with agonists such as adenosine diphosphate (ADP) or collagen, the alpha IIbbeta 3 complex becomes activated, binds to fibrinogen (resulting in platelet aggregation), and prevents blood loss at sites of vascular injury. Glanzmann thrombasthenia, an inherited bleeding disorder in humans, is caused by functional or quantitative abnormal exposure of the alpha IIbbeta 3 integrin at the surface of platelets caused, in molecular terms, by deletions or nucleotide transversions in either of the genes encoding the 2 subunits.11 Glanzmann thrombasthenia has been classified into type 1, type 2, and variants, depending on the amount of alpha IIbbeta 3, the amount of intracellular fibrinogen within platelets, and the residual capacity of platelets to retract clots.12 The ensuing disease is characterized by hemorrhagic episodes caused by the lack of platelet aggregation because of the inability of platelets to bind adhesive proteins when activated. Clinically, patients suffer from frequent mucocutaneous bleeding episodes. Their bleeding times are prolonged, but their blood coagulation times and their platelet counts are normal.

We have previously used fragments of different lengths of the human and the murine alpha IIb promoters to drive the expression of the tk gene in megakaryocytes.9,13 When these transgenic animals were exposed to ganciclovir, an acute cessation of megakaryocytopoiesis occurred that could be reversed by discontinuing the ganciclovir treatment. One of the interesting findings to come out of these studies was that the human and the murine promoters were found to be transcriptionally active in multipotent progenitor cells, suggesting that this megakaryocytic gene is expressed early in the differentiation pathway. The definition of the earliest hematopoietic cell capable of expressing the alpha IIb glycoprotein is of considerable importance because this could specify, at the genetic level, the mechanism(s) by which the megakaryocytic phenotype is established during the differentiation of hematopoietic cells.

Analysis with limited promoter fragments, however, may not account for all the cis-acting regulatory elements involved in the regulation of the expression of the alpha IIb gene. Therefore, in this study, we have used homologous recombination technology to insert the tk gene specifically into the alpha IIb locus to produce mice in which the expression of the knocked-in tk gene will mimic that of the targeted alpha IIb gene. Our results demonstrated that the tk gene is expressed in a pool of primitive multipotent stem cells. Furthermore, the insertion of the tk gene within the alpha IIb locus resulted in the disruption of the endogenous gene and, subsequently, in mice deficient in the alpha IIb glycoprotein. These animals exhibited a bleeding disease closely paralleling that seen in patients with type 1 Glanzmann thrombasthenia.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Construction of the targeting vector

Three clones were isolated from a genomic library using the murine alpha IIb promoter probe as described.13,14 Partial sequencing indicated that the murine and human alpha IIb genes share extensive similarity. Consequently, a 6.3-kb HindIII fragment spanning exons 1 to 7 and 2.7 kb of 5'-flanking sequences of the alpha IIb gene were identified, cloned in pBluescript, and named pHIIIBS. The distal 5'-flanking region of the alpha IIb gene (positions -1914 to -114) was excised from pHIIIBS by BamHI/SalI. The fragment encompassing the tk gene, positioned under the control of the proximal 5'-flanking region of the alpha IIb gene, was excised from plasmid alpha IIbtk-pPNT13 by HindIII-SalI digestion and inserted into a Bluescript plasmid digested by the same enzymes. The distal 5'-flanking region (BamHI/SalI) was then added to assemble the entire promoter region. The neomycin-resistance (NeoR) cassette was introduced 3' of the tk gene after HindIII-NotI digestion of plasmid pPGKNeobpA.15 The targeting vector was completed by the introduction, after the NeoR cassette, of a 3.4-kb PstI fragment encompassing the end of exon 1 to exon 7 (Figure 1A) and thus lacking a DNA fragment coding for the first 14 amino acids of the alpha IIb protein. Linear vector-free insert DNA, prepared by digestion with BamH1, was electroporated into R1 embryonic stem (ES) cells16,17 provided by Dr A. Nagy (Mount Sinai Hospital, Toronto, Canada).


View larger version (38K):
[in this window]
[in a new window]
 
Figure 1. Generation of chimeric mice and progeny genotyping. (A) Schematic representation of the wild-type alpha IIb allele, the targeting vector, and the resultant recombinant alpha IIb locus. Filled rectangles indicate exons. Arrows indicate putative transcription initiation sites. Restriction endonuclease enzymes are abbreviated as follows: H, HindIII; B, BamHI; E, EcoRI; Hc, HincII; RV, EcoRV. Probe A was produced by PCR amplification using oligonucleotides 5'-GCCCATGTGTGTGTATGCC-3' and 5'-CCTCAGGTCTCCATCTTGAACC-3', located within the 5'-flanking region of the alpha IIb gene. Probe B was produced using 2 oligonucleotides, 5'-ACACAGAGAGACCCCCTGTC-3' and 5'-CGGTAGCTGGAGATGATGTTC-3', located within intron 6 and exon 7, respectively. Both probes were labeled by a random priming method using fluorescein-11-dUTP and hybridized according to the manufacturers' recommendations (Gene Image Random prime labeling and CDP star detection System, Amersham). (B) Southern blot analysis of HindIII and EcoRV double-digested DNA of R1 ES cell line (WT) and recombinant clones (lanes 1-4) hybridized with probe A. Targeted clones have both the wild-type (6.3 kb) and the disrupted (3 kb) alleles. (C) Southern blot analysis of HincII and BamHI double-digested DNA of R1 ES cell line (WT) and recombinant clones (lanes 1-4) hybridized with probe B. Recombinant clones have wild-type (4.3 kb) and mutated (7.6 kb) alleles. (D) Southern blot analysis of progeny derived from heterozygous intercross. Tail DNA digested with HindIII and subsequently hybridized to probe A indicated the presence of all expected genotypes, including the predicted 6.3-kb band for the wild-type allele and the 5-kb fragment for the mutant allele. A wild-type (+/+), a heterozygous (+/-), and a homozygous mutant (-/-) offspring are represented.

Generation of chimeras and progeny genotyping

Eight cell-stage embryos (2.5 days postcoitum) were isolated from superovulated OF1/Ico females (Iffa Credo, L'Arbresle, France) mated with males of the same strain. Chimeric mice were generated from these and recombinant ES cells by the aggregation method.18 The resultant mice were bred to derive heterozygous mice, and their genotypes were established by analyzing tail DNA either by Southern blot hybridization or polymerase chain reaction (PCR) amplification performed with alpha IIb (CCGGTGGTGGGAACTTCAGG, CTAGGACCCAAGAACAGTGGTG) and tk primers, as described.13

Assessment of gene expression

Gene expression analysis was performed by Northern blot and by reverse transcription (RT)-PCR of total RNA prepared from mouse tissues using a RNeasy kit (Qiagen, Hilden, Germany). RNA samples were transferred to Hybond N+ nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ) and hybridized with alpha IIb or tk probes. These probes were produced by PCR amplification of wild-type bone marrow (BM) RNA or from plasmid pPNT,19 respectively. RT-PCR was performed as described.13 For the amplification of blood mRNA, samples were diluted 5 times before reverse transcription into cDNA.

Real-time quantitative RT-PCR

A 2-µg sample of total RNA was treated with 1 U RQ1-DNAse. After phenol extraction and ethanol precipitation, cDNA was synthesized by MMLV-RT at 42°C for 30 minutes in a 100-µL cDNA synthesis reaction using random hexamers. A 5-µL cDNA aliquot was used to perform PCR reactions with a SYBR Green PCR kit (Perkin Elmer/Applied Biosystems, Foster City, CA), in the ABI PRISM 7700 detector.20 The conditions for each reaction were 2 minutes at 50°C and 10 minutes at 95°C, followed by 40 cycles (15 seconds at 95°C and 1 minute at 60°C). The primers were chosen with the assistance of the computer program oligo-4 (National Biosciences, Plymouth): alpha IIb, 5'-GTGGGGAAGACGACCTGTGTG-3' and 5'-CAAGCCTCTCAAAGCCCTCAAT-3'; tk, 5'-CCCGGCCCTCACCCTCATC-3' and 5'-AAGGTCGGCGGGATGAGG-3'. Statistics were obtained using Excel computer software (Microsoft, Redmond, WA).

