Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Costa, J.-M.
Right arrow Articles by Lavergne, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Costa, J.-M.
Right arrow Articles by Lavergne, J.-M.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 August 2000, Vol. 96, No. 4, pp. 1585-1587

BRIEF REPORT

Somatic mosaicism and compound heterozygosity in female hemophilia B

Jean-Marc Costa, Dominique Vidaud, Ingrid Laurendeau, Michel Vidaud, Edith Fressinaud, Jean-Pierre Moisan, Albert David, Dominique Meyer, and Jean-Maurice Lavergne

From the American Hospital of Paris, Neuilly, France; the UPRESS-JE 2195, Faculté de Pharmacie Paris V, Paris, France; the Centre Hospitalier Régional Universitaire, Nantes, France; and the INSERM U 143 and Assistance Publique Hôpitaux de Paris, Hôpital Bicêtre, Bicêtre, France.


    Abstract
Top
Abstract
Introduction
Study design
Results and discussion
References

Sequencing the complete factor IX gene of 2 sisters with hemophilia B with different phenotypes and no family history of hemorrhagic diathesis revealed a common 5' splice site mutation in intron 3 (T6704C) in both and an additional missense mutation (I344T) in one. The presence of dysfunctional antigen in the latter strongly suggested that these mutations are in trans. Neither mutation was found in leukocyte DNA from the asymptomatic parents, but the mother was in somatic mosaicism for the shared splice site mutation. This case illustrates the importance of defining the phenotype and considering somatic mosaicism in sporadic cases. It underlines the limitations of complete gene sequencing for the detection of mosaicism and has implication for genetic counseling. (Blood. 2000;96:1585-1587)

© 2000 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Study design
Results and discussion
References

Hemophilia B is an X-linked bleeding disorder resulting from factor IX (F.IX) deficiency,1-3 caused by a wide range of mutations on the F.IX gene.4 Hemophilia B in girls is extremely rare and results from different mechanisms, the most common of which is skewed inactivation of the normal X chromosome in heterozygous girls.5-10 In some cases, the inactivation process does not seem to be random and occurs by either selection in favor of the activity of an X chromosome involved in a balanced X:autosome translocation11 or as a result of genetic differences affecting the X chromosome inactivation itself.12 More rarely, the phenotypic expression of the disease can be related to compound heterozygosity for hemophilic mutations13 or Turner syndrome.

We present a family (Figure 1) with no prior bleeding history in whom moderate hemophilia B was diagnosed in 2 sisters having different (II3) and identical (II2) levels of F.IX activity (F.IXC) and antigen (F.IXAg). This discrepancy in the coagulation results implies a different molecular basis for hemophilia. Analysis of the F.IX gene nucleotide sequence confirmed this hypothesis: II2 is heterozygous for a null mutation with skewed inactivation of the normal X chromosome; II3 has an additional mutation in trans and is therefore a compound heterozygote. Neither mutation was detected in DNA from the parents. However, maternal buccal and uroepithelial studies showed somatic mosaicism for the mutation shared by the daughters. The second mutation must have resulted from a de novo mutation in the father's gametes.


View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Pedigree, haplotypes, and coagulation and mutation studies. (Top) Pedigree and haplotype results of the family with female hemophilia B. Haplotype analysis by restriction fragment length polymorphism using the enzyme Dde I demonstrates that the 2 affected sisters, II2 and II3, share a common allele (2/1) with the mother (I2), whereas the normal sister (II1) inherited the mother's other allele (2/2). (Bottom) Coagulation and mutation studies. For each member of the family, F.IXC and F.IXAg are indicated as well as the presence (+) or the absence (-) of each characterized mutation.