Hematopoietic progenitor assays

BM cells flushed from the femoral cavity were cultured in methylcellulose media, as described.13 In some cases, G418 (1 mg/mL) or ganciclovir (from 1 to 10 µmol/L) were added to the media, as specified in the text.

For long-term cultures, marrow cells were flushed into M5300 liquid medium (Stem Cell Technologies) supplemented with hydrocortisone at a final concentration of 10-6 mol/L to establish adherent marrow feeder layers.21 After 3 weeks, BM of chimeric and control mice were seeded onto irradiated 20 Gy feeder layers. Cultures were maintained at 33°C with weekly half-medium changes and the concomitant removal of nonadherent cells. For the initial 4 weeks, ganciclovir was maintained in the culture medium at a dose of 1 µmol/L. This excluded the possibility that the production of granulocyte macrophage-colony-forming cell (GM-CFC)-derived colonies would arise from late progenitor cells that might persist through this period of culturing. Then ganciclovir was withdrawn from the medium, and the number of GM-CFC was evaluated on an aliquot of nonadherent and adherent cells after 2 additional weeks of culture. Controls without BM seeding were included in each experiment and were never found to have endogenous regeneration, as determined weekly by the absence of GM-CFC-derived colonies.

Immunoblotting of alpha IIb

The alpha IIb protein was assayed by Western blot analysis with a monoclonal antibody (D12A) directed against the human alpha IIb protein produced in our laboratory.

Hematologic parameters

Whole blood was drawn by cardiac puncture into anticoagulant (acid-citrate-dextrose; 10 vol blood:1 vol anticoagulant). Automated blood counts were performed with a Micros Blood Cell Analyzer (ABX).

Bleeding time

Mice were anesthetized with 60 µg avertine (Aldrich), and the bleeding time was measured by gently blotting emerging blood with Whatman 3MM paper every 5 to 10 seconds, as described.22

Fibrinogen binding

Fibrinogen from Diagnostica Stago was iodinated by the chloramine method, as described.23 The PRP was centrifuged at 800g, and the platelet pellet was washed twice in Tyrode buffer (NaHCO3, 12 mmol/L; NaCl, 130 mmol/L; KCl, 2.6 mmol/L; MgCl2, 2 mmol/L; bovine serum albumin, 2%; and dextrose, 5.5 mmol/L). Platelets were resuspended in the same buffer at 100 000 platelets/µL, and a 3-µL aliquot of sodium iodide I 125-fibrinogen (1.5 mg/mL) and 5 µL of CaCl2 (22.6 mmol/L) was added. One half of the platelet sample was activated with 5 µL of ADP (226 µmol/L); 5 µL of Tyrode buffer was added to the second half and used as the nonactivated platelet sample. After 25 minutes, a 50-µL aliquot of each sample was centrifuged on a 15% sucrose solution (in Tyrode buffer) to separate free from bound fibrinogen. Platelet-bound fibrinogen was measured by gamma counting of the cut-tip of the tube.

Standard electron microscopy and immunogold labeling on ultrathin cryosections

For standard electron microscopy, marrow samples were analyzed as described.13,24 For immunogold labeling, cryo-ultrathin sections placed on collodion-coated nickel grids were incubated successively for 1 hour at room temperature with the polyclonal antibodies and then with gold-labeled goat antirabbit IgG (1/50 dilution of AuroProbe EM G10; Amersham, Les Ulis, France).

The expression of the alpha IIbbeta 3 complex and GPIb in megakaryocytes was detected using polyclonal antibodies directed against the human alpha IIbbeta 3 complex and the human GPIb (a generous gift from Dr B. Steiner from Hoffman-La Roche, Basel, Switzerland). The presence of adhesive proteins, such as fibrinogen or von Willebrand factor (vWF), was detected with polyclonal antibodies (DAKO, Glostrup, Denmark).


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Generation of mice with the tk gene inserted into the alpha IIb locus

To monitor the transcriptional activity of the alpha IIb gene, homologous recombination technology was used to generate ES cells and mice harboring the tk gene located in the alpha IIb locus. Several clones having the predicted modification for a replacement event were obtained (Figure 1B,C).

Four of these recombinant ES clones were subsequently used in aggregation experiments. Of the 207 embryos transferred, 52 mice were born; 22 were chimeras, as judged by their pigmented coats, because the ES cells were derived from agouti embryos whereas the receivers were albinos. Thirteen chimeras, ranging from 60% to 100% coat color chimerism, were obtained. Most of these chimeras appeared to be sterile or did not transmit the mutation to their offspring. The sterility of females obtained after homologous recombination events in ES cells has been previously explained by the fact that the injection of ES cells derived from male 129Sv, thus XY, into female embryos results in inappropriate (XYright-arrowXX) combinations of sex genotypes. This might affect the pattern of sexual development.25,26 Sterility of transgenic males harboring the tk gene had been related to the expression of tk from an endogenous cryptic promoter transcriptionally active in testes.27,28 In a few cases, fertile males have been produced9,29; nevertheless, the molecular mechanism has not been clearly identified. In the present study, one male exhibiting approximately 80% chimerism showed normal fertility and germline transmission after crossing with either Balb/c or C57Bl/6. The resultant heterozygous offspring were interbred to generate homozygous mutant mice. To verify whether the tk gene was precisely inserted in the alpha IIb locus, DNA of these mice was analyzed by Southern blot. All the restriction fragments obtained had the predicted size for a correct replacement event. The HindIII restriction is represented in Figure 1D.

tk Expression analysis of mutant mice

To determine whether the tk gene was active when inserted in the alpha IIb locus, BM RNA of wild type, heterozygous, and homozygous mice were analyzed by Northern blot. As illustrated in the upper part of Figure 2, the tk message was detected in heterozygous animals and at higher levels in homozygous mice. As expected, no tk transcripts were found in wild-type mice. To establish the consequence of tk insertion on the expression of the endogenous alpha IIb gene, the same analysis was performed using an alpha IIb probe. In this case, the levels of the alpha IIb mRNA were lower in heterozygous mice than in wild-type animals. No alpha IIb transcripts were found in homozygous mice. This clearly indicated that tk was expressed in these animals and that its integration into the alpha IIb locus impaired the transcription of the endogenous alpha IIb gene. Several other tissues besides BM were also tested. This was performed in heterozygous mice to compare the pattern of expression of the alpha IIb and the tk genes in the same animal. No alpha IIb or tk transcripts were detected in tissues other than BM by this method (not shown). A more sensitive quantification assay was developed to see whether extremely low levels of alpha IIb and tk transcripts were produced in tissues other than BM. The relative quantification was performed using a SYBR Green-based PCR method. A strong linear relationship between the Ctau (the cycle threshold value, predictive of the quantity of input target) and the log of the starting concentration of the cDNA (R2 >=  0.98) was always demonstrated (Table 1, Figure 2B). The results confirmed those of Northern blot analysis, showing that the expression of alpha IIb and tk genes occurs mostly in BM. The tk transcripts, however, were slightly higher than alpha IIb. This might be attributed to the better efficiency and yield of the tk reactions (approximately 82.6%) relative to the alpha IIb reactions (approximately 81%) because of the inherent oligonucleotide sequence or message stability. It should be noted that significant tk transcripts were detected in testes. This was shown to be directed by a cryptic promoter within the tk coding region, which can drive its expression in this organ regardless of the upstream promoter used.27,28


View larger version (46K):
[in this window]
[in a new window]
 
Figure 2. Expression of the tk gene inserted into the alpha IIb locus. (A) Results of Northern blot analysis of BM RNA prepared from wild-type mice (+/+), heterozygous (+/-), and homozygous tk-knocked mice (-/-) are represented. Each lane contains 30 µg total RNA. RNA integrity was determined by gel electrophoresis and visual examination of ethidium bromide-stained ribosomal bands. RNA samples were transferred to Hybond N+ nylon membrane (Amersham) and hybridized with alpha IIb (left) or tk (right) probes. The distortion of the tk band might result because tk transcripts comigrate with the 18S ribosomal RNA. (B) Standard curves for alpha IIb and tk transcripts. Serial dilutions of BM cDNA were used. 10 µL cDNA solution, corresponding arbitrarily to 2000 U, was used as the highest value. Ctau values are plotted against the relative concentration of serial-diluted cDNA. A strong linear relationship between the Ctau (the cycle threshold value predictive of the quantity of input target) and the log of the starting concentration of the cDNA is demonstrated (R2 >=  0.98). (C) Relative expression levels obtained after semiquantitative RT-PCR of RNA prepared from a variety of tissues of heterozygous mice. Duplicates for each sample were performed, but the data for only one is shown here. A negative PCR control without reverse transcription was performed to exclude PCR amplification of contaminating genomic DNA. Dark and dashed boxes correspond to alpha IIb and tk expression, respectively. Lane 1, BM; lane 2, spleen; lane 3, liver; lane 4, lung; lane 5, brain; lane 6, testes; lane 7, heart; lane 8, thymus; lane 9, kidney.


                              
View this table:
[in this window]
[in a new window]
 
Table 1. Threshold cycle values obtained in semiquantitative RT-PCR

Considering that the alpha IIb and the beta 3 genes are closely linked in the same chromosome, the impaired expression of the alpha IIb gene might have altered the expression of the gene coding for the beta  subunit of the alpha IIbbeta 3 complex. To test this possibility, the presence of the beta 3 mRNA was assessed by RT-PCR. The level of the beta 3-cDNA product was similar for homozygous mutant and control mice (Figure 3A), indicating that the transcription of the beta 3 subunit was unaffected in these animals. As a control for mRNA integrity, amplification of the hypoxanthine-phosphoribosyl transferase (HPRT) message was performed.


View larger version (67K):
[in this window]
[in a new window]
 
Figure 3. Molecular phenotype of the Glanzmann thrombasthenic mice. (A) RT-PCR analysis of the expression of genes in wild-type (+/+) and alpha IIb-null mice (-/-). BM RNA was amplified using sense primers (A) and antisense primers (B) as follows. For the alpha IIb gene, 2 different 5'-oligonucleotides were used with the same 3'-primer: alpha IIb1 (A): CCTGTTTAGGACGTTTGGGAAG; alpha IIb2 (A): CACCACTGTTCTTGGGTCCTAG; alpha Iib (B): GGGCGGTAGCTGGAGATGATG; tk (A): CCCCTGCCATCAACACGCG; tk (B): CGATGGGGATGGCGGTCGAAG; beta 3 (A): ACTACACGCACTGACACCTGCATG; beta 3 (B): ACACTCCACACACTCCTTCTT; HPRT (A): GCTGGTGAAAAGGACCTCT; and HPRT (B): CACAGGACTAGAACACCTGC. The sizes of the amplified products are as follows: HPRT, 250 bp; tk, 411 bp; alpha IIb1, 777 bp; alpha IIb2, 677 bp; and beta 3, 123 bp. (C) Product from a control PCR with RT omitted. (B) Immunoblot analysis of platelet proteins from adult wild type (+/+), heterozygous (+/-), and homozygous (-/-) mice. Platelet pellets (50 × 106) were lysed in Tris buffer, 0.125 mol/L, pH 6.8, containing 2.5% SDS, 25% glycerin, 0.5 mg/mL leupeptin (Boehringer), and 2-mercaptoethanol 0.7 mol/L. The solubilized proteins were heated to 100°C for 5 minutes, electrophoresed on a 7.5% polyacrylamide gel, and transferred to a polyvinylidene fluoride membrane (Boehringer). Then alpha IIb was detected using the monoclonal antibody D12A raised against human alpha IIb. Bound primary antibody was developed with a goat antimouse alkaline phosphatase (AP) antibody (Sigma) and enhanced using the CDP-Star chemiluminescence system (Amersham). For the data shown, the film was exposed to the blot for 5 seconds. The only reactive species noted on the blot migrates as predicted for native alpha IIb protein.

Homozygous mutant mice do not synthesize detectable levels of the alpha IIb protein

To examine whether the absence of the alpha IIb mRNA correlated with the absence of alpha IIb protein, immunoblot analysis of platelet proteins was performed using an antibody directed against human alpha IIb. This antibody cross-reacted with murine alpha IIb of wild-type mice. Results revealed a reduction in the level of alpha IIb for heterozygous mice and the absence of alpha IIb in the platelet extract of homozygous animals (Figure 3B). From these observations, we concluded that the integration of the targeting vector into the alpha IIb locus resulted in mice deficient in alpha IIb.

Primitive hematopoietic cells express the toxic gene

To characterize the precise stage of hematopoietic differentiation at which the expression of the tk gene was initiated, the toxic effect of ganciclovir was examined using progenitor cell assays. In the first set of experiments, BM was extracted from alpha IIb-deficient mice and cultured on methylcellulose. The level of tk in these mice proved to be insufficient to produce a toxic effect. This is consistent with the fertility of these male mice, as discussed above. Consequently, progenitor cell assays were performed in 2 other chimeric animals. The direct analysis of chimeric mice to evaluate the consequences of targeted mutations on hematopoiesis has been largely used.30-32 One prerequisite of this analysis, however, is to identify precisely those cells that are derived from the modified ES cells because in chimeras, mutant cells are mixed with wild-type cells. This implied a double selection of cells expressing both the tk and the NeoR genes. To this end, the 13 chimeric mice were tested for the expression of the knock-in tk gene in hematopoietic cells. This was achieved first by determining which of these animals expressed the tk gene in their blood by RT-PCR. Total RNA prepared from whole blood was amplified with tk-specific primers; tk expression represented by a 400-bp cDNA product was found in 6 chimeras. These animals were further analyzed to determine the level of chimerism in BM cells and to identify those hematopoietic progenitors that derive from modified ES cells. This is a critical issue to interpret unambiguously the subsequent results.

To this end, a strategy in which the growth of colonies was evaluated on semisolid assays in the presence of G418 was developed. It was rationalized that all the progenitor cells derived from modified ES cells, possessing the NeoR gene, should produce colonies on serum-free medium in the presence of this drug. In contrast, the growth of colonies derived from wild-type cells should be completely inhibited because these wild-type cells do not possess the NeoR gene. Consequently, BM cells of animals were plated on methylcellulose and cultured under optimal conditions for the growth of CFU-GEMMk and individual committed hematopoietic progenitor cells. First the BM of wild-type mice was cultured in the absence of G418 to determine the number and size of colonies derived from these early progenitor cells in normal conditions. Then it was cultured in the presence of G418 (1 mg/mL) to verify the activity of the drug. The results, summarized in Table 2, showed a total inhibition of the growth of all types of colonies in the presence of G418 for the control mice. When the BM of chimeric mice were plated on methylcellulose, colonies for all hematopoietic lineages were obtained in the presence of G418. This indicated that in these animals, hematopoietic cells of all lineages contained the NeoR and thus derived from a modified recombinant ES cell. Moreover, the number and size of colonies derived from chimeras in the presence or absence of the drug was similar to those derived from BM of a control mouse cultured in standard conditions, further indicating that the insertion of tk per se did not affect the development of hematopoietic cells.