    Study design
Top
Abstract
Introduction
Study design
Results and discussion
References

Patients and coagulation studies

The proband, a 14-year-old girl with moderate hemophilia B, suffered from hematomas, hemarthrosis, and epistaxis. There was no family history of a bleeding disorder and family studies revealed a milder form of the disease in a sister who suffered only from rare hematomas. The eldest sister and parents were asymptomatic. After informed consent, F.IXC was determined by a modified one-stage assay14 and F.IXAg by an immunoenzymatic method using a commercial kit (Asserachrom F.IXAg, Diagnostica Stago, Franconville, France).

Polymerase chain reaction (PCR) amplification and sequencing

Genomic DNA was prepared from leukocytes using standard procedures.15 All 8 exons, intron-exon boundaries, and 5' and 3' ends of the F.IX gene were amplified by PCR and, after purification on Sephacryl S400 columns (Pharmacia, Orsay, France), fragments were directly sequenced using the ABI PRISM Dye Terminator Cycle Sequencing Reaction Kit (PE Biosystems, Courtaboeuf, France) on an ABI PRISM 377 DNA sequencer according to the manufacturer's specifications.

Competitive oligo priming (COP) PCR

We performed COP PCR according to Tada.16 Leukocyte DNA as well as DNA obtained from uroepithelial and buccal cells were studied by COP with allele-specific primers conjugated to different fluorescent dyes, 6-carboxy-fluorescein (FAM), or tetrachloro-6-carboxy-fluorescein (TET), in conjunction with a common primer. The fluorescence of each dye with respect to its amplified DNA locus is scored on a 373 DNA sequencer as previously described.17 Primer sequences for intron 3 splice mutation are as follows:
  • F.IX-FOR1: 5' (TET) TTGGAAGCAGTATGTTGGC 3'
  • F.IX-REV2: 5' (FAM) TTGGAAGCAGTATGTTGGT 3'
  • F.IX-REV: 5' TCAGGTTGGGAGATTGGGTAT 3'

Chromosome X inactivation

Chromosome X inactivation was analyzed by the method described by Allen18 studying the (CAG) repeat present in the human androgen receptor (HUMARA) gene and determination of the nucleotide sequence of the minimal XIST gene promoter according to Plenge et al.19


    Results and discussion
Top
Abstract
Introduction
Study design
Results and discussion
References

The female proband (II3) had levels of F.IXC of 1 U/dL and F.IXAg of 28 U/dL, indicating moderately severe hemophilia B, and a karyotype of 46,XX. Her sister (II2) had mild hemophilia B with F.IXC and F.IXAg levels of 7 U/dL. The parents (I1 and I2) and elder sister (II1) showed normal coagulation results.

The F.IX gene analysis demonstrated heterozygosity for a unique splice site alteration (T6704C) in the affected sister (II2) as already described in severe hemophiliacs.20 The proband is therefore a carrier for hemophilia B and her low F.IXC and F.IXAg most probably result from a skewed X inactivation.6-8 Inactivation patterns using the HUMARA gene showed that both II1 and II3 had a normal pattern. Unfortunately, X inactivation analysis in the third daughter (II2) was inconclusive because she was not polymorphic for the HUMARA gene (CAG) repeat. But her F.IX level demonstrates that at least a skewed inactivation occurred in the liver.

Families have been identified in which unbalanced X inactivation is apparently inherited as an X-linked dominant trait. A mutation involving a single nucleotide in the promoter region of the XIST gene has recently been shown to underlie a skewed pattern of X inactivation in multiple members of 2 unrelated families.19 Sequencing of the minimal promoter showed a normal nucleotide sequence especially the absence of the C43G mutation previously described by Plenge et al.19

The F.IX gene of the proband (II3) showed the same T6704C mutation as her sister's (II2). However, a second alteration, T31152C, was found in exon 8. This missense mutation, I344T, has not been reported to date but 2 mutations involving the same amino acid residue, I344F and I344S, have been found associated with moderate hemophilia (9th edition of the hemophilia B database; http://www.umds.ac.uk/molgen/haemBdatabase.htm).

The different levels of F.IXC and F.IXAg in II3 are only compatible with the presence of each mutation on different alleles and II3 is therefore a compound heterozygote.