                              
View this table:
[in this window]
[in a new window]
 
Table 2. Analysis of multipotent, mixed, and committed progenitor-derived colonies in semisolid assays

The fact that all the hematopoietic cells in chimeric animals originated from mutant ES cells enabled us to address the key question: at which stage during hematopoietic differentiation was the expression of the tk knock-in gene initiated? To this end, BM cells of chimeric and control animals were cultured on methylcellulose in the presence of ganciclovir. At a dose of 1 µmol/L, the number of all the progenitors derived from the mutant mice was drastically reduced, whereas the drug had no effect on control mice-derived cells, even at a dose of 10 µmol/L (Table 2). These results clearly indicated that the expression of tk was initiated in early multipotent progenitor cells.

Long-term BM cultures were then performed to investigate further whether the expression of tk was initiated in most primitive progenitors, usually referred to as long-term culture initiating cells (LTC-IC). In this set of experiments, control BM cells produced the same number of GM-CFC in the presence or absence of ganciclovir. In contrast, the number of GM-CFC derived from mutant cells was drastically reduced both in the supernatant and in the stromal layer (Table 3). This drastic failure of chimeric BM cells to produce GM-CFC colonies in long-term assays was consistent with the fact that the expression of tk exerted a cytotoxic effect in a pool ofuncommitted primitive hematopoietic cells. From these results we concluded that tk was transcriptionally active in primitive multipotent cells before the occurrence of a megakaryocytic commitment decision.

                              
View this table:
[in this window]
[in a new window]
 
Table 3. Ganciclovir-induced toxicity on LTC-IC after long-term culture assays

Targeting the tk gene to the alpha IIb locus results in mice with a thrombasthenic-like syndrome

Analysis of alpha IIb-deficient mice revealed a hemostatic disorder that prevented them from controlling blood loss. Bleeding persisted for as long as it was monitored (more than 15 minutes). In 12 of 24 adult alpha IIb-null mice studied, severe bleeding diathesis were observed at autopsy. Five of these animals had subcutaneous bleeding, 2 had gastrointestinal hemorrhage, and 3 exhibited urogenital bleeding episodes. Three of 24 alpha IIb-/- mice developed visible intra-abdominal bleeding that did not prove to be fatal. Control and homozygous mutant mice did not show major differences in the number of white cells, red cells, or platelets (Table 4), though in 3 of the alpha IIb-null mice, slight erythrocytopenia was associated with splenomegaly.

                              
View this table:
[in this window]
[in a new window]
 
Table 4. Hematologic analysis of control and mutant mice

Platelets of these alpha IIb-deficient mice were next examined for their capacity to aggregate in response to stimulation. Platelet suspensions were prepared from alpha IIb+/+, alpha IIb+/-, and alpha IIb-/- mice and tested using standard aggregometer assays. Platelets of wild-type animals aggregated promptly, whereas platelets of homozygous mutant animals failed to aggregate in the presence of either ADP or collagen (Figure 4). Platelets from heterozygous animals supported substantial aggregation to both agonists, but the collagen response was significantly delayed, suggesting that an intermediate level of platelet fibrinogen receptors was sufficient to support aggregation. The observed delay in response to collagen, however, suggested that the kinetics of collagen stimulation, which requires ADP secretion, is more dependent on the density of alpha IIbbeta 3 receptors at the surface of the cell.


View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. Aggregation response of platelets derived from alpha IIb+/+, alpha IIb+/-, and alpha IIb-/- mice. Platelets diluted with PBS at a final concentration ranging from 0.5 to 1 × 108 in 336 µL were mixed with 14 µL CaCl2 (1 mmol/L final) and placed in an aggregometer (Chrono-log) at 37°C. Aggregation was initiated by the addition of 18.5 µL ADP (final concentration, 10 µmol/L) or 39 µL collagen (final concentration, 0.2 mg/mL) from Sigma (diagnostic kit for aggregation). Aggregation was monitored by recording the increase in light transmittance as a function of time.

Binding experiments were performed to monitor the capacity of platelets from alpha IIb-deficient mice to interact with fibrinogen. Because of the scarcity of platelet samples derived from each mouse, test and control assays were performed using separate animals. Nonspecific binding was examined in the presence of a 100-fold excess unlabeled fibrinogen, and specific binding to wild-type platelets was taken as 100%. When compared to normal platelets, platelets from alpha IIb+/- exhibited a specific binding capacity of 57% (Figure 5). Platelets of alpha IIb-null mice maintained a specific and displaceable binding of approximately 6% ± 2% of normal. This residual binding might represent differences in genetic backgrounds, variation in fibrinogen samples, or additional fibrinogen binding to glycoproteins other than alpha IIbbeta 3, such as the alpha vbeta 3 integrin. The results, however, clearly indicated that platelets of alpha IIb-/-mice have a severely decreased capacity to bind fibrinogen. Finally, the clot reaction for wild-type mice was completed within a 2-hour period, whereas clot retraction with alpha IIb+/- PRP was delayed and incomplete during this period (Figure 6). PRP from null mice failed to undergo clot retraction as long as the reaction was monitored (15 hours). From these results we concluded that the impaired synthesis of the alpha IIb subunit in these mutant mice lead to a thrombasthenia-like phenotype. Otherwise, the alpha IIb-deficient mice did not reveal any gross anatomic abnormalities. The animals appeared normal at birth, grew to normal size, and were fertile.


View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. Differences in fibrinogen binding of platelet suspensions prepared from wild-type (+/+), heterozygous (+/-), and homozygous (-/-) mice. Filled boxes represent nonstimulated platelets, and striped boxes represent platelets stimulated with 10 µmol/L ADP. Platelets were incubated with 40 µg/mL labeled fibrinogen for 25 minutes at 22°C. Results represent specific fibrinogen binding. Nonspecific binding was evaluated on separate mice because of the scarcity of the platelet sample drawn from each animal.



View larger version (98K):
[in this window]
[in a new window]
 
Figure 6. Platelet-mediated clot retraction. PRP samples prepared from wild-type (+/+), alpha IIb+/-, and alpha Iib-/- mice were clotted by the addition of thrombin, and the progress of clot retraction was followed for 15 hours at 37°C. (A) t = 0 hours. (B) t = 2 hours. (C) t = 15 hours. The platelet-rich plasma (PRP) was obtained by centrifugation at 70g, and plasma was obtained by further centrifugation at 2500g in a F2402 rotor (Beckman). PRP at a concentration of 1 × 105 platelets/µL in 270-µL was incubated at 37°C in the presence of 30 µL CaCl2 (50 mmol/L). Clot formation was performed with 1 U prewarmed human thrombin (Sigma). PRP from wild-type animals had completed the retraction of the opaque clots in a 2-hour period, whereas the clot retraction for the alpha IIb+/- mice was incomplete. PRP of alpha IIb-/- failed to induce clot retraction for 15 hours.

Cellular morphology of BM in mice lacking the alpha IIb gene

Evaluation of the BM ultrastructure of alpha IIb deficient mice by electron microscopy revealed a normal morphology of cells of the megakaryocytic lineage. Megakaryocytes were observed near the vascular sinus in a normal bone microenvironment, where all myeloid lineages were represented. The demarcation membrane system (DMS) with well-defined platelet territories was observed in maturing megakaryocytes. Consequently, their fragmentation into proplatelets was normal. Immunogold staining using polyclonal antibodies revealed the alpha IIbbeta 3 complex in megakaryocyte membranes of wild-type mice. Labeling was seen on the surface, on the DMS, and in association with the alpha -granules membranes (Figure 7A). In contrast, a total absence of alpha IIbbeta 3 complexes was found in all the membrane compartments of megakaryocytes from alpha IIb-deficient mice (Figure 7B). The occasional labeling observed was similar to that seen in control assays performed with nonimmune rabbit IgG and was considered to represent background staining. Labeling of the alpha -granules confirmed the presence of fibrinogen (Figure 7C) in wild-type mice, whereas no labeling was found associated with these organelles in the alpha IIb-deficient mice (Figure 7D). Occasional gold beads were present in the channels of the DMS. This labeling was significant and may represent alpha IIbbeta 3-independent fibrinogen endocytosis, consistent with the transport of fibrinogen from the plasma but without storage in alpha -granules. Labeling of the GP Ibalpha subunit and of vWF was similar for normal and alpha IIb-deficient mice (not shown).


View larger version (133K):
[in this window]
[in a new window]
 
Figure 7. Immunogold labeling of megakaryocytes. Immunogold labeling of megakaryocytes with anti-alpha IIbbeta 3 antibody (A, B) and antifibrinogen antibody (C-G). In both cases, binding of antibodies was revealed with a goat anti-rabbit IgG adsorbed onto 10-nm gold particles. The cryosections embedded in a thin film of methylcellulose were observed with a JEOL JEM-1010 transmission electron microscope at 80 kV. In A, a normal megakaryocyte shows abundant labeling for alpha IIbbeta 3 on the plasma membrane and in the DMS (arrowheads). Occasional beads were seen on the membranes of alpha -granules (inset). In B, little or no staining for alpha IIbbeta 3 was seen on the membranes of the megakaryocytes from an alpha IIb-deficient mouse. In the megakaryocyte of a normal mouse (C), fibrinogen (arrowheads) is essentially present in the alpha -granules (G), as also illustrated at higher magnification (E, F). No labeling was found in the alpha -granules (G) of alpha IIb-deficient mice (D, G), though some labeling was present in externally accessible dilated channels. (A-D) Bars = 0.5 µm; (E-G) Bars = 0.1 µm.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

In this paper, we describe a strategy for analyzing the transcriptional activity of lineage-specific genes during hematopoiesis. A gene encoding a conditional toxin was targeted to a defined locus to induce a restricted cell knockout. The locus of the alpha IIb gene encoding a protein known to be active in platelets, which corresponds to the terminal phase of the differentiation process of the megakaryocyte, was selected. The results show that, although the alpha IIb gene is not critical for the development of the hematopoietic system, it is transcriptionally active in early hematopoietic progenitor cells. This supports the existence of a multilineage gene expression in the stem cell population. In addition, the knock-in of the tk gene into the alpha IIb locus impaired the synthesis of the alpha  subunit of the platelet integrin alpha IIbbeta 3 and resulted in alpha IIb-null mice with a Glanzmann thrombasthenia-like syndrome. The strength of this model is that these mice possess a single molecular defect, and they provide unlimited material for experimental analysis. This is particularly useful given that it is difficult to obtain platelet or BM biopsies from patients with Glanzmann thrombasthenia because of the risk for hemorrhage.

The gene-targeting approach developed here led to the correct insertion of the tk gene in the alpha IIb locus. In heterozygous mice, alpha IIb and tk genes were coexpressed and were found mainly in BM. Using a sensitive quantification assay, trace amounts were detected in spleen and lungs, tissues where megakaryocytes could be found. The only difference seen was the presence of tk transcripts in testes. This testicular expression has been shown to be inherent to the tk gene, which has a cryptic promoter within its coding region that produces a shorter mRNA. Thus, even without a promoter, tk is expressed in this tissue.27,28 The possibility that this cryptic promoter could account for the slight difference in the tk expression and could limit the interpretation of the hematopoietic stem cell experiments cannot be excluded. Although both mRNA are indistinguishable by Northern blot or PCR analysis, such an effect would appear unlikely because the protein synthesized from the cryptic promoter is less efficient than the wild type for the eradication of cells,28 and, in some cases, this truncated mRNA does not result in translation into tk protein.29 Moreover, the same dose of ganciclovir did not eradicate testicular cells in previous alpha IIbtk transgenic mice expressing tk in testes (13 and our unpublished results).

Direct analysis of chimeric mice to evaluate the consequences of targeted lethal mutations on hematopoiesis has been previously used.30-32 A prerequisite of this analysis is to determine precisely whether the cells that are studied originate from the genetically modified cells. We found that mutated ES cells harboring the tk and NeoR genes contributed to the production of all hematopoietic lineages, with an apparent lack of compensation from the wild-type ES cells. This was deduced from results of BM cultures of chimeric mice showing that the growth of colonies derived from CFU-GEMM or all individual monopotent hematopoietic progenitors was not affected in the presence of G418.

The fact that all hematopoietic cells in chimeric mice were derived from mutant ES cells enabled us to undertake the analysis of the tk expression in BM of these animals. The toxic effect of ganciclovir was demonstrated in the multipotent CFU-GEMM progenitor, consistent with the tk expression in these cells. A possible explanation for the ganciclovir sensitivity of early progenitors could be that a nonspecific cell knock-out occurred as a result of the general release of toxic phosphorylated ganciclovir from dying cells specifically expressing tk. Although this bystander effect has been described in other systems,33,34 it would seem to be an unlikely event in this study because most cells are impermeable to phosphorylated nucleotides. This possibility was, in fact, tested in our previous studies in which BM cells of transgenic and control mice were cultured together.13 We showed that co-culturing BM cells of nontransgenic mice in the presence of transgenic BM cells did not reduce the number of expected colonies.

Long-term BM cultures performed on stromal feeders had been largely validated to characterize adherent and nonadherent early hematopoietic cells that have the capacity to express both myeloid and lymphoid differentiation potentials.35,36 These LTC-ICs maintain their capacity to repopulate the hematopoietic system of irradiated mice after long-term engraftment.37-39 Culturing BM cells of chimeric mice for 6 weeks indicated that the toxic gene was expressed in a subset of adherent and nonadherent LTC-ICs. This demonstrates that tk was expressed in a more primitive cell than the CFU-GEMM progenitor when located in the alpha IIb locus. This cell knock-out strategy provides a qualitative analysis, and the subsets of tk-expressing pluripotent hemopoietic stem cells (PHSC) remains to be identified.

The transcriptional activity of the toxic gene in a subset of PHSC indicates that the genetic programs of specific lineages are simultaneously activated in a primed totipotent stem cell. This establishes that the early, undifferentiated cells may express the full repertoire of lineage-specific genes. To date, increasing numbers of reports in the literature are consistent with this model. The coexistence of terminal erythroid and myeloid genetic programs in a permanent cell line exhibiting characteristics of PHSC and the presence of different lineage marker mRNA as c-kit, GATA-2, NF-E2, tal-1, and c-myb in the PHSC was demonstrated.40,41 Other transcription factors representing specific hematopoietic lineages were found in individual quiescent multipotent hematopoietic cells. Furthermore, recent studies show that alternative fates are preserved in stem and progenitor cells by the simultaneous low expression of genes for several lineages.42,43 All these observations challenge current ideas as to how immature cells become committed to producing specific types of progeny cells.

Early reports in the literature suggest the presence of the alpha IIbbeta 3 complex in a totipotent stem cell.44,45 More recent studies performed in the avian hematopoietic system providing evidence that alpha IIbbeta 3+ BM cells can differentiate into T cells46 are consistent with these results. Furthermore, the alpha IIb gene was found to be expressed as early as the mouse blastocysts.47 The protein encoded by the alpha IIb gene, however, is only known to be functionally important in the terminal phase of megakaryocytic differentiation. The functional or quantitative abnormal exposure of the alpha IIbbeta 3 at the surface of platelets results in the human inherited bleeding disorder, Glanzmann thrombasthenia. The mutant mice described in this study have a similar syndrome.