Analysis of 2 intragenic polymorphic markers within the F.IX gene revealed that the 2 sisters, II2 and II3, inherited the same maternal haplotype, different from the normal eldest sister (II1). Therefore, the T6704C is of maternal origin. To investigate the possibility of somatic mosaicism in the mother (I2), DNA studies were performed on peripheral blood leukocytes and uroepithelial and buccal cells. Sequence analysis showed the unequivocal presence of a normal and mutant sequence at nucleotide 6704 in various amounts in these cells. COP PCR analysis confirmed the sequencing results with less than 5% leukocytes but 10% and 30% of uroepithelial or buccal cells, respectively, carrying the mutation. The second mutation of the proband (II3) probably originated in the father's gametes. Using the same approach, search for a mosaicism in the father's buccal and uroepithelial cells for the mutation in exon 8 was negative. Unfortunately, sperm cells were not available and germline mosaicism could not be excluded.

Mosaicism has been documented for chromosomal abnormalities, mitochondrial mutations, triplet repeats, and mutations in a growing number of dominant and X-linked single gene disorders.21 For X-linked disorders, the detection of somatic mosaicism implies prior knowledge of the deleterious mutation. Actually, the method of choice for identification of the deleterious mutation relies on DNA sequencing, but the ability of this method to detect somatic mosaicism is poor because the ratio of the mutant to the wild-type allele can be quite small.

Somatic mosaicism may be more common than previously thought.22,23 In sporadic cases of hemophilia one must always consider the possibility of maternal somatic/germline mosaicism and therefore systematically examine buccal and uroepithelial DNA. In this family, the mother (I2) must be considered as a carrier even if the germinal mosaicism cannot be documented.

Moreover, the implication of the compound heterozygosity in II3 is that any male child has F.IX deficiency. Altogether, these results confirm the initial hypothesis based on coagulation studies that the molecular basis of hemophilia B in these 2 girls is different. Without determination of both low F.IXC and F.IXAg, such a hypothesis could not have been verified and if the entire F.IX gene had not been studied, one of the 2 mutations could have been overlooked with important consequences in genetic counseling.


    Acknowledgment

We wish to thank Dr John F. Davidson for helpful advice.


    Footnotes

Submitted October 13, 1999; accepted April 5, 2000.

Supported by a grant from Baxter Laboratories.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: J. M. Lavergne, INSERM U143, Hôpital Bicêtre, 94275 Bicêtre Cedex, France; e-mail: lavergne{at}infobiogen.fr.


    References
Top
Abstract
Introduction
Study design
Results and discussion
References

1. Thompson AR. Structure, function and molecular defects of the factor IX. Blood. 1986;67:565-572[Free Full Text].

2. Kurachi K, Kurachi S, Furukawa M, Yao SN. Biology of factor IX. Blood Coagul Fibrinolysis. 1993;4:953-973[Medline] [Order article via Infotrieve].

3. Yoshitake S, Schach BG, Foster DC, Davie EW, Kurachi K. Nucleotide sequence of the gene for human factor IX (antihemophilic factor B). Biochemistry. 1985;24:3736-3750[Medline] [Order article via Infotrieve].

4. Green PM, Bentley DR, Mibashan RS, Nilsson IM, Giannelli F. Molecular pathology of hemophilia B. EMBO J. 1989;8:1067-1072[Medline] [Order article via Infotrieve].

5. Kitchens CS. Discordance in a pair of identical twins carriers of factor IX deficiency. Am J Hematol. 1987;24:225-228[Medline] [Order article via Infotrieve].

6. Nisen PD, Waber PG. Nonrandom X chromosome DNA methylation patterns in hemophilic females. J Clin Invest. 1989;83:1400-1403.

7. Kling S, Coffey AJ, Ljung R, et al. Moderate hemophilia B in female carrier caused by preferential inactivation of the parental X chromosome. Eur J Hematol. 1991;47:255-261.