Mice lacking the alpha IIb subunit were born in the correct Mendelian ratio, demonstrating that the alpha IIb subunit is not essential for normal embryonic development. Females were fertile and did not have major delivery problems. In contrast, women with Glanzmann thrombasthenia have severe hemorrhagic episodes at this stage. Furthermore, secondary effects, such as splenomegaly, encountered in some alpha IIb-null animals but not commonly reported in patients with Glanzmann thrombasthenia, were also observed in beta 3-null mice.48 The propensity for intra-abdominal hemorrhage found in alpha IIb-null mice was also seen in mice deficient for alpha IIbbeta 3 ligands such as fibrinogen and vWF.22,49,50 However, mice lacking fibrinogen showed a more severe tendency to bleed. This is perhaps because fibrinogen is involved in other biologic processes51-53 in addition to platelet aggregation and thrombus formation. Considering the similar roles of these ligands and the complexity of the systems in which they are involved, detailed comparative analyses of null mice might provide a means by which to define the precise role of each molecule.

Ultrastructural analysis and immunogold staining using electron microscopy further demonstrated the absence of alpha IIbbeta 3 complexes at the surface of alpha IIb-deficient mice megakaryocytes. These cells displayed normal morphology with normal alpha -granule organization. The development of platelet territories was indistinguishable from that of control mice as found for the human pathology.54

Platelet alpha -granules of alpha IIb-null mice did not contain fibrinogen. A correlation between the absence of the alpha IIbbeta 3 complex at the surface of platelets and the lack of granular fibrinogen within platelets has been reported in patients with Glanzmann thrombasthenia.12,55,56 The production of thrombasthenic mice, in which the only molecular defect is the absence of glycoprotein alpha IIb, provides a definite molecular basis for this correlation and further confirms that the presence of a functional integrin is a prerequisite for the uptake and storage of fibrinogen in alpha -granules. An interesting observation was that fibrinogen was localized within the DMS of mature megakaryocytes lacking the alpha IIbbeta 3 receptor. This suggests that endocytosis of circulating fibrinogen emerges as a complex event that may proceed, at least in part, through an alpha IIbbeta 3 independent mechanism occurring before the alpha IIbbeta 3 mediated storage in alpha -granules.

These results, combined with those obtained with BM cultures, indicated that the alpha IIb subunit does not appear to play a major role in stem cell commitment, hematopoietic progenitor cell development, or megakaryocyte differentiation. This raises the question of the possible role played by this glycoprotein in the establishment of the megakaryocytic phenotype or the differentiation of other hematopoietic lineages. One possibility is that in the absence of this integrin, a compensatory mechanism might develop by which other members of the integrin family would accomplish some of its biologic functions.

The platelet glycoprotein alpha IIbbeta 3 antagonist c7E3 has been approved for human use to reduce the risk for ischemic complications after percutaneous coronary intervention, angioplasty, or atheroctomy.57 However, it still has to be proven whether the beneficial effects of this antibody derive from the alpha Vbeta 3 or the alpha IIbbeta 3 blockade. This is a critical issue for the successful design of effective protocols. Animals lacking alpha IIb described in this study, and those deficient in beta 3,48 might constitute valuable tools for developing comparative assays to define unambiguously the involvement of each integrin in physiological and pathologic processes.

Platelets are involved in a number of vascular diseases, including thrombosis, restenosis, and atherosclerosis. Different transgenic mouse models with an atherosclerotic phenotype have been developed.58,59 Thus, it is now feasible to create a second generation of atherosclerotic animals in which the precise roles of the alpha IIbbeta 3 integrin and platelet aggregation might be assigned. Furthermore, a model for arterial injury has been reported.60 Its use in animals such as alpha IIb-deficient mice could help determine whether this integrin influences the outcome of vascular insult.

In conclusion, alpha IIb-deficient mice constitute a reliable model for type 1 Glanzmann thrombasthenia. Furthermore, the present data strongly support the notion that the expression of lineage-specific genes occurs at the stem cell level. An interesting question that arises from these findings is whether a gene encoding an integrin subunit, which is functionally important in the terminal phase of the megakaryocytic differentiation, is transcriptionally active in a primitive totipotent cell. Clearly, the potential role of the alpha IIb subunit in early hematopoietic development must be further examined.


    Acknowledgments

We thank Dr Nagy for providing the R1 ES cells, Muriel Vernet for assistance with ES cells culture and the production of mice, and Philippe Tropel for assistance with the experimental work. We thank Dr Roland Berthier for help with BM cultures, Dr Jean Jacques Ryckwaert for advice concerning platelet biochemistry, and Hervé Pointu for excellent technical assistance. Finally, we thank Yotis Senis for many valuable comments on the manuscript.


    Footnotes

Submitted January 15, 1999; accepted March 28, 2000.

Supported by the Commissariat á l'Energie Atomique and by a grant from l'Association pour la Recherche sur le Cancer.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Diana Tronik-Le Roux, Commissariat à l'Energie Atomique, Département de Radiobiologie et Radiopathologie, DRR/LRGH, CEA-Evry, 2 rue Gaston Crémieux, 91057 Evry Cedex, France; e-mail: leroux{at}dsvidf.cea.fr.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Hoffman R. Regulation of megakaryopoiesis. Blood. 1989;74:1196-1212[Free Full Text].

2. Kaushansky K. Thrombopoietin: the primary regulator of platelet production. Blood. 1995;86:419-431[Free Full Text].

3. Ellis MH, Avraham H, Groopman JE. The regulation of megakaryocytopoiesis. Blood. 1995;9:1-6.

4. Borelli E, Heyman R, Hsi M, Evans RM. Targeting of an inducible toxic phenotype in animal cells. Proc Natl Acad Sci U S A. 1988;85:7572-7576[Abstract/Free Full Text].

5. Heyman RA, Borrelli E, Lesley J, et al. Thymidine kinase obliteration: creation of transgenic mice with controlled immune deficiency. Proc Natl Acad Sci U S A. 1989;86:2698-2702[Abstract/Free Full Text].

6. Dzierzak E, Daly B, Fraser P, Larsson L, Müller A. Thy-1 tk transgenic mice with a conditional lymphocyte deficiency. Int Immunol. 1993;5:975-984[Abstract/Free Full Text].

7. Kamogawa Y, Minasi LE, Carding SR, Bottomly K, Flavell RA. The relationship of IL-4 and IFNgamma -producing T cells studied by lineage ablation of IL-4 producing cells. Cell. 1993;75:985-995[Medline] [Order article via Infotrieve].

8. Salomon B, Lorès P, Pioche C, Racz P, Jami J, Klatzmann D. Conditional ablation of dentritic cells in transgenic mice. J Immunol. 1994;152:537-548[Abstract].

9. Tronik-Le Roux D, Roullot V, Schweitzer A, Berthier R, Marguerie G. Suppression of erythro-megakaryocytopoiesis and the induction of reversible thrombocytopenia in mice transgenic for the thymidine kinase gene targeted by the platelet glycoprotein alpha IIb promoter. J Exp Med. 1995;181:2141-2151[Abstract/Free Full Text].

10. Phillips DR, Charo IF, Scarborough RM. GPIIb-IIIa: the responsive integrin. Cell. 1991;65:359-362[Medline] [Order article via Infotrieve].

11. Basani RB, Brown DL, Vilaire G, Bennett JS, Poncz M. A Leu117right-arrowTrp mutation within the RGD-peptide cross-linking region of beta 3 results in Glanzmann's thrombastenia by preventing alpha IIbbeta 3 export to the platelet surface. Blood. 1997;90:3082-3088[Abstract/Free Full Text].

12. George JN, Caen JP, Nurden AT. Glanzmann's thrombasthenia: the spectrum of clinical disease. Blood. 1990;75:1383-1395[Free Full Text].

13. Tropel P, Roullot V, Vernet M, et al. A 2.7-kb portion of the 5'-flanking region of the murine glycoprotein alpha IIb is transcriptionally active in primitive hematopoietic progenitor cells. Blood. 1997;90:2995-3004[Abstract/Free Full Text].

14. Denarier E, Martin F, Martineau S, Marguerie G. PCR cloning and sequence of the murine GPIIb gene promoter. Biochem Biophys Res Commun. 1993;195:1360-1364[Medline] [Order article via Infotrieve].

15. Soriano P, Montgomery C, Geske R, Bradley A. Targeted disruption of the c-src proto-oncogene leads to osteopetrosis in mice. Cell. 1991;64:693-702[Medline] [Order article via Infotrieve].

16. Nagy A, Rossant J, Nagy R, Abramow-Nawerly W, Roder J. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc Natl Acad Sci U S A. 1993;90:8424-8428[Abstract/Free Full Text].

17. Wurst W, Joyner AL. Production of targeted embryonic stem cell clones. In: Joyner AL, ed. Gene Targeting, A Practical Approach. Oxford: Oxford University Press; 1993:33-61.

18. Nagy A, Rossant J. Production of completely ES cell derived fetuses. In: Joyner AL, ed. Gene Targeting, A Practical Approach. Oxford: Oxford University Press; 1993:147-179.

19. Tybullewicz VLJ, Crawford CE, Jackson PK, Bronson RT, Mulligan RC. Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene. Cell. 1991;65:1153-1163[Medline] [Order article via Infotrieve].

20. Overbergh L, Valckx D, Waer M, Mathieu C. Quantification of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine. 1999;11:305-312[Medline] [Order article via Infotrieve].

21. Dexter TM, Allen TD, Laijitha LG. Conditions controlling the proliferation of hematopoietic stem cells in vitro. J Cell Physiol. 1977;91:335-344[Medline] [Order article via Infotrieve].

22. Suh TT, Holmbäck K, Jensen N, et al. Resolution of spontaneous bleeding events but failure of pregnancy in fibrinogen-deficient mice. Genes Dev. 1995;9:2020-2033[Abstract/Free Full Text].

23. Marguerie G, Plow EF, Edgington TS. Human platelets possess an inducible and saturable receptor specific for fibrinogen. J Biol Chem. 1979;254:5357-5363[Free Full Text].

24. Poujol C, Tronik-Le Roux D, Tropel P, et al. Ultrastructural analysis of bone marrow hematopoiesis in mice transgenic for the thymidine kinase gene driven by the alpha IIb promoter. Blood. 1998;92:2012-2023[Abstract/Free Full Text].

25. Robertson EJ. Pluripotential stem cell lines as a route into the mouse germ line. Trends Genet. 1986;2:9-13.

26. Papaioannou V, Johnson R. Production of chimeras and genetically defined offspring from targeted ES cells. In: Joyner AL, ed. Gene Targeting, A Practical Approach. Oxford: Oxford University Press; 1993:107-146.

27. Al-Shawi R, Burke J, Wallace H, et al. The herpes simplex virus type 1 thymidine kinase is expressed in the testes of transgenic mice under the control of a cryptic promoter. Mol Cell Biol. 1991;8:4207-4216.

28. Salomon B, Maury S, Loubière L, Caruso M, Onclercq R, Klatzmann D. A truncated herpes simplex thymidine kinase phosphorylates thymidine and nucleoside analogs and does not cause sterility in transgenic mice. Mol Cell Biol. 1995;15:5322-5328[Abstract].

29. Markkula M, Hämäläinen T, Loune E, Huhtaniemi I. The follicle-stimulating hormone (FSH) beta - and common alpha -subunits are expressed in mouse testis, as determined in wild type mice and those transgenic for the beta -subunit/herpes simplex virus thymidine kinase fusion gene. Endocrinology. 1995;136:4769-4775[Abstract].

30. Pevny L, Simon MC, Robertson E. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature. 1991;349:257-260[Medline] [Order article via Infotrieve].

31. Pevny L, Lin CS, D'Agati V, Simon MC, Orkin SH, Constantini F. Development of haematopoietic cells lacking transcription factor GATA1. Development. 1995;121:163-172[Abstract].

32. Tsai FY, Keller G, Kuo FC, et al. An early hematopoietic defect in mice lacking the transcription factor GATA-2. Nature. 1994;371:221-226[Medline] [Order article via Infotrieve].

33. Moolten FL. Tumor chemosensitivity conferred by inserted thymidine kinase genes: paradigm for a prospective cancer control strategy. Cancer Res. 1986;46:5276-5281[Abstract/Free Full Text].

34. Culver KW, Ram Z, Walbridge S, Ishii H, Oldfield EH, Blaese RM. In vivo gene transfer with retroviral vector-producer cells for treatment of experimental brain tumors. Science. 1992;256:1550-1552[Abstract/Free Full Text].

35. Ploemacher RE, van der Sluijs JP, Voerman JSA, Brons NHC. An in vitro limiting-dilution assay of long-term repopulating hematopoietic stem cells in the mouse. Blood. 1989;74:2755-2763[Abstract/Free Full Text].

36. Lemieux ME, Rebel VI, Lansdorp PM, Eaves CJ. Characterization and purification of a primitive hematopoietic cell type in adult mouse marrow capable of lymphomyeloid differentiation in long-term marrow switch cultures. Blood. 1995;86:1339-1347[Abstract/Free Full Text].

37. Harrison DE, Lerner CP, Spooncer E. Erythropoietic repopulating ability of stem cells from long-term marrow culture. Blood. 1987;69:1021-1025[Abstract/Free Full Text].

38. Sutherland HJ, Lansdorp PM, Henkelman DH, Eaves AC. Functional characterization of individual human hematopoietic stem cells cultured at limiting dilution on supportive marrow stromal layers. Proc Natl Acad Sci U S A. 1990;87:3584-3588[Abstract/Free Full Text].

39. Szilvassy SJ, Fraser CC, Eaves CJ, Lansdorp PM, Eaves AC, Humphries RK. Retrovirus-mediated gene transfer to purified hemopoietic stem cells with long-term lympho-myelopoietic repopulating ability. Proc Natl Acad Sci U S A. 1989;86:8798-8802[Abstract/Free Full Text].

40. Hu M, Krause D, Greaves M, et al. Multilineage gene expression precedes commitment in the hematopoietic system. Genes Dev. 1997;11:774-785[Abstract/Free Full Text].

41. Orlic D, Anderson S, Biesecker LG, Sorrentino BP, Bodine DM. Pluripotent hematopoietic stem cells contain high levels of mRNA for c-kit, GATA-2, p45 NF-E2, and c-myb and low levels or no mRNA for c-fms and the receptors for granulocyte colony-stimulating factor and interleukins 5 and 7. Proc Natl Acad Sci U S A. 1995;92:4601-4605[Abstract/Free Full Text].

42. Cory S. Wavering on commitment. Nature. 1999;401:538-539[Medline] [Order article via Infotrieve].

43. Nutt SL, Heavy B, Rolink AG, Busslinger M. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature. 1999;401:556-562[Medline] [Order article via Infotrieve].

44. Berridge MV, Ralph SJ, Tan AS. Cell-lineage antigens of the stem cell-megakaryocyte-platelet lineage are associated with the platelet IIb-IIIa glycoprotein complex. Blood. 1985;66:76-85[Abstract/Free Full Text].

45. Fraser JK, Leahy MF, Berridge MV. Expression of antigens of the platelet glycoprotein IIb-IIIa complex on human hematopoietic stem cells. Blood 1986;68:762-769[Abstract/Free Full Text].