8. Wadelius C, Lindstedt M, Pigg M, Egberg N, Pettersson U, Anvret M. Hemophilia B in a 46, XX female probably caused by non-random X inactivation. Clin Genet. 1993;43:1-4[Medline] [Order article via Infotrieve].

9. Naumova AK, Plenge RM, Bird LM, et al. Heritability of X chromosome-inactivation phenotype in a large family. Am J Hum Genet. 1996;58:1111-1119[Medline] [Order article via Infotrieve].

10. Lyon MF. Gene action in the X-chromosome of the mouse. Nature. 1961;190:372-373[Medline] [Order article via Infotrieve].

11. Zabel BU, Baumann WA, Printke W, Gerhard-Ratschow K. X-inactivation pattern in three cases of X/autosome translocation. Am J Hum Genet. 1978;1:309-317.

12. Orstavik KH, Orstavik RE, Eiklid K, Tranebjaerg L. Inheritance of skewed X chromosome inactivation. Am J Med Genet. 1996;64:31-34[Medline] [Order article via Infotrieve].

13. Windsor S, Lyung A, Taylor SA, Ewenstein BM, Neufeld EJ, Lillicrap D. Severe hemophilia A in a female resulting from two de novo factor VIII mutations. Br J Haematol. 1995;90:906-909[Medline] [Order article via Infotrieve].

14. Langdell RD, Wagner RH, Brinkhous KM. Effect of anti-hemophilic factor IX on one stage clotting test. J Lab Clin Med. 1953;41:637-641[Medline] [Order article via Infotrieve].

15. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.

16. Tada M, Omata M, Kawai S, et al. Detection of ras gene mutations in pancreatic juice and peripheral blood of patients with pancreatic adenocarcinoma. Cancer Res. 1993;53:2472-2474[Abstract/Free Full Text].

17. Lazar V, Diez SG, Laurent A, et al. Expression of human chorionic gonadotropin b subunit in superficial and invasive bladder carcinomas. Cancer Res. 1995;55:3735-3738[Abstract/Free Full Text].

18. Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X-chromosome inactivation. Am J Hum Genet. 1992;51:1229-1239[Medline] [Order article via Infotrieve].

19. Plenge RM, Hendrich BD, Schwartz C. A promoter mutation in XIST gene in two unrelated families with skewed X-chromosome inactivation. Nat Genet. 1997;17:353-356[Medline] [Order article via Infotrieve].

20. Giannelli F, Green PM, Sommer SS, et al. Hemophilia B: a database of point mutations and short additions and deletions, 8th ed. Nucleic Acids Res. 1998;26:265-268[Abstract/Free Full Text].

21. Bernards A, Gusella JF. The importance of genetic mosaicism in human disease. N Engl J Med. 1994;331:1447-1449[Free Full Text].

22. Evans DGR, Wallace AJ, Wu CL, Trueman L, Ramsden RT, Strachan T. Somatic mosaicism: a common cause of classic disease in tumor-prone syndromes? Lessons from type 2 neurofibromatosis. Am J Hum Genet. 1998;63:727-736[Medline] [Order article via Infotrieve].

23. Taylor SA, Deugau KV, Lillicrap DP. Somatic mosaicism and female-to-female transmission in a kindred with hemophilia B (factor IX deficiency). Proc Natl Acad Sci U S A. 1991;88:39-42[Abstract/Free Full Text].

© 2000 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Med. Genet.Home page
V. Bourdon, C. Philippe, T. Bienvenu, B. Koenig, M. Tardieu, J. Chelly, and P. Jonveaux
Evidence of somatic mosaicism for a MECP2 mutation in females with Rett syndrome: diagnostic implications
J. Med. Genet., December 1, 2001; 38(12): 867 - 871.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Costa, J.-M.
Right arrow Articles by Lavergne, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Costa, J.-M.
Right arrow Articles by Lavergne, J.-M.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2000 by American Society of Hematology         Online ISSN: 1528-0020