46. Ody C, Vaigot P, Quere P, Imhof BA, Corbel C. Glycoprotein IIb-IIIa is expressed on avian multilineage hematopoietic progenitor cells. Blood. 1999;93:2898-2906[Abstract/Free Full Text].

47. Schultz JF, Mayernik I, Rout UK, Armant DR. Integrin trafficking regulates adhesion to fibronectin during differentiation of mouse peri-implantation blastocysts. Dev Genet. 1997;21:31-43[Medline] [Order article via Infotrieve].

48. Hodivala-Dilke KM, McHugh KP, Tsakiris DA, et al. Beta3-integrin-deficient mice are a model for Glanzmann thrombasthenia showing placental defects and reduced survival. J Clin Invest. 1999;103:229-238[Medline] [Order article via Infotrieve].

49. Holmbäck K, Danton MJS, Suh TT, Daugherty CC, Degen JL. Impaired platelet aggregation and sustained bleeding in mice lacking the fibrinogen motif bound by integrin alpha IIbbeta 3. EMBO J. 1996;15:5760-5771[Medline] [Order article via Infotrieve].

50. Denis C, Methia N, Frenette PS, et al. A mouse model of severe von Willebrand disease: defects in hemostasis and thrombosis. Proc Natl Acad Sci U S A. 1998;95:9524-9529[Abstract/Free Full Text].

51. Plow EF, Edginton TS. Lymphocyte suppressive peptides from fibrinogen are derived predominantly from the Aalpha chain. J Immunol. 1986;137:1910-1915[Abstract].

52. Tang L, Eaton JW. Fibrin(ogen) mediates acute inflammation responses to biomaterials. J Exp Med. 1993;178:2147-2156[Abstract/Free Full Text].

53. Languino LR, Duperray A, Joganic KJ, Fornaro M, Thornton GB, Altieri DC. Regulation of leukocyte-endothelial interaction and leukocyte transendothelial migration by intercellular adhesion molecule I-fibrinogen recognition. Proc Natl Acad Sci U S A. 1995;92:1505-1509[Abstract/Free Full Text].

54. Hourdillé P, Fialon P, Belloc F, Namur M, Boisseau MR, Nurden A. Megakaryocytes from the bone marrow of a patient with Glanzmann's thrombasthenia lacked GP IIb-IIIa complexes. Thromb Haemost. 1986;56:66[Medline] [Order article via Infotrieve].

55. Harrisson P, Debili N, Vainchenker W, et al. Uptake of plasma fibrinogen into the alpha granules of human megakaryocytes and platelets. J Clin Invest. 1989;84:1320-1324.

56. Handagama P, Scarborough RM, Shuman MA, Bainton DF. Endocytocis of fibrinogen into megakaryocytes and platelet alpha -granules is mediated by alpha IIbbeta 3 (glycoprotein IIb-IIIa). Blood. 1993;82:135-138[Abstract/Free Full Text].

57. Coller BS. Platelet GPIIb/IIIa antagonists: the first anti-integrin receptor therapeutics. J Clin Invest. 1997;99:1467-1471[Medline] [Order article via Infotrieve].

58. Plump AS, Smith JD, Hayek T, et al. Severe hypercholesterolemia and atherosclerosis in Apolipoprotein E-deficient mice created by homologous recombination in ES cell. Cell. 1992;71:343-353[Medline] [Order article via Infotrieve].

59. Warden CH, Hedrick CC, Qiao JH, Castellani LW, Lusis AJ. Atherosclerosis in transgenic mice overexpressing Apolipoprotein A-II. Science. 1993;261:469-472[Abstract/Free Full Text].

60. Lindner V, Fingerle J, Reidy MA. Mouse model of arterial injury. Circ Res. 1993;73:792-796[Abstract/Free Full Text].

© 2000 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
B. S. Coller and S. J. Shattil
The GPIIb/IIIa (integrin {alpha}IIb{beta}3) odyssey: a technology-driven saga of a receptor with twists, turns, and even a bend
Blood, October 15, 2008; 112(8): 3011 - 3025.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Y. Bertrand, A. D. Kim, S. Teng, and D. Traver
CD41+ cmyb+ precursors colonize the zebrafish pronephros by a novel migration route to initiate adult hematopoiesis
Development, May 15, 2008; 135(10): 1853 - 1862.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. K. Larson and S. P. Watson
Regulation of proplatelet formation and platelet release by integrin {alpha}IIbbeta3
Blood, September 1, 2006; 108(5): 1509 - 1514.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Oki, J. Kitaura, K. Eto, Y. Lu, M. Maeda-Yamamoto, N. Inagaki, H. Nagai, Y. Yamanishi, H. Nakajina, H. Kumagai, et al.
Integrin {alpha}IIb{beta}3 Induces the Adhesion and Activation of Mast Cells through Interaction with Fibrinogen
J. Immunol., January 1, 2006; 176(1): 52 - 60.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Jacquelin, T. Kortulewski, P. Vaigot, A. Pawlik, G. Gruel, O. Alibert, P. Soularue, C. Joubert, X. Gidrol, and D. T.-L. Roux
Novel pathway for megakaryocyte production after in vivo conditional eradication of integrin {alpha}IIb-expressing cells
Blood, September 15, 2005; 106(6): 1965 - 1974.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T.-T. Li, S. Larrucea, S. Souza, S. M. Leal, J. A. Lopez, E. M. Rubin, B. Nieswandt, and P. F. Bray
Genetic variation responsible for mouse strain differences in integrin {alpha}2 expression is associated with altered platelet responses to collagen
Blood, May 1, 2004; 103(9): 3396 - 3402.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Lu, M. J. Pazin, and K. Ravid
Properties of Ets-1 Binding to Chromatin and Its Effect on Platelet Factor 4 Gene Expression
Mol. Cell. Biol., January 1, 2004; 24(1): 428 - 441.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G.A. Stouffer and S.S. Smyth
Effects of Thrombin on Interactions Between {beta}3-Integrins and Extracellular Matrix in Platelets and Vascular Cells
Arterioscler Thromb Vasc Biol, November 1, 2003; 23(11): 1971 - 1978.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. J. Ferkowicz, M. Starr, X. Xie, W. Li, S. A. Johnson, W. C. Shelley, P. R. Morrison, and M. C. Yoder
CD41 expression defines the onset of primitive and definitive hematopoiesis in the murine embryo
Development, September 15, 2003; 130(18): 4393 - 4403.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. T. Mitjavila-Garcia, M. Cailleret, I. Godin, M. M. Nogueira, K. Cohen-Solal, V. Schiavon, Y. Lecluse, F. Le Pesteur, A. H. Lagrue, and W. Vainchenker
Expression of CD41 on hematopoietic progenitors derived from embryonic hematopoietic cells
Development, March 6, 2003; 129(8): 2003 - 2013.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. K. A. Mikkola, Y. Fujiwara, T. M. Schlaeger, D. Traver, and S. H. Orkin
Expression of CD41 marks the initiation of definitive hematopoiesis in the mouse embryo
Blood, January 15, 2003; 101(2): 508 - 516.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Eto, R. Murphy, S. W. Kerrigan, A. Bertoni, H. Stuhlmann, T. Nakano, A. D. Leavitt, and S. J. Shattil
Megakaryocytes derived from embryonic stem cells implicate CalDAG-GEFI in integrin signaling
PNAS, October 1, 2002; 99(20): 12819 - 12824.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
M. K. Boudreaux and D. L. Lipscomb
Clinical, Biochemical, and Molecular Aspects of Glanzmann's Thrombasthenia in Humans and Dogs
Vet. Pathol., May 1, 2001; 38(3): 249 - 260.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roux, D. T.-L.
Right arrow Articles by Marguerie, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roux, D. T.-L.
Right arrow Articles by Marguerie, G.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2000 by American Society of Hematology         Online ISSN: 1528-0